Abstract
The goal of this study was to develop an in vivo murine model that can be used to study the influence of HSV-2 on HIV infection. Mice expressing transgenes for human CD4, CCR5, and Cyclin T1 were infected intravaginally with HSV-2 and 3–7 days later infected with HIV. HIV DNA was detected by real-time PCR. The frequency of detection of HIV DNA was significantly higher (65%) in vaginal tissue of HSV-2-infected mice compared to mock-infected mice (35%) when HIV was given 3 days after HSV-2. HSV-2-infected mice also had significantly higher levels of HIV DNA in vaginal tissue. HIV DNA was not detected in vaginal tissue of mice lacking human CD4. Longer periods (5 or 7 days) between infection with HSV-2 and HIV did not increase the frequency of detection or the amount of HIV DNA detected. HIV DNA was also detected in lymph nodes from some of the mice that were infected intravaginally with HSV-2 and HIV. Flow cytometric and mRNA analysis of human CD4 in vaginal tissue suggested that HSV-2 infection increased the number of T cells expressing human CD4 in vaginal tissue. This study provides evidence that HIV infection of cells occurs in the vagina of mice expressing human CD4, CCR5, and Cyclin T1 and that HSV-2 infection increases HIV infection. These findings demonstrate that this model can be used to study the mechanisms responsible for increased susceptibility to HIV in HSV-2-infected persons and for testing preventative treatments.
Introduction
In recent years, more than 3 million people have become infected with HIV annually with about 85% of these infections acquired through heterosexual transmission. 1 Recent failures of vaccines and microbicides that were designed to interrupt HIV transmission 2,3 suggest that a better basic understanding of the factors that affect heterosexual transmission of HIV is needed for the design of strategies to prevent HIV transmission.
Herpes simplex virus type 2 (HSV-2) is a common infection of the lower genital tract, and a number of epidemiological studies provide evidence that a preexisting infection with HSV-2 increases susceptibility to acquisition of HIV. 4 For example, in monogamous HIV-1-discordant couples in Rakai, there was a 5-fold higher likelihood of acquiring HIV-1 if the HIV-seronegative subject was HSV-2 seropositive. 5 Meta-analyses of studies that assessed the influence of documented HSV-2 infection on acquisition of HIV-1 show relative risks of 2.1–3.1. 4,6
While epidemiologic studies indicate that HSV-2 infection can increase susceptibility to HIV acquisition, the mechanism(s) responsible for this association have not been determined. Possible mechanisms include changes in mucosal HIV target cell density, location, activation, or type. Alterations in either migration of infected cells from the mucosal epithelium or anti-HIV immunity could also play a role in HIV susceptibility. A murine model could facilitate our understanding of the relationship between HSV-2 and HIV infection. However, mice are susceptible to HSV-2 infection but resistant to infection with HIV. Murine cells have multiple blocks to HIV infection that are not found in human cells. These blocks include defective HIV entry due to a lack of CD4 and CCR5 receptors capable of interacting with HIV gp120 7,8 and differences between murine and human Cyclin T1 that lead to a murine cell defect in Tat-mediated transactivation. 9,10 Murine cells also have posttranslational defects that substantially limit infectious HIV production 11,12 and block HIV integration. 13
The goal of this study was to establish an in vivo murine model to study the effects of HSV-2 infection on HIV susceptibility. Intravaginal infections were performed in mice transgenic for human CD4, CCR5, and Cyclin T1 since these transgenes would facilitate HIV entry and expression in murine cells. Expression of the transgenes was under the control of murine and human CD4 enhancer and promoter elements 13 so that the transgenes would be coexpressed by cells expressing murine CD4. Since previous studies show that little or no infectious HIV produced by triple transgenic (human CD4, CCR5, and Cyclin T1) murine or rat cells due to posttranslational blocks, 14 infection of mice was assessed by PCR for HIV DNA isolated from tissues.
