Near Full-Length Genetic Analysis of HIV Sequences Derived from Cyprus: Evidence of a Highly Polyphyletic and Evolving Infection

Abstract

The molecular epidemiology of HIV-1 infection was previously studied in Cyprus but the degree of HIV-1 diversity has remained indefinable. The main objective of the present study is to examine HIV-1 strains isolated from 77 HIV-1-infected individuals representing 38% of the known infected population in Cyprus in the period 1986 to 2006. DNA of the near full-length genome encoding gag, pol, vif, vpr, vpu, tat, rev, env, and 5′-end of nef was amplified by nested PCR/RT-PCR from all HIV-1 seropositives and sequenced using a newly designed assay. Detailed phylogenetic and bootscanning analyses were performed to determine phylogenetic associations and subtype assignments. Phylogenetic analyses of the obtained viral sequences indicated that subtype B was the dominant subtype (61%), followed by subtype A (23.3%), subtype C (5.2%), CRF02_AG (3.9%), and subtype D, CRF01_AE, and CRF04_cpx (1.3% each). Two HIV-1 isolates (2.6%), originating from the Democratic Republic of Congo (DRC), were not classified in any pure (sub)subtype or circulating recombinant form (CRF). Complete phylogenetic and bootscanning analyses revealed that one of these isolates had a new, unique recombinant pattern, comprising segments of subtypes D and G, and is distinct from any other CRFs or URFs reported so far. Detailed analyses of the sequence of the second isolate, which could not be classified, reveal that it is close to subtype K reference sequences but clusters near the root of the clade. At least two epidemiologically unrelated HIV-1 seropositives with an HIV-1 variant similar to this isolate are required to designate this variant as a novel HIV-1 subtype or subsubtype of subtype K. Analogous to results of the earlier epidemiological studies, these data exhibit the extensive heterogeneity of HIV-1 infection in Cyprus, which is being fueled by a continuous entry of new strains from other countries, creating an evolving and polyphyletic infection.

Introduction

H uman immunodeficiency virus type 1 (HIV-1) has the ability to develop extensive genetic diversity due to the fast turnover of virions in HIV-1 seropositives and the high error and recombination rates of the reverse transcription process.^1

–4 Phylogenetic analysis of HIV-1 strains has revealed the complexity of the virus, with nine distinct phylogenetic subtypes (A–D, F–H, J, and K) of the major group M that are associated with the global pandemic, and at least 43 intersubtype recombinants responsible for the epidemic spread, known as circulating recombinant forms (CRFs).^5
–7 In addition, there are various unique recombinant forms (URFs) in a population in which multiple HIV-1 strains cocirculate, which are detected either within a single individual or a single epidemiologically linked cluster in the region.⁸ The constant pursuit of the genetic diversity of HIV-1 infection is important for monitoring the global evolution of HIV-1 and tracking the origin and spread of HIV-1 variants to different geographic areas and populations. Furthermore, it ensures the efficacy of viral RNA quantitation methods^9

–14 and future vaccine development.^15

–18

The first AIDS patient in Cyprus was reported in 1986 and in 1994 the first molecular epidemiological study of HIV-1 infection in Cyprus was carried out.¹⁹ The study was based on phylogenetic analysis of viral sequences encoding the C2 to V3 env gp120 region from 24 patients infected from 1987 to 1994. Subtype B was found to be the dominant strain accounting for 63% of the infections, followed by subtypes C and I (later determined as CRF04_cpx²⁰) 4% each, and two distinct clusters in which one was related to subtype A (21%) and the other to subtype F (8%).¹⁹ This subtype heterogeneity was confirmed in a subsequent study,²¹ where HIV-1 strains from 37 newly diagnosed untreated HIV-1 patients in the period 2003 to 2006 were characterized based on phylogenetic analyses of obtained viral sequences encoding the gag region, the pol (protease and reverse transcription, RT), and the env (gp160). Subtype A was identified as the most prevalent subtype accounting for 38% of the newly diagnosed infections, followed by subtype B (35%), subtype C (13%), CRF02_AG (8%), and subtypes D and CRF01_AE (3% each). The diversity of HIV-1 subtypes in Cyprus is extensive and led us to assume that HIV-1 isolates from Cyprus might be uncommonly heterogeneous, including new variants or recombinant forms. As part of a growing effort to monitor and characterize the molecular epidemiology of HIV in Cyprus, in this study we determined the genetic diversity among HIV-1 strains isolated from 77 HIV-1 seropositives diagnosed from 1986 to 2006 by means of a near full-length genome sequence analysis.

Materials and Methods

Study subjects

For the period 2003 to 2006 blood samples were obtained from 77 consenting HIV-1-infected individuals from the Cyprus Reference AIDS Clinic of Larnaca National Hospital. All HIV-1 study subjects were diagnosed from 1986 to 2006 and represent 38% of the living known infected population diagnosed from 1986 to 2006. The majority of study subjects were Greek-Cypriots, although a number reported traveling or living abroad in the past. All blood samples were processed at the Laboratory of Biotechnology and Molecular Virology of the University of Cyprus within the same day of sampling.

PCR amplification of near-full genome and sequencing

Patient's blood (16 ml) was collected in CPT tubes (Becton Dickinson, Annapolis, MD); peripheral blood mononuclear cells (PBMCs) and plasma were isolated using the CPT vacutainer procedure. HIV-1 RNA was extracted from 200 μl of plasma and genomic DNA was extracted from about 10⁷ uncultured PBMCs using the QIAamp UltraSens Virus Kit and QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA), respectively. HIV-1 sequences encoding approximately 1722 bp of the gag region, 1461 bp of the pol (protease and RT) region, 3118 bp of the pol (RNase H, integrase IN) region and vif, vpr, and vpu genes, and 2927 bp of the env (gp160) and 5′-end of the nef region were amplified from each sample by nested polymerase chain reaction (PCR) applying PBMC-associated HIV-1 DNA (Fig. 1A, B, C). For any samples in which the PCR product of genomic DNA was problematic, reverse transcription nested PCR (RT-PCR) using plasma HIV-1 RNA was performed instead. Primers used in the PCR and/or RT-PCR reactions are described in Table 1 and their positions correspond to the HXB2 strain (accession number K03455). Reagents and thermocycling profiles for the amplification of each region have been described elsewhere.^21,22 Amplified products from the second-round PCR were purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA). Their lengths were analyzed by 1% agarose gel electrophoresis and the concentrations were quantified by UV absorbance spectrophotometry using the Nanodrop ND-1000 Spectrophotometer (Nanodrop Technologies, Wilmington, DE). In each sample, the DNA sequences encoding the gag, pol (protease and RT), and pol (RNase H and IN) region and vif, vpr, and vpu genes and the env (gp160) region and 5′-end of nef were determined by direct sequencing in separate reactions, using second-round-amplified PCR product as the template and sequencing primers (Table 1, Fig. 1D). Reagents and thermocycling profiles used in each amplification reaction of sequencing are described elsewhere.^21,22 Amplicons were sequenced with the ABI 3130 genetic analyzer (Applied Biosystems, Foster City, CA). Samples exhibiting partial or extensive viral diversity by direct sequencing were subsequently cloned, using the TOPO TA cloning kit for sequencing (Invitrogen Corp., San Diego, CA), and sequenced as described. The sequence data were analyzed and edited using the Sequencing analysis 5.2 program (Applied Biosystems, Foster City, CA) and the Primer Premier 5 application (Primer Biosoft International, Palo Alto, CA). The sequence fragments of each of the four amplified regions were assembled manually, with overlapping segments removed to acquire the near full-length sequences for each sample.