Materials and Methods
Virus preparation and titration
A pseudotyped HIV (designated JR-FL/R7) capable of only one round of infection was prepared by transient transfection of 293 HEK cells using CaCl2 with two plasmids: one expressing a GFP-containing HIV with a mutated envelope (R7/E-/GFP) 12 and the other expressing the R5 envelope protein of JR-FL that has a truncated gp41 cytoplasmic tail. 15,16 For some infection experiments, an R5 consensus subtype B envelope was used to make virus (designated ConB/R7). 17 Virus was concentrated by ultracentrifugation through 20% glycerol and resuspended in Hanks' balanced salts without phenol red and 1% fetal bovine serum (Lonza Walkersville, Inc., Walkersville, MD). HIV infectious units were determined by in vitro infection of CEM.NKR-CCR5 cells [CEM.NKR-CCR5 obtained through the AIDS Research and Reference Reagent Program (ARRRP), Division of AIDS, NIAID, NIH, from Dr. Alexandra Trkola]. 18 Serial dilutions of concentrated virus stocks were added to 0.1 ml containing 105 cells in microtiter wells. After 3 days of culture, the percentage of cells expressing GFP was determined by flow cytometry and the infectious units calculated by multiplying the total number of GFP+ cells/well by the dilution of virus stock. Stocks of HSV-2 strain 333 (kindly provided by Dr. Patricia Spear) were grown and titered on Vero cells. For UV-inactivation of HSV-2, virus was exposed to a Phillips 30W TUV T8 bulb (Royal Phillips Electronics, The Netherlands) at a distance of 10 cm for 7 min. This treatment was confirmed to completely inactivate HSV-2 by lack of replication on Vero cells.
Transgenic mice
Mice expressing human CD4, CCR5, and Cyclin T1 (Tg mice) were a gift from Jing-Xin Zhang and Dan Littman (New York University). 13 Expression of the three transgenes is under the control of murine CD4 enhancer and human CD4 promoter, silencer, and monocyte lineage enhancer. 13 Mice were phenotyped for human CD4 and CCR5 expression by flow cytometric analysis of blood lymphocytes using anti-CCR5-PE [BD Pharmingen, San Diego, CA (BD)] and anti-CD4-PE (Southern Biotech, Birmingham, AL). The presence of human Cyclin T1 in mouse tail DNA was determined by PCR using primers F5′ TTTCTCATCATGATAGCCATT and R5′-AGTACCAACTGGAAGTTGGGA. All mice used in this study were positive for the Cyclin T1 transgene.
Spleen cell cultures
Spleen cells were isolated from hCD4+hCCR5+ mice or hCD4−hCCR5+ littermates. They were suspended in RPMI-1640 medium containing 10% heat-inactivated fetal bovine serum (all culture materials from Lonza, Walkersville, MD). Cells (106 per well) were infected in 96-well plates with 105 infectious units of JR-FL/R7 (200 μl final culture volume). After 48 h of culture, spleen cells were washed and levels of HIV DNA were determined.
Intravaginal infection of mice
DepoProvera (PharmaciaUpjohn, 150 mg/ml) was diluted to 25 mg/ml in phosphate-buffered saline (PBS) and 0.1 ml was given to each mouse subcutaneously at the nape of the neck. This treatment thins the vaginal epithelium and is required for vaginal HSV-2 infection. 19 Five days later, mice were anesthetized and infected intravaginally with 10 μl of HSV-2 (103 pfu), UV-inactivated HSV-2, or saline (mock infection). After virus inoculation, mice were kept on their backs for 30 min under the influence of the anesthesia to allow the inoculum to remain within the vagina. Three, five, or seven days after HSV-2 infection, mice were again anesthetized and infected with HIV (4000 infectious units). Two days after HIV infection, mice were sacrificed and vaginal lavage, vaginal tissue, and iliac lymph nodes were collected. Vaginal lavage was collected by pipetting 20 μl of PBS into and out of the vagina five times. This was repeated with two additional 20 μl volumes to give a total pooled lavage volume of 60 μl from each mouse.
Detection of HIV and HSV-2 DNA
Vaginal tissue and lymph node tissue were cut into small (1 mm) pieces with a scalpel. Vaginal lavage cells were pelleted by centrifugation. DNA was isolated using the Puregene DNA Purification Kit (Puregene, Minneapolis, MN). Levels of HIV DNA in tissue or cell DNA were determined using real-time PCR and primers previously described, 20,21 F5′-GGTCTCTCTGGTTAGACCAGAT and R5′-CTGCTAGAGATTTTCCACACTG. A standard curve was generated using DNA isolated from the 8E5 cell line (obtained through ARRRP), which contains one copy of HIV provirus per cell. 22 Amplification was performed on a 7500 thermal cycler (Applied Biosystems, Foster City, CA). Levels of HSV-2 DNA in vaginal tissue were determined by real-time PCR using primers F5′-CTTCAGCCACTTTAAGCGCAGCAT and R5′-TCATCATGCTCTGGCGTAGCATCT. A standard curve for HSV-2 was generated using DNA extracted from HSV-2-infected Vero cells.
Detection of human CD4 mRNA in vaginal tissue
Vaginal tissue was cut into small pieces. RNA was isolated and cDNA produced as previously described. 23 Briefly, RNA was isolated using the Rneasy kit (Qiagen, MD) and cDNA was prepared from RNA using the Advantage RT-for-PCR kit (Clontech, Mountain View, CA). Real-time PCR was performed using primers to hCD4 (F- 5′-CAT CGT GGT GCT AGC TTT CCA and R-5′-CCA CCT GTT CCC CCT CTT TC) and mouse GAPDH (F-5′AAGGTAGTGAAGCAGGCATCTGA and R-5′-CTGTTGAAGTGGCAGGAGACAA) and results were expressed as relative levels of hCD4 mRNA normalized to murine GAPDH.
Flow cytometric analysis of cells in spleen and vaginal tissue
Spleens were cut into small pieces with a scalpel and cells were teased from tissue pieces using the frosted ends of microscope slides. Red blood cells were removed by hypotonic lysis.
Vaginal tissue was cut into small pieces with a scalpel and pieces were incubated for 1 h at 37°C in 1 ml of Collagenase D (1 mg/ml) (Roche) and Collagenase 4 (400 U/ml) (Sigma). Fifty milliliters of calcium- and magnesium-free PBS was added to the partially digested tissue pieces and the mixture was stirred for 30 min. Tissue pieces were pushed through a stainless-steel mesh screen (mesh size 70) (Sigma). Cells were resuspended in 30% Percoll (Sigma-Aldrich, St. Louis, MO), layered over 80% Percoll, and centrifuged at 500 × g for 15 min at ambient temperature. Cells at the interface were collected and washed with PBS. Isolated cells were incubated for 15 min with Fc-receptor blocking buffer containing 10% normal mouse serum, 0.02% normal human serum, and 16 μl of 2.4G2 monoclonal anti-Fc receptor (BD) for each 4 ml of blocking buffer. Cells were then stained with mouse antihuman CD4-RPE (Southern Biotech), and either antimouse CD3e-FITC (BD), antimouse CD11c-FITC (BD), antimouse CD11b-FITC (BD), rat IgG2b-FITC isotype control (BD), or rat IgG1-FITC isotype control (BD). Cells were analyzed on a FACSCalibur flow cytometer (BD).