FIG. 1.

Schematic representation summarizes the amplification of the new full-length genome region within HIV-1 M group subtypes used in an assay described in this study. (A) The upper diagram summarizes the overall HIV-1 genetic organization exemplified by the HXB2 genome (GenBank accession number K03455). The beginning and end of each major genetic region are indicated by a corresponding number above and below the diagram, respectively, using the HXB2 numbering. Shaded area in the HIV-1 gene map indicates the gag, pol, vif, vpr, vpu, tat, rev, env, and 5′-end of nef regions amplified in the assay. (B) The second scheme summarizes the primary reaction of the nested PCR/RT-PCR designed for the amplification of the near full-length genome in four overlapping regions. Black arrows indicate the orientation and 5′-end-primer-binding positions of the primary PCR primers for each region with respect to the HXB2 genome: 623 and 2501 for gag; 1832 and 3583 for protease and RT genes; 2621 and 6883 for RNase H, integrase, vif, vpr, and vpu genes and first exons of tat and rev; 5955 and 9181 for gp160 and the 5′-end of nef. The intermittent cylinders indicate the product of the primary PCR/RT-PCR reaction. (C) The third diagram summarizes the secondary PCR reaction. Black arrows show the orientation and 5′-end-primer-binding positions of the secondary PCR primers for each region: 684 and 2406 for gag; 2078 and 3539 for protease and RT genes; 3241 and 6359 for RNase H, integrase, vif, vpr, and vpu genes and first exons of tat and rev; 6111 and JL88 for gp160 and the 5′-end of nef and the sequencing primers. Secondary PCR primers marked by an asterisk (see the corresponding number above the diagram) are also used as sequencing primers. The solid cylinders indicate the product of the secondary PCR. (D) Cylinders indicate the sequence segments obtained from each sequencing primer. The beginning and end of each segment are indicated by a corresponding number above and below the diagram, respectively.

Table 1.

PCR and Sequencing Primers

Designation a	Target gene	Sequence b	Position c	Reference d
PCR primers
623 (F)	gag	AAATCTCTAGCAGTGGCGCCCGAA	623–646	51
2501 (R)	gag	GTTGACAGGTGTAGGTCCTAC	2481–2501	51
684 (F)e	gag	TCTCGACGCAGGACTCGGCTTG	684–705	21
2406 (R)e	gag	CTCCAATTCCYCCTATCATTTTTGGTTTCC	2377–2406	21
1832 (F)	pol	CAGCATGYCAGGGAGTRGGRGGACC	1832–1856	21
3583 (R)	pol	GGYTCTTGRTAAATTTGATATGTCCATTG	3555–3583	21
2078 (F)	pol	AGGCTAATTTTTTAGGGAARATYTGGCCTTCC	2078–2109	21
3539 (R)	pol	CTGTATTTCTGCTAYTAAGTCTTTTGATGG	3510–3539	21
2621 (F)	int	GCCATTGACAGAAGARAAAATAAAAGCATT	2621–2650	22
6883 (R)	int	GGRGCACAATAATGTATRGGAATTGG	6858–6883	22
3241 (F)e	int	GDTATGAACTCCATCCTGAYAAATGGAC	3241–3268	22
6359 (R)e	int	CCACACAGGTACCCCATARTADAC	6336–6359	22
5955 (F)	env	GCTTAGGCATCTCCTATGGCA	5955–5975	21
9181 (R)	env	GTGTGTAGTTYTGCCAATCAGG	9160–9181	21
6111 (F)e	env	TMATAGCAATAGTTGTGTGGACYATAG	6111–6137	21
JL88 (R)e	env	TAAGTCATTGGTCTTAAAGGTACCTG	9013–9038	51
Sequencing primers
1173 (F)	gag	CAGYCAAAATTAYCCTATAGTGCA	1173–1196	21
1985 (R)	gag	CCTTCYTTGCCACARTTGAAACAY	1962–1985	21
2136 (F)	pol	YCAGARCAGACCAGAGCCAACAGCCCC	2136–2162	21
3462 (R)	pol	CTGCCARTTCTARYTCTGCTTC	3441–3462	21
3777 (F)	int	TGGATTCCTGARTGGGARTTTG	3777–3798	22
4236 (F)	int	GATGGVATAGATAARGCYCAAGA	4236–4258	22
5342 (R)	int	YCAGGRTCTAYTTGTGTGCTAT	5321–5342	22
5804 (R)	int	CCTATTCTGCTATGTTGRCACCC	5782–5804	22
6438 (F)	env	CATGCCTGTGTACCCACAGA	6438–6457	21
6858 (F)	env	CCAATTCCYATACATTATTGTGCYC	6858–6882	21
8039 (R)	env	GGTGCARATGWGTTTTCCAGAGC	8017–8039	21
8530 (R)	env	TGGTAGCTGAAGAGGCACAG	8511–8530	21

Reverse transcriptase, primary and secondary PCR primers, and sequencing primer names as these appear in the text; the orientation of the PCR primer is indicated in parenthesis: F, forward; R, reverse.

Y, indicates equal molar mixture of C and T; R, A, and G; M, A, and C; W, A, and T; V, A, C, and G.

Primer positions correspond to subtype B HIV-1 HXB2 strain (accession number K03455).

Salminen et al.,⁵¹ Kousiappa et al.,²¹ Loizidou et al.²²

Used also as sequencing primers as described in the text.