Results
Zhang et al. 13 reported that in mice transgenic for human CD4, CCR5 and Cyclin T1 (Tg mice), human CD4 (hCD4), and CCR5 (hCCR5) were expressed on mouse CD4+ T cells in blood and spleen. To confirm this, we performed flow cytometric analysis and found that between 20% and 30% of peripheral lymphocytes and spleen cells expressed hCD4 and hCCR5 (not shown). Most (>95%) blood and spleen cells that were positive for hCD4 also expressed murine CD4 (mCD4) while hCD4 was not expressed on cells that did not express mCD4. Similar coexpression of hCCR5 and mCD4 was also observed (not shown). Zhang et al. 13 also showed, by utilizing a Vpr-ß-lactamase assay, that resting hCD4+ T cells isolated from Tg mice supported efficient R5 HIV entry. To determine if T cells from Tg mice could support virus entry and reverse transcription of pseudotyped HIV, HIV pseudotyped with the R5 JR-FL envelope (JR-FL/R7) and capable of only a single round of infection was added to spleen cell cultures from either hCD4+hCCR5+ mice or hCD4−hCCR5+ mice. After 48 h of culture, HIV DNA was detected by real-time PCR in cultures of spleen cells from four out of four hCD4+hCCR5+ mice with levels ranging from 104 to 105 copies of HIV DNA/50 ng spleen cell DNA (not shown). In contrast, no HIV DNA was detected in spleen cell cultures from three hCD4−hCCR5+ mice.
To determine if HIV DNA could be detected in vaginal tissue after intravaginal infection with HIV, and if HSV-2 infection affected HIV DNA levels, Tg mice were infected intravaginally with HSV-2 or mock infected. Three days later, mice were infected with JR-FL/R7 intravaginally. Two days after JR-FL/R7 infection, mice were sacrificed and HIV DNA in vaginal tissue was measured. HIV DNA was detected in 35% (7/20) of the mice that had received the mock infection 3 days prior to HIV (Fig. 1), while 65% (28/43) of mice that were HSV-2 infected were positive for HIV DNA (p = 0.03, Fisher's exact test). The amount of HIV DNA in vaginal tissue was also significantly higher (p = 0.005, Mann–Whitney test) when HIV was given 3 days after HSV-2 infection (median of 72 HIV DNA copies/50 ng vaginal DNA) versus mock infection (median of 0 HIV DNA copies/50 ng vaginal DNA). In contrast, when mice were inoculated with UV-inactivated HSV-2 3 days before HIV infection, the amount of HIV DNA in vaginal tissue (median of 0) was not significantly different than mock-infected HIV DNA levels (p = 0.43, Mann–Whitney) but was significantly lower than HSV-2-infected HIV DNA levels (p = 0.004).

The effect of HSV-2 infection on detection of HIV DNA in vaginal tissue of mice. hCD4+hCCR5+ (+) or hCD4−hCCR5+ (−) mice were infected intravaginally with HSV-2 or mock infected and 3, 5, or 7 days later, mice were infected intravaginally with JR-FL/R7. Two days after HIV infection, mice were sacrificed, DNA was extracted from vaginal tissue, and HIV DNA was measured by PCR. Each point represents the number of copies of HIV DNA detected in 50 ng of vaginal tissue DNA from one mouse.
Longer periods between HSV-2 and JR-FL/R7 infections (5 and 7 days) were also tested to determine the effect of more advanced HSV-2 infection on HIV DNA levels (Fig. 1). Infection with JR-FL/R7 5 days after HSV-2 or mock infection resulted in medians of 38 and 0 HIV DNA copies/50 ng vaginal DNA, respectively (p = 0.08, Mann–Whitney) while infection 7 days after HSV-2 or mock infection resulted in medians of 0 and 0 HIV DNA copies/50 ng vaginal DNA, respectively (p = 0.4, Mann–Whitney). Thus, when compared to 3 days between HSV-2 and HIV infection, intervals of 5 or 7 days between HSV-2 and HIV infections did not lead to increased levels of HIV DNA. Intervals longer than 7 days were not attempted due to increasing pathology of the HSV-2 infection over time.
To assess the requirement of human CD4 for detection of HIV DNA in vaginal tissue, hCD4−hCCR5+ mice were infected with JR-FL/R7 3 days after HSV-2 infection since these conditions led to the highest HIV DNA levels in hCD4+hCCR5+ mice. Mice that lacked hCD4 but were infected with HSV-2 had a median of 0 HIV DNA copies/50 ng DNA compared to 72 for CD4+ mice (Fig. 1, p = 0.009, Mann–Whitney).
To determine if a different R5 envelope protein could also mediate HIV DNA appearance in vaginal tissue of Tg mice and to assess the effect of HSV-2 on HIV infection, groups of mice were infected with ConB/R7, an HIV pseudotyped with a consensus clade B envelope protein 3 days after HSV-2 or mock infection. 17 Two days after ConB/R7 HIV infection, mice were sacrificed and HIV levels assessed. HIV DNA was detected in 2/6 mock-infected mice (median HIV DNA level of 0 copies/50 ng of vaginal DNA) while HIV DNA was detected in 7/12 HSV-2-infected mice with a median level of 124 copies/50 ng of vaginal DNA (p = 0.09 Mann–Whitney) showing a trend for increased HIV DNA due to HSV-2.
To determine the relationship between HSV-2 and HIV infection of vaginal tissue, the levels of HSV-2 in vaginal tissue from 22 of the mice that received JR-FL/R7 3 days after HSV-2 were measured and compared with HIV levels in vaginal tissue. There was a significant positive relationship (p = 0.016, r 2 = 0.25, linear regression after log10 transformation of both variables) between HSV-2 and HIV. This result suggests the possibility that increased replication of HSV-2 in vaginal tissue leads to a change in the vagina that results in higher susceptibility to HIV infection.
It has been suggested that in women recently exposed to HIV through sexual contact, virus spreads after immune cells such as T cells or dendritic cells that become infected in mucosal tissues migrate to regional draining lymph nodes. 24,25 To determine if HIV-infected cells migrate from the genital tract to lymph nodes in Tg mice, the presence of HIV DNA was assessed in iliac lymph nodes from hCD4+hCCR5+ mice that were either mock infected or HSV-2 infected 3 days before HIV infection. HIV DNA was detected in lymph nodes from 4/15 HSV-2-infected mice, but was not detected in any of the lymph nodes from five mock-infected mice (Table 1). HIV DNA was also measured in cells collected by vaginal lavage from hCD4+hCCR5+ mice that were either mock infected or HIV infected 3 days before HIV infection. HIV DNA was detected in lavages from 18/22 HSV-2-infected and 6/14 mock-infected mice (Table 1). The mice that were tested for HIV DNA in lymph nodes and in vaginal lavages were a subset of randomly selected mice shown in Fig. 1.
Detection of HIV DNA in Lymph Node and Vaginal Lavage Cells
Number of mice positive for HIV DNA/number of mice assayed. For all mice, HIV was given 3 days after intravaginal HSV-2 infection. The mice in this table are a subset of the same mice shown in Fig. 1.
Since the above experiments showed that vaginal tissue from HSV-2-infected mice had increased levels of HIV DNA compared to mock-infected mice, we investigated the possibility that there were increased numbers of hCD4+ target cells present in the vagina due to HSV-2 infection. Mice were either HSV-2 infected or mock infected and 3 days later hCD4 mRNA in vaginal tissue was measured. No hCD4 mRNA was detected in vaginal tissue or spleen from hCD4−hCCR5+ Tg mice (Fig. 2A). Levels of hCD4 mRNA in vaginal tissue from mock-infected mice averaged 630 relative units. Two of the mice that were HSV-2 infected had hCD4 mRNA levels in vaginal tissue that were similar to the mock-infected mice while the other two mice had levels that were more than 2-fold higher than the mock-infected mice. This result suggests that HSV-2 infection increased hCD4 levels in some mice.