Phylogenetic analysis

Bionumerics 5.0 program²³ was used for multiple DNA alignment. The Molecular Evolution Genetic Analysis (MEGA) software was used for distance calculation and phylogenetic tree construction.²⁴ Study subjects' DNA sequences encoding near full-length viral regions were aligned against corresponding near full-length genome sequences of genetically characterized HIV-1 strains obtained from the Los Alamos database.⁵ Pairwise distance matrices were calculated using the Kimura two-parameter distance estimation approach with a transition/transversion ratio of 2.0 and phylogenetic trees were constructed using neighbor joining (NJ). The consistency of the phylogenetic clustering was tested using bootstrap analysis with 1000 replicates. For one isolate the phylogenetic analysis was confirmed by using the maximum-likelihood (ML) model with the Jukes-Cantor evolutionary model. Bootstrap values above 70 were considered adequate for subtype assignment. The subtype assignment was confirmed using the REGA algorithm.²⁵ GenBank accession numbers for control reference sequences in phylogenetic analyses are as follows: A1-PS1044, DQ676872; A1-92UG037, AB253429; A1-94Q2317, AF004885; A1-92RW008, AB253421; A2-97CDKTB48, AF286238; A2-94CY01741, AF286237; A2-97CDKS10, AF286241; B-83HXB2.LAI.IIIB.BRU, K03455; B-981058, AY331295; B-90BK132, AY173951; B-0067100T36, AY423387; B-98153841, DQ853463; C-92BR025d, U52953; C-86ETH2220, U46016; C-04SK164B1, AY772699; C-95IN21068, AF067155; D-01A280, AY253311; D-94UG114, U88824; D-83ELI, K03454; D-01CM4412HAL, AY371157; F1-93VI850, AF077336; F1-93FIN9363, AF075703; F1-9393BR020-1, AF005494; F1-96MP411, AJ249238; F2-95MP255, AJ249236; F2-95MP257, AJ249237; F2-02CM0016BBY, AY371158; F2-97CM53657, AF377956; G-93HH8793121, AF061641; G-96DRCBL, AF084936; G-92NG083, U88826; G-PT2695, AY612637; H-93VI997, AF190128; H-90056, AF005496; H-93VI991, AF190127; J-94SE7022, AF082395; J-93SE7887, AF082394; J-97DCKTB147, EF614151; K-97EQTB11C, AJ249235; K-96MP535, AJ249239; 01AE-90CM240, U54771; 01AE-93TH051, AB220944; 02AG-IBNG, L39106; 02AG-99pBD615, AY271690; 04cpx-97PVMY, AF049337; and 04cpx-9197PVCH, AF049292.

Analysis of the intersubtype mosaicism

To explore putative recombination patterns in the sequences we performed a bootscanning analysis using Simplot, version 3.5.1,²⁶ which is a sliding window approach that allows identification and evaluation of the putative intersubtype recombination breakpoints of the query sequence by the graphic detection of a change in the phylogenetic signal. For the query sequence we run similarity and bootscanning analyses against a pure subtype reference set. Bootscanning was performed with a sliding window of 400 nucleotides overlapped by 40 nucleotides to define the recombinant structure. Subregion confirmatory NJ tree analyses were carried out using MEGA software²⁴ to confirm the subtype origin within each gene fragment. Bootstrap analysis (1000 replicates) was used to estimate the reliability of the constructed trees and a bootstrap value of 70% was considered to be definitive. To look for any potential relationships between possible recombinant sequences and previously characterized HIV-1 sequences, a BLAST search was performed using the default settings in the HIV BLAST tool available at the Los Alamos HIV Sequence Database.^27,28

Results

Clinical and epidemiological features of the study subjects

The study group consisted of 77 HIV-1 seropositives and each subject is identified by a laboratory registration number ascending in chronological order of blood drawn. The study subjects represent 38% of the HIV-1-infected individuals diagnosed from 1986 to 2006. Blood samples from all study subjects were withdrawn in the period from 2003 to 2006. The general demographic, epidemiological, and clinical features of all study subjects are summarized in Table 2. Among the 77 study subjects, 56 (72.7%) were male and 21 (27.3%) were female. Their median age was 38 years and interquartile range (IQR) 32 to 47. The median CD4⁺ lymphocyte count was 448 cells/mm³ (IQR, 232 to 651) and the median plasma HIV load was 3.59 log HIV-1 RNA copies/ml (IQR, 1.7 to 4.6). Fifty-six HIV-1 seropositives are Cypriots (72.7%); seven are from sub-Saharan Africa (9.1%), seven, from eastern Europe (9.1%), six from western Europe (7.8%); and one (1.3%) from the United States. Thirty-seven study subjects (48.0%) were infected by homosexual/bisexual contact, 39 (50.6%) by heterosexual contact, and one (1.3%) by intravenous drug use. Thirty-one subjects (40.2%) were infected in Cyprus, 17 (22.1%) in western Europe, 4 (5.2%), in eastern Europe, 11 (14.3%), in countries of sub-Saharan Africa, 2 (2.6%) in the United States, and 1 (1.3%) in southeast Asia. For 11 study subjects (14.3%) the country in which the infection was most likely contracted is unknown. Among study subjects there are four heterosexual couples, one infected in the UK, one in Georgia, the other in Cyprus, and the last with an unknown place of infection.

Table 2.

Clinical and Epidemiological Information for Study Patients

Patient a	Sex b	Age (years)	Positive test date c	Country of origin d	Risk group e	CD4 (cells/mm³)	Plasma HIV-1 RNA (copies × 10⁴/ml)	Epidemiological information f
CY018	M	35	12/97	Cyprus	MSM	570	<50	Infected in Cyprus
CY020	F	41	01/97	Cyprus	HSX	324	<50	Infected in Cyprus
CY021	M	33	03/04	Georgia	HSX	309	0.1	Infected in Georgia
CY022	M	28	05/04	Cyprus	MSM	290	2.7	Infected in Cyprus; HBV positive
CY023	F	22	01/05	Georgia	HSX	369	0.1	Infected in Cyprus
CY028	M	49	02/97	Cyprus	MSM	99	60.1	Infected in United Kingdom; HBV positive
CY029	M	38	03/97	Cyprus	MSM	512	<50	HBV positive
CY030	M	45	03/98	Cyprus	MSM	282	<50	N/A
CY031	M	45	05/01	Cyprus	MSM	805	<50	Infected in Greece; HBV positive
CY032	M	41	04/01	Cyprus	MSM	987	<50	N/A
CY033	M	44	04/01	Cyprus	MSM	606	0.1	N/A
CY035	M	30	04/05	Cyprus	MSM	191	54.6	Infected in Greece
CY036	F	49	03/97	Cyprus	HSX	764	<50	Infected in Cyprus; HCV positive
CY037	F	35	07/99	U.K.	HSX	N/A	N/A	Infected in United Kingdom; heterosexual partner of CY038
CY038	M	46	07/99	Cyprus	HSX	426	0.1	Infected in United Kingdom; heterosexual partner of CY037
CY040	M	63	06/00	Cyprus	HSX	482	0.3	Infected in South Africa
CY048	M	33	05/05	Burkina-Faso	MSM	181	27.4	Infected in Burkina-Faso
CY051	F	N/A	03/02	Cyprus	HSX	500	<50	N/A
CY055	M	41	03/02	Cyprus	MSM	845	0.1	Infected in Cyprus
CY056	M	51	06/02	Cyprus	MSM	470	1.0	Infected in Cyprus
CY057	F	31	06/05	Georgia	HSX	N/A	2.8	Infected in Georgia; heterosexual partner of CY058; HCV positive
CY058	M	37	06/05	Georgia	HSX	N/A	3.2	Infected in Georgia; heterosexual partner of CY057; HCV positive
CY063	M	40	04/95	Rep. Congo	HSX	7	0.1	Infected in DRC
CY064	M	53	02/96	Cyprus	HSX	448	<50	Infected in Cyprus
CY065	F	50	07/00	Greece	HSX	263	10.6	Infected in Greece
CY067	M	40	02/98	Cyprus	MSM	1200	<50	Infected in Ukraine
CY068	M	57	02/97	Cyprus	MSM	240	0.1	Infected in Greece
CY069	M	84	10/99	Cyprus	HSX	191	0.4	Infected in South Africa
CY070	M	47	02/00	Cyprus	MSM	1103	<50	Infected in Cyprus
CY072	F	36	04/03	Russia	HSX	1276	0.4	Infected in Cyprus
CY074	M	40	08/98	Cyprus	MSM	163	<50	N/A
CY075	F	32	10/95	Belarus	HSX	636	<50	Infected in Cyprus
CY077	M	53	10/86	Cyprus	MSM	490	4.0	Infected in Greece
CY081	M	49	05/89	Cyprus	IVDU	446	1.3	Infected in Greece
CY082	M	67	10/94	Cyprus	MSM	473	0.6	Cyprus
CY087	M	38	08/97	Cyprus	MSM	792	0.3	N/A
CY088	M	28	08/05	Cyprus	HSX	77	12.4	Infected in Cyprus; heterosexual partner of CY089
CY089	F	23	08/05	Cyprus	HSX	262	5.6	Infected in Cyprus; heterosexual partner of CY088
CY090	F	47	–/93	Cyprus	HSX	545	0.1	Infected in DRC; rough mentally handicapped
CY092	M	47	03/94	Cyprus	HSX	894	<50	Infected in Cyprus
CY093	F	49	03/98	Cyprus	HSX	284	<50	Infected in Cyprus
CY096	M	35	01/97	Cyprus	MSM	100	0.1	Infected in Greece
CY097	M	42	08/02	Cyprus	MSM	640	<50	N/A
CY100	F	74	03/97	Cyprus	HSX	812	<50	Infected in Cyprus
CY106	F	55	05/99	Cyprus	HSX	183	1.3	Infected in Cyprus
CY107	M	29	06/99	Cyprus	MSM	341	1.5	Infected in Austria
CY110	F	35	–/94	United States	HSX	739	<50	Infected in United States; diagnosed with herpes genital; HCV positive
CY111	F	40	10/05	Sweden	HSX	32	200.0	Heterosexual partner of CY112; CMV positive
CY112	M	N/A	10/05	UK	HSX	292	6.0	Heterosexual partner of CY111; HCV positive
CY113	M	49	12/93	Cyprus	HSX	910	<50	Infected in United States
CY120	M	33	03/99	Greece	HSX	277	<50	Infected in Greece
CY121	M	46	06/02	Cyprus	MSM	233	2.6	Infected in Cyprus
CY122	M	43	–/88	South Africa	OHPC	298	3.9	Infected in South Africa
CY124	M	65	–/86	Germany	MSM	N/A	N/A	Infected in Switzerland
CY130	M	N/A	02/05	Cyprus	MSM	671	1.7	Infected in Cyprus
CY131	M	62	02/05	Cyprus	HSX	202	17.5	Infected in Cyprus
CY132	M	41	–/90	Cyprus	MSM	652	2.6	Infected in Cyprus
CY137	M	37	02/91	Cyprus	MSM	893	0.4	Infected in Austria
CY140	M	33	11/04	Cyprus	MSM	461	33.4	Infected in Cyprus
CY141	M	57	01/05	Cyprus	MSM	79	128.0	Infected in Cyprus
CY142	M	56	11/05	Cyprus	MSM	32	31.2	Infected in Greece
CY149	M	42	07/01	Cyprus	MSM	599	0.1	Infected in Cyprus
CY150	M	36	12/97	Cyprus	MSM	738	<50	Infected in Germany
CY153	M	23	12/05	Cyprus	MSM	223	5.9	Infected in Greece
CY154	F	36	–/95	Zimbabwe	HSX	172	0.1	Infected in DRC
CY158	M	39	01/06	Burkina-Faso	OHPC	78	6.5	Infected in Burkina-Faso; political refugee
CY163	M	40	02/04	Cyprus	MSM	842	1.2	Infected in Cameroon
CY164	F	40	03/04	South Africa	HSX	556	0.2	Infected in Cyprus
CY165	F	54	04/93	Cyprus	HSX	230	18.7	Infected in Cyprus
CY166	M	59	03/06	Cyprus	HSX	134	>100	Infected in South Africa
CY168	M	49	05/06	Cyprus	MSM	386	0.1	Infected in Cyprus
CY171	M	49	06/06	Cyprus	HSX	447	10.7	Infected in Cyprus
CY173	F	29	06/06	Ukraine	HSX	598	1.9	Infected in Cyprus
CY176	F	26	08/06	Ethiopia	HSX	595	2.1	Infected in Ethiopia
CY178	M	44	10/06	Cyprus	MSM	785	0.1	N/A
CY179	M	38	11/06	Cyprus	HSX	498	10.2	Infected in Thailand
CY180	M	52	12/06	Cyprus	HSX	650	0.8	Infected in Cyprus

Indicates the laboratory code for each study subject.

F, female; M, male.

Indicates the date (month/year; –, unknown month) of the first known positive HIV antibody test.

Country of birth of the study subjects.

MSM, men who have sex with men; HSX, heterosexual contact; OHPC, origin from a high prevalence country; IVDU, intravenous drug user.

Information provided by the study subjects. N/A, Not available; CMV, Cytomegavirus; HBV, Hepatitis B virus; HCV, Hepatitis C virus.

Sequence analysis of near full-length HIV-1 genome

Uncultured PBMCs and plasma from all subjects were HIV-1 positive by nested PCR and/or RT-PCR in gag, pol (protease and RT), pol (RNase H and IN), and vif, vpr, and vpu genes, env (gp160), and the 5′-end of nef regions. The positive PCR combined with the extensive genetic diversity of HIV-1 strains, as described in the phylogenetic analysis (Fig. 2), demonstrates that the designed PCR primers (Table 1) are suitable or diverse M-group strains. All HIV-1 internal PCR products were further analyzed by nucleotide sequencing analysis using sequencing primers for each region (Table 1, Fig. 1D). The near full-length genome of the HIV-1 strains was assembled from the overlapping sequenced fragments. The complete near full-length DNA sequences encoding the expected nine open reading frames for gag, pol, vif, vpr, vpu, tat, rev, env, and the 5′-end of nef (Fig. 1A) were successfully derived from all 77 study subjects.

FIG. 2.

NJ phylogenetic tree for the nucleotide sequence of the near full-length genome of HIV-1 strains obtained from 77 HIV-1-seropositive patients in Cyprus, based on the Kimura two-parameter distance estimation method. The tree includes representative reference sequences of HIV-1 subtypes (A–K) and CRF01_AE, CRF02_AG, and CRF04_cpx (shown in bold). The numbers indicated at several nodes are consensus bootstrap values out of 1000 replications (only bootstrap values greater than 50% are denoted). The sequences determined in the study are shown in black boxes with a prefix CY for Cyprus and the numbers following denoting the laboratory code. The unclassified sequences are shown in boxes. Epidemiologically linked patients are indicated by brackets. The divergence between any two sequences is obtained by summing the horizontal branch length, using the scale at the lower left, which represents 2% genetic distance (0.02 substitutions per site). The brackets on the right side of the tree indicate the determined subtypes as described in Results; U, for unclassified.

Phylogenetic analysis

The molecular epidemiological relationships among DNA sequences encoding near full-length genomes (790 to 8930 nt, Fig. 1A, D) were analyzed by nucleotide phylogenetic analysis. One phylogenetic tree was constructed for the 77 study subjects on the basis of 77 derived near full-length DNA sequences (Fig. 2). In addition to the sequences from Cyprus, 46 previously sequenced HIV-1 isolates from diverse global locations, encompassing all nine known subtypes (A through K) and three CRFs (CRF01_AE, CRF02_AG, and CRF04_cpx), were also included in the analysis. According to the constructed NJ phylogenetic tree shown in Fig. 2, four distinct subtypes (A, B, C, and D) and three CRFs (CRF01_AE, CRF02_AG, and CRF04_cpx) were identified for the Cypriot sequences within the M group: subtype A, 18 sequences (23.3%); subtype B (61.0%), 47 sequences; subtype C, 4 sequences (5.2%); subtype D, 1 sequence (1.3%); CRF01_AE, 1 sequence (1.3%); CRF02_AG, 3 sequences (3.9%); and CRF04_cpx, 1 sequence (1.3%). It is important to note that the Cypriot sequences in subtypes A, B, C, and CRF02_AG have a relatively high average intrasubtype genetic diversity. The average (range) intrasubtype nucleotide divergence among the Cypriot gag sequences with subtype A is 11.0% (1.4–14.8%); within subtype B, 10.3% (4.4–19.4%); within subtype C, 10.0% (0.9–10.8%); and within CRF02_AG, 11.6% (8.5–13.5%). This variation is within the range of intrasubtype diversity and suggests that subtypes A, B, C, and CRF02_AG were transmitted to Cyprus during the study period (1986 to 2006) by multiple sources, which is consistent with the epidemiological data of the study subjects presented in Table 2.

The study group consisted of four heterosexual couples: a couple from Georgia (CY057 and CY058) infected in Georgia; a couple, the man from UK (CY112) and the woman from Sweden (CY111), with site of infection unknown; and two couples from Cyprus, one (CY088 and CY089) infected in Cyprus and the other (CY037 and CY038) in the UK. In the phylogenetic tree the sequences of three of the couples are very closely clustered: CY057–CY058 and CY111–CY112 in subtype A and CY088–CY089 in subtype B, with bootstrap values of 100%. The branch topologies in the phylogenetic tree (Fig. 2) reconfirm this relation. The average intrasubtype diversity between the gag sequences of CY111–CY112 is 1.5% and for the sequences CY057–CY058 is 0.7%; for the sequences CY088–CY089 it is 1.9%. The relatively low genetic diversity between these sequences in subtype A and subtype B, in comparison with the overall intrasubtype diversity for A (11%) and B (10.3%), respectively, reconfirms that the isolates were derived from epidemiologically linked individuals. The average intrasubtype diversity between the gag sequences of couple CY037 and CY038 (subtype B) is 11.0% and the branch lengths of the tree indicate that although they are epidemiologically linked they do not cluster very closely.

Two sequences (2.6%), isolated from CY063 and CY090 HIV-1 seropositives, do not cluster within pure subtypes or CRFs. As indicated in Fig. 2, the sequence of the CY063 isolate is branched close to subtype G reference sequences with a considerable bootstrap value of 100%, whereas the genetic distance of the CY090 strain sequence is closest to subtype K variants with a bootstrap value of 95%. The HIV-1 patient CY063 originating from the Democratic Republic of Congo (DRC) was infected before 1995 in the DRC by heterosexual contact. Running the CY063 sequence with the REGA algorithm, a recombinant pattern between subtypes G and D was indicated (data not shown). The HIV-1-infected patient CY090 originating from Cyprus was infected before 1993 in the DRC, by heterosexual contact. The sequences from these two isolates seem to be a unique case.

Evidence of mosaicism

For a more detailed comparison with other subtypes of HIV-1, the two unclassified sequences CY063 and CY090 were analyzed by similarity and bootscanning analysis. The similarity plot and the bootscan analysis showed that the genome of the CY063 sequence consisted of segments clustering alternatively with references of subtype G and D (Fig. 3). In the bootscan analysis a high bootstrap value (≥70%) was indicated in almost all regions of the genome, supporting the classification as a recombinant strain. Subtype assignments for each segment derived from the bootscan analyses were confirmed with NJ trees, in each case with a bootstrap value of ≥70% supporting the relation with subtype references (Fig. 4). The CY063 sequence contained 10 breakpoints (Fig. 3). The beginning of the genome, nucleotide (nt) 790–3000 (HXB2 numbering), was subtype G with a bootstrap value of 100%, shifting to subtype D with a low bootstrap value of 60% in the 3′-end of RT and 5′-end of RNase H of pol (3000–4100 nt). The third subregion in the 3′-end of RNase H and 5′-end of IN of pol (4100–4550 nt) clustered with subtype G with an 89% bootstrap value, followed by a small fragment in IN (250 nt) that was an area of poor resolution between subtypes D and G (Fig. 3). This area clustered with reference sequences of subtype D at a low bootstrap value of 11% in the NJ and was considered as unclassified. From the 3′-end of IN to the 3′-end of vpr (4800–5700 nt) the genome was of subtype G with the bootstrap value of 97%. The genome was shifted back to subtype D (5700–6300 nt) with an 81% bootstrap value and had the next breakpoint at the beginning of env (gp120). A following small fragment of 150 nt clustered with reference sequences of subtype G with a bootstrap value 86%. The eighth fragment (6450–7200 nt) clustered in the NJ tree with subtype D and a 93% bootstrap value, while the next subregion (7200–7600 nt) of env (gp120) was determined as unclassified as it was poorly resolved between D and B references, and it was clustered in the NJ tree with subtype B with a 65% bootstrap value. The tenth fragment (7600–8700 nt) coding part of exon 2 of rev and tat through env (gp41) belonged to subtype D with a bootstrap value of 95%. The last region (8700–8930 nt) was unclassified due to a poor signal and clustering (not shown in Fig. 4). CY063 had nearly equal proportions of G and D subtypes. It is significant that the crossover sites of the CY063 isolate recombinant form corresponds to the genomic regions (the 5′-end of RT, 3′-end of RNase and IN of pol, vpr, 5′-end of gp120, 3′-end of gp120, and 3′-end of gp41 of env) of HIV-1, which have been characterized as recombination hot spots.^29
–31 A BLAST search was performed to carry out comparative phylogenetic analysis with HIV-1 sequences from the Los Alamos HIV Sequence Database. No similar recombinant patterns were found in samples from the database, supporting the belief that this recombinant sequence is a unique recombinant form. A previous study referred to the existence of a D/G/D recombinant sequence of the protease and RT region (2042–4261 nt) of pol from a Cameroonian isolate,³² but did not have the same recombinant pattern as the one found in this study, since CY063 has a G/D/G pattern for the same region. Additionally, one Portuguese strain was found to have a envG-nefD/G proviral genomic structure,³³ but did not match with the recombinant CY063, since it has the envD/U-nefD/U pattern, where U represents unclassified.

FIG. 3.

Recombinant analysis of the near full-length genome of the CY063 isolate in comparison to reference strains of all HIV-1 pure subtypes of the M group. The upper diagram indicates the gene regions and the recombination breakpoints of the CY063 isolate as determined by informative analysis. The illustration was created according to HXB2 numbering using the Recombinant Drawing tool available on the Los Alamos HIV sequence Database website.²⁸ The middle panel presents the similarity plot diagram and the bottom panel shows the bootscan analysis performed as described in Materials and Methods. The y-axis in the similarity plot indicates the percent identity of the query sequence to a set of reference sequences; in the bootscan diagram, the bootstrap value. The x-axis shows the nucleotide position of the HXB2 genome. The dotted line indicates 70% (significant) bootstrap value.

FIG. 4.

Phylogenetic analysis of the interbreakpoint segments comprises the CY063 strain as defined by the similarity plot and the bootscan analysis. Analysis was performed using the NJ method with the Kimura's two-parameter parameter distance estimation method and bootstrap analysis (1000 replicates). All reference HIV-1 pure (sub)subtypes of the M group were used to construct the trees and are denoted with different colors. *, Bootstrap value ≥70%; ∙, query sequence of CY063. Loci of genome segments are based on the HXB2 numbering. The divergence between any two sequences is obtained by summing the horizontal branch length, using the scale at the lower left.

As illustrated in the similarity plot (Fig. 5), along the CY090 sequence there are multiple regions with similarity to subsubtypes F2 or F1, but in general the similarity with these subsubtypes is not significantly higher than the similarity with the other subtypes. Further analysis of the CY090 sequence by the bootscan approach demonstrated that clustering close to subtype K existed in a few short genetic regions with bootstrap values above 70%, but in the rest of the sequence the bootstrap values with this clade were <70% (Fig. 5). A detailed similarity analysis and bootscan analysis were performed with the inclusion of near full-length sequences of all the pure subtypes and CRFs, but no difference was seen (data not shown). The limited size of the few regions that cluster with subtype K in bootscan analysis and the mixed similarity plot suggest that the new sequence does not cluster with any known subtype or CRF. An ML tree was constructed from the near full-length sequence of CY090 and all pure HIV-1 reference sequences to determine if a clustering occurs (Fig. 5). The ML tree confirms the previous analysis: it is close to subtype K, but does not totally cluster. An HIV-1 variant that belongs to the M group, with limited similarity of short genetic regions to subtype K and the remainder of the genome unrelated to any established HIV-1 subtype, was found in an HIV-1-infected male patient living in the Netherlands who most likely encountered the virus in Africa before 1989 via heterosexual contact.³⁴ However, phylogenetic analyses using near full-length sequences from the two unknown “K-like” strains, CY090 from Cyprus and H10986 from the Netherlands, revealed that they are unrelated HIV-1 variants (data not shown).

FIG. 5.

Recombinant analysis of the near full-length genome of the CY090 isolate in comparison to reference strains of all HIV-1 pure subtypes of the M group. The upper diagram indicates the similarity plot of the CY090 isolate; in the middle is the bootscan analysis. Similarity and bootscan plots were performed as described in Materials and Methods. The y-axis in the similarity plot indicates the percent identity of the query sequence to a set of reference sequences; in the bootscan diagram, the bootstrap value. The x-axis shows the nucleotide position of the HXB2 genome. The dotted line indicates 70% (significant) bootstrap value. At the bottom of the scheme an ML tree of the near full-length sequence of CY090 and all pure HIV-1 reference sequences and two CRFs is presented with bootstrap analysis (1000 replicates). All reference HIV-1 pure (sub)subtypes of the M group were used to construct the trees and are denoted by different colors. *, Bootstrap value ≥70%; ∙, query sequence of CY090.

Discussion

In the period 1986 to 2006, 287 persons were reported infected with HIV-1 in Cyprus. In this study, a genetic characterization and a phylogenetic analysis were performed in the near full-length genome sequences of 77 HIV-1 seropositives, depicting 38% of the known infected population of HIV-1 seropositives, to determine the genetic profile of HIV-1 strains circulating in Cyprus in the past two decades. Compared with the data already published by Kostrikis et al.,¹⁹ and Kousiappa et al.,²¹ the present study offers more detailed information on the molecular epidemiology of HIV-1 infection in Cyprus.

The phylogenetic analysis of the near full-length genome of the analyzed HIV-1 samples indicated clearly that subtype B is the dominant subtype, followed by subtypes A, C, and CRF02_AG, strains that dominate the global epidemic.³⁵ Representative strains of other subtypes have also been observed, as of subtype D, CRF01_AE, and CRF04_cpx. Two unclassified isolates derived from different HIV-1-seropositive individuals; CY063 and CY090 were further characterized phylogenetically. The CY063 isolate had a unique mosaic pattern, comprising segments of subtypes D and G and unclassified short regions. The newly found URF is probably generated from a recombination event between two parental viruses: one belonging to the subtype G lineage and the other to subtype D, in DRC where the infection was contracted. The profile of HIV-1 in DRC is characterized by high HIV-1 genetic diversity with a large number of cocirculating HIV-1 subtypes, recombinant viruses, and unclassified strains.^36,37 Subtypes D and G are present in DRC, with a regional range of 5.1–17.4% in 2002 and 6.7–13.1% in 1997 for subtype D and 2.3–21.7% in 2002 and 3.3–9.7% in 1997 for subtype G.³⁷ This new and unique recombinant form of HIV-1 displays a recombinant structure distinct from any other CRFs or URFs reported so far. The detailed phylogenetic analysis of the near full-length sequence of the CY090 isolate revealed that is close to subtype K, but does not totally cluster within. Similarity plot and bootscan analyses revealed that most of the genome sequence of the CY090 isolate is not closely related to subtype K sequences or any other known HIV sequence (Fig. 5). In a previous study of Kostrikis et al.,¹⁹ an isolate of patient CY090 (H044) was collected, amplified in the env (C2–V3) region, and analyzed by heteroduplex mobility assay (HMA), but could not be classified into any HIV-1 subtype (A to F) known at that time. A phylogenetic analysis with HIV-1 pure reference subtypes denoted a relation to subtype F reference sequences, the ancestor lineage of subtype K,³⁸ but formed a distinct divergent cluster; because it was not clear whether that sequence belonged to a new subtype or was recombinant, it was referred to as FcY. Nevertheless, although the near full-length sequence of this strain has been analyzed, no clarification about its phylogeny could be made. The CY090 strain may represent a novel subtype or a subsubtype of subtype K. At least two epidemiologically unrelated patients with an HIV-1 variant that is similar to the CY090 isolate are required to formally designate this variant as a new HIV-1 subtype or subsubtype.

The presence of a new URF and an HIV-1 diverse unclassified strain increases the genetic complexity of the HIV-1 epidemic in Cyprus. This is not consistent with the country's small area, population size, and transmission type, but it can be explained by the population flow in Cyprus of many foreign tourists, workers, political refugees, as well as repatriating Cypriots. The majority of non-B subtypes entering Cyprus in the past two decades is due to a large number of immigrants from Africa and eastern European countries, where non-B strain are predominant.³⁵ It is well known that Africa has the greatest genetic diversity of HIV-1,^39,40 and in this study 12.9% of the HIV-1 infections are linked to Africa, including the strains CY063 and CY090. This phenomenon has also been observed in other European countries,^41

–47 in countries of the Mediterranean region,^48,49 and in the United States.⁵⁰

Current subtype screening assays may not be sufficiently effective to capture the increasing complexity of recombinant genomes or new variants. In our method we employed near full-length characterization, a highly accurate assay that enables us to determine subtype distribution. Nevertheless, the assay must be continually evaluated and optimized in relation to newly identified recombinant forms as new and strange variants are circulating in Cyprus.⁵¹

In conclusion, this is the largest study of phylogenetic analysis of near full-length coding sequences of Cypriot HIV-1 strains confirming the high genetic diversity of HIV-1 in Cyprus, which derives from the introduction of multiple non-B genetic forms from other countries. Furthermore, a novel URF and an unclassified variant, both originating from the DRC in Africa, were identified as part of this study. Ongoing surveillance of HIV-1 subtypes and recombinant forms in Cyprus may have important implications for HIV-1 vaccine development and new drug design and can provide insights into the evolutionary history of HIV-1.

Sequence Data

GenBank accession numbers for the near full-length sequences obtained in this study are as follows: FJ388890–FJ388965 and FJ403482.

Footnotes

Acknowledgments

We thank all participating subjects from the Larnaca General Hospital AIDS Clinic, I. Demetriades, E. Lazarou, C. Kasapis, I. Christodoulou, M. Christophina, the Cyprus Ministry of Health, and the Cyprus National Bioethics Committee for valuable assistance, as well as S. Gilliland and E. Yiacoumi for data preparation. This work was supported by grants from the European Commission (FP6-014822, QLK2-CT-2001-01344, and LSHP-CT-2006-518211), the Cyprus Research Promotion Foundation (Health/0104/22), the University of Cyprus (8037-3/312-25004 and 837-25011), and the Birch Biomedical Research LLC (3416-25017) awarded to L.G. Kostrikis.

Disclosure Statement

No competing financial interests exist.

References

Ramirez

, Simon-Loriere

, Galetto

, Negroni

. Implications of recombination for HIV diversity. Virus Res, 2008; 134:64–73.

Robertson

, Hahn

, Sharp

. Recombination in AIDS viruses. J Mol Evol, 1995; 40:249–259.

Robertson

, Sharp

, McCutchan

, Hahn

. Recombination in HIV-1. Nature, 1995; 374:124–126.

Roberts

, Bebenek

, Kunkel

. The accuracy of reverse transcriptase from HIV-1. Science, 1988; 242:1171–1173.

Leitner

, Korber

, Daniels

, Calef

, Foley

. HIV-1 Subtype and Circulating Recombinant Form (CRF) Reference Sequences, 2005. Los Alamos National Laboratory: Los Alamos, NM, 2005.

Los-Alamos-HIV-sequence-database: HIV-1 Subtype Reference Alignments. Los Alamos National Laboratory: Los Alamos, NM, 2005.

Robertson

, Anderson

, Bradac

, Carr

, Foley

, Funkhouser

et al. HIV-1 nomenclature proposal. Science, 2000; 288:55–56.

Thomson

, Najera

. Molecular epidemiology of HIV-1 variants in the global AIDS pandemic: An update. AIDS Rev, 2005; 7:210–224.

Parekh

, Phillips

, Granade

, Baggs

, Hu

, Respess

. Impact of HIV type 1 subtype variation on viral RNA quantitation. AIDS Res Hum Retroviruses, 1999; 15:133–142.

10.

Gottesman

, Grossman

, Lorber

, Levi

, Shitrit

, Katzir

et al. Comparative performance of the Amplicor HIV-1 Monitor Assay versus NucliSens EasyQ in HIV subtype C-infected patients. J Med Virol, 2006; 78:883–887.

11.

Gobbers

, Fransen

, Oosterlaken

, Janssens

, Heyndrickx

, Ivens

et al. Reactivity and amplification efficiency of the NASBA HIV-1 RNA amplification system with regard to different HIV-1 subtypes. J Virol Methods, 1997; 66:293–301.

12.

Chew

, Herring

, Zheng

, Browne

, Saksena

, Cunningham

et al. Comparison of three commercial assays for the quantification of HIV-1 RNA in plasma from individuals infected with different HIV-1 subtypes. J Clin Virol, 1999; 14:87–94.

13.

Emery

, Bodrug

, Richardson

, Giachetti

, Bott

, Panteleeff

et al. Evaluation of performance of the Gen-Probe human immunodeficiency virus type 1 viral load assay using primary subtype A, C, and D isolates from Kenya. J Clin Microbiol, 2000; 38:2688–2695.

14.

Jenny-Avital

, Beatrice

. Erroneously low or undetectable plasma human immunodeficiency virus type 1 (HIV-1) ribonucleic acid load, determined by polymerase chain reaction, in West African and American patients with non-B subtype HIV-1 infection. Clin Infect Dis, 2001; 32:1227–1230.

15.

Fischer

, Liao

, Haynes

, Letvin

, Korber

. Coping with viral diversity in HIV vaccine design: A response to Nickle et al. PLoS Comput Biol, 2008; 4:e15author reply e25.

16.

Nickle

, Rolland

, Jensen

, Pond

, Deng

, Seligman

et al. Coping with viral diversity in HIV vaccine design. PLoS Comput Biol, 2007; 3:e75.

17.

Fischer

, Perkins

, Theiler

, Bhattacharya

, Yusim

, Funkhouser

et al. Polyvalent vaccines for optimal coverage of potential T-cell epitopes in global HIV-1 variants. Nat Med, 2007; 13:100–106.

18.

Rolland

, Nickle

, Mullins

. HIV-1 group M conserved elements vaccine. PLoS Pathog, 2007; 3:e157.

19.

Kostrikis

, Bagdades

, Cao

, Zhang

, Dimitriou

, Ho

. Genetic analysis of human immunodeficiency virus type 1 strains from patients in Cyprus: Identification of a new subtype designated subtype I. J Virol, 1995; 69:6122–6130.

20.

Gao

, Robertson

, Carruthers

, Li

, Bailes

, Kostrikis

et al.

An isolate of human immunodeficiency virus type 1 originally classified as subtype I represents a complex mosaic comprising three different group M subtypes (A, G, and I)

J Virol, 1998; 72:10234–10241.

21.

Kousiappa

, Van de Vijver

DAMC

, Demetriades

, LG

. Genetic analysis of HIV type 1 strains from newly infected untreated patients in Cyprus: High genetic diversity and low prevalence of drug resistance. AIDS Res Hum Retroviruses, 2009; 25:23–35.

22.

Loizidou

, Kousiappa

, Zeinalipour-Yazdi

, Van de Vijver

, Kostrikis

. Implications of HIV-1 M group polymorphisms on integrase inhibitor efficacy and resistance: Genetic and structural in-silico analyses. Biochemistry, 2009; 48,1:4–6.

23.

www.applied-maths.com/bionumerics/bionumerics.htm 2008. applied Maths NV.

24.

Tamura

, Dudley

, Nei

, Kumar

. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol, 2007; 24:1596–1599.

25.

de Oliveira

, Deforche

, Cassol

, Salminen

, Paraskevis

, Seebregts

et al. An automated genotyping system for analysis of HIV-1 and other microbial sequences. Bioinformatics, 2005; 21:3797–3800.

26.

Lole

, Bollinger

, Paranjape

, Gadkari

, Kulkarni

, Novak

et al. Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J Virol, 1999; 73:152–160.

27.

Altschul

, Gish

, Miller

, Myers

, Lipman

. Basic local alignment search tool. J Mol Biol, 1990; 215:403–410.

28.

http://www.hiv.lanl.gov/content/sequence/HIV/HIVTools.html.

29.

Magiorkinis

, Paraskevis

, Vandamme

, Magiorkinis

, Sypsa

, Hatzakis

. In vivo characteristics of human immunodeficiency virus type 1 intersubtype recombination: Determination of hot spots and correlation with sequence similarity. J Gen Virol, 2003; 84:2715–2722.

30.

Fan

, Negroni

, Robertson

. The distribution of HIV-1 recombination breakpoints. Infect Genet Evol, 2007; 7:717–723.

31.

Magiorkinis

, Paraskevis

, Hatzakis

. Comments on “The distribution of HIV-1 recombination breakpoints” by Jun Fan, Matteo Negroni, David L. Robertson. Infect Genet Evol, 2008; 8:527–528.

32.

Vergne

, Peeters

, Mpoudi-Ngole

, Bourgeois

, Liegeois

, Toure-Kane

et al. Genetic diversity of protease and reverse transcriptase sequences in non-subtype-B human immunodeficiency virus type 1 strains: Evidence of many minor drug resistance mutations in treatment-naive patients. J Clin Microbiol, 2000; 38:3919–3925.

33.

Parreira

, Padua

, Piedade

, Venenno

, Paixao

, Esteves

. Genetic analysis of human immunodeficiency virus type 1 nef in Portugal: Subtyping, identification of mosaic genes, and amino acid sequence variability. J Med Virol, 2005; 77:8–16.

34.

van der Hoek

, Pollakis

, Lukashov

, Jebbink

, Jeeninga

, Bakker

et al. Characterization of an HIV-1 group M variant that is distinct from the known subtypes. AIDS Res Hum Retroviruses, 2007; 23:466–470.

35.

McCutchan

. Global epidemiology of HIV. J Med Virol, 2006; 78:S7–S12.

36.

Kita

, Ndembi

, Ekwalanga

, Ido

, Kazadi

, Bikandou

et al. Genetic diversity of HIV type 1 in Likasi, southeast of the Democratic Republic of Congo. AIDS Res Hum Retroviruses, 2004; 20:1352–1357.

37.

Vidal

, Mulanga

, Bazepeo

, Mwamba

, Tshimpaka

, Kashi

et al. Distribution of HIV-1 variants in the Democratic Republic of Congo suggests increase of subtype C in Kinshasa between 1997 and 2002. J Acquir Immune Defic Syndr, 2005; 40:456–462.

38.

Triques

, Bourgeois

, Vidal

, Mpoudi-Ngole

, Mulanga-Kabeya

, Nzilambi

et al. Near-full-length genome sequencing of divergent African HIV type 1 subtype F viruses leads to the identification of a new HIV type 1 subtype designated K. AIDS Res Hum Retroviruses, 2000; 16:139–151.

39.

Janssens

, Buve

, Nkengasong

. The puzzle of HIV-1 subtypes in Africa. AIDS, 1997; 11:705–712.

40.

Papathanasopoulos

, Hunt

, Tiemessen

. Evolution and diversity of HIV-1 in Africa—a review. Virus Genes, 2003; 26:151–163.

41.

Palma

, Araujo

, Duque

, Borges

, Paixao

, Camacho

. Molecular epidemiology and prevalence of drug resistance-associated mutations in newly diagnosed HIV-1 patients in Portugal. Infect Genet Evol, 2007; 7:391–398.

42.

Alaeus

, Leitner

, Lidman

, Albert

. Most HIV-1 genetic subtypes have entered Sweden. AIDS, 1997; 11:199–202.

43.

Chaix

, Descamps

, Harzic

, Schneider

, Deveau

, Tamalet

et al. Stable prevalence of genotypic drug resistance mutations but increase in non-B virus among patients with primary HIV-1 infection in France. AIDS, 2003; 17:2635–2643.

44.

Maljkovic

, Wilbe

, Solver

, Alaeus

, Leitner

. Limited transmission of drug-resistant HIV type 1 in 100 Swedish newly detected and drug-naive patients infected with subtypes A, B, C, D, G, U, and CRF01_AE. AIDS Res Hum Retroviruses, 2003; 19:989–997.

45.

Deroo

, Robert

, Fontaine

, Lambert

, Plesseria

, Arendt

et al. HIV-1 subtypes in Luxembourg, 1983–2000. AIDS, 2002; 16:2461–2467.

46.

Esteves

, Parreira

, Venenno

, Franco

, Piedade

, De Sousa

et al. Molecular epidemiology of HIV type 1 infection in Portugal: High prevalence of non-B subtypes. AIDS Res Hum Retroviruses, 2002; 18:313–325.

47.

Snoeck

, Van Laethem

, Hermans

, Van Wijngaerden

, Derdelinckx

, Schrooten

et al. Rising prevalence of HIV-1 non-B subtypes in Belgium: 1983–2001. J Acquir Immune Defic Syndr, 2004; 35:279–285.

48.

Grossman

, Lorber

, Maayan

, Bar-Yacov

, Levy

, Averbuch

et al. Drug-resistant HIV infection among drug-naive patients in Israel. Clin Infect Dis, 2005; 40:294–302.

49.

Bouzeghoub

, Jauvin

, Recordon-Pinson

, Garrigue

, Amrane

, Belabbes

et al. High diversity of HIV type 1 in Algeria. AIDS Res Human Retroviruses, 2006; 22:367–372.

50.

Bennett

. HIV-1 genetic diversity surveillance in the United States. J Infect Dis, 2005; 192:4–9.

51.

Salminen

, Carr

, Robertson

, Hegerich

, Gotte

, Koch

et al. Evolution and probable transmission of intersubtype recombinant human immunodeficiency virus type 1 in a Zambian couple. J Virol, 1997; 71:2647–2655.