Effect of HSV-2 infection on hCD4 in vaginal tissue. (
To determine the types of cells in vaginal tissue that expressed hCD4 in HSV-2- and mock-infected mice, cells in vagina and spleen were isolated and costained with PE-labeled anti-hCD4 and either FITC-labeled antimurine CD3, CD11b, or CD11c. In spleen from HSV-2 or mock-infected mice, most (79%) of the cells expressing hCD4 coexpressed murine CD3+ indicating that they were T cells, while there were smaller but distinct populations of hCD4+ cells that expressed murine CD11b (12%) and murine CD11c (16%) (not shown). In mock-infected vaginal tissue, approximately one-third of the hCD4+ cells coexpressed murine CD3, and this increased to 45% in HSV-2-infected mice (Fig. 2B and C). Based on the percentage of cells expressing the three murine markers (Fig. 2B) and the number of cells isolated from vaginal tissue, there were on average 2.2 × 104 murine CD3+hCD4+ cells, 1.5 × 104 murine CD11b+hCD4+ cells, and 1.5 × 104 murine C11c+hCD4+ cells isolated from each HSV-2-infected vagina. In contrast, there were on average 7.5 × 103 murine CD3+hCD4+ cells, 6.0 × 103 murine CD11b+hCD4+ cells, and 6.0 × 103 murine CD11c+hCD4+ cells isolated from each mock-infected vagina. The proportion of CD11b+ and CD11c+ cells that coexpressed hCD4 in mock-infected mice was higher than in spleen, but did not change appreciably due to HSV-2 infection (Fig. 2B). Thus, phenotypic analysis of vaginal cells indicated that HSV-2 infection increased the number of hCD4-expressing T cells in vaginal tissue.
Discussion
The current study shows that vaginal HSV-2 infection of mice 3 days before introduction of HIV increased the frequency of mice in which HIV DNA was detected as well as increased the amount of HIV DNA detected in vaginal tissue. Increased hCD4 mRNA in the vaginal tissue of some of the mice suggested that either increased numbers of hCD4 target cells and/or increased levels of hCD4 expressed by target cells could be responsible for the effect of HSV-2 on HIV infection. Flow cytometric studies showed increased numbers of CD3+hCD4+ cells in vaginal tissue from HSV-2-infected mice. Increased numbers of target cells could explain both why higher amounts of HIV DNA formed and why more mice were positive for HIV DNA. However, our findings do not rule out other HSV-2 effects on HIV DNA formation such as creation of breaks in the vaginal epithelium, trafficking of HIV target cells to sites in the epithelium that would be more accessible to intravaginal HIV, or increased HIV susceptibility of target cells. UV-inactivated virus did not increase HIV infection indicating that only live HSV-2 infection was capable of inducing the conditions required for the increase in HIV infection.
The increase in hCD4+ cells in the vaginal tissue of HSV-2-infected mice is likely to be due to local production of chemokines induced in vaginal cells by the infection. A recent study showed that intravaginal inoculation of macaques with SIV resulted in a local influx of CD4+ lymphocytes that was associated with local production of MIP-1α (CCL3) and MIP-1ß (CCL4). 26 In humans, HSV-2 infection has in fact been associated with an increase in CCR5+ T cells in genital tissues. 27 We speculate that a similar mechanism for increased HIV susceptibility is operative in this murine model and future studies that identify the types of chemokine receptors expressed by CD4+ lymphocytes as well as the types of chemokines expressed in vaginal tissue of HSV-2-infected mice will help to establish this.
When mice were vaginally infected with HSV-2 5 days before HIV inoculation there was a trend toward increased HIV infection when compared to mock infection (p = 0.08), but with a period of 7 days between HSV-2 and HIV, there was no enhancing effect of HSV-2 on HIV infection. Thus, the optimal period between HSV-2 and HIV for observing enhanced HIV infection was 3 days, with the enhancing effect decreasing at later time points over time. The explanation for the apparent loss of the HSV-2-enhancing effect on HIV infection could involve migration of hCD4+ cells out of vaginal tissue and a return to baseline levels of these cells. However, it is also possible that other factors, such as stronger antiviral responses (interferon) or repair of HSV-2-induced epithelial damage, could also play a role in the loss of the HSV-2-enhancing effect.
Two other studies recently reported the development of humanized mouse models for intravaginal HIV infection. 28,29 However, neither of the two other mouse models for intravaginal HIV infection assessed the impact of HSV-2 on HIV infection. The major difference between our model and the other two models is that our model used mice that express murine immune cells while the other two use mice that are reconstituted with human immune cells. Denton et al. 29 reported that intravaginal infection of eight humanized BLT (bone marrow–liver–thymus) mice with 9 × 104 tissue culture infectious units of an R5 virus resulted in systemic infection in seven mice when detected by HIV antigenemia. In that study antiretroviral treatment prevented the establishment of HIV infection in five out of five treated mice. BLT mice are generated by transplantation of liver and thymus tissue as well as bone marrow into immunodeficient (NOD/SCID) mice, which results in mice with about half of all blood cells from human origin including lymphocytes. The human cells appear to develop within the implanted immune organ tissue. 30 Another recent study, using Rag-hu mice, showed that nine out of nine mice infected intravaginally with an R5 virus and four out of five infected with an X4 virus became systemically infected as detected by PCR for HIV RNA in plasma. 28
In the current study, HIV DNA was detected not only in vaginal tissue, but was detected in iliac lymph nodes from some of the mice 2 days after intravaginal inoculation of HIV. This suggested that cells that were exposed to HIV in the vagina became infected and migrated to the lymph node within 48 h of infection. Because the virus used in this study was capable of only a single round of infection, it can be ruled out that secondary rounds of infection were responsible for the HIV DNA signal in the lymph node. However, it is possible that dendritic cells or other cells picked up HIV without becoming infected and then migrated to the lymph node where infection and subsequent formation of HIV DNA took place. Hu et al. 31 found simian immunodeficiency virus (SIV)-infected cells in draining lymph nodes of rhesus macaques 18 h after intravaginal application of simian immunodeficiency virus while Joag et al. 32 observed infected cells in pigtailed macaques 48 h after simian/human immunodeficiency virus (SHIV) application. In both of the macaque studies, infectious virus was used so that the infected cells that were observed in the lymph nodes may not have been the initial cells that were infected by the intravaginally delivered virus. It should also be noted that in both macaque studies, the effect of HSV-2 infection on HIV appearance in the lymph nodes was not tested and currently there is not a simian model for HSV-2 infection that could be used for these types of studies. In contrast, there have been extensive studies of the murine model of HSV-2 infection including mechanisms of immunity, virology, and effects of microbicides. 33 –35
While assessing infection of mice, we observed variability in HIV infection of vaginal tissue in both mock-HSV-2 and HSV-infected mice. To determine if variability of HIV infection in HSV-2-infected mice could be due to variability in HSV-2 infection, we assessed HSV-2 collected by lavage from four mice 2 and 3 days after HSV-2 infection. All mice that were infected with HSV-2 had detectable HSV-2 by plaque assay (data not shown). We also assessed HSV-2 DNA in vaginal tissue (Fig. 2) and observed substantial variability in levels of HSV-2 that were significantly associated with HIV DNA levels. Additionally, there was variability in the amount of genital redness and swelling due to HSV-2. Variation was present even between mice from the same litters that were given HSV-2 on the same day. Other published studies have also reported intraexperiment variability in pathology and time to death of HSV-2 infection. 36,37 Thus, variability in HSV-2 infection could account for some of the variation in HIV infection observed in our study.
In conclusion, this study shows that mice expressing human CD4, CCR5, and Cyclin T1 can be used as a model for investigating the mechanisms responsible for increased susceptibility to HIV in HSV-2-infected persons. The model could also potentially be used for testing treatments to prevent this effect. Potential advantages of this model when compared with the humanized mouse models for studies of vaginal HIV infection include the ability to cross it with other genetically altered mouse strains and the relatively simple maintenance of the mice. The model could also potentially be used to assess the effects of latent HSV-2 infection on HIV susceptibility. 38
Footnotes
Acknowledgments
Support for this subproject (MSA-05-419) was provided by CONRAD, the Eastern Virginia Medical School under a Cooperative Agreement (HRN-A-00-98-00020-00) with the United States Agency for International Development (USAID), the Bill and Melinda Gates Foundation, and by National Institutes of Health Grants AI065308 and AI33856.
Disclosure Statement
No competing financial interests exist.
