Construction and Phenotypic Characterization of HIV Type 1 Functional Envelope Clones of Subtypes G and F

Abstract

Subtype G has been estimated to represent the fourth most prevalent clade in the HIV-1 pandemic and subtype F is widely circulating in parts of South America (frequently within BF recombinant forms) and in Romania. However, functional envelope clones of these subtypes are lacking, which are needed for studies on antibody-mediated neutralization, coreceptor usage, and efficiency of viral entry inhibitor drugs. Here we report the construction, neutralization properties, and coreceptor usage of HIV-1 functional envelope clones of subtypes G (n = 15) and F (n = 7). These clones were obtained through RT-PCR amplification of HIV-1 gp160 from plasma RNA, and were used for pseudovirus production. All 15 subtype G-enveloped pseudoviruses were resistant to neutralization by gp120-targeted broadly neutralizing monoclonal antibodies (MAbs) b12 and 2G12, while a majority were neutralized by gp41-targeted MAbs 2F5 and 4E10. With regard to the subtype F envelopes, all seven pseudoviruses were resistant to 2F5 and b12, six were resistant to G12, and six were neutralized by 4E10. Coreceptor usage testing revealed that 21 of 22 envelopes were CCR5-tropic, including all 15 subtype G envelopes, seven of which were from patients with CD4⁺ T cell counts <200/ml. These results confirm the broadly neutralizing activity of 4E10 on envelope clones across all tested group M clades, including subtypes G and F, reveal the resistance of most subtype F-enveloped pseudoviruses to broadly neutralizing MAbs b12, 2G12, and 2F5, and suggest that, similarly to subtype C, CXCR4 tropism is uncommon in subtype G, even at advanced stages of infection.

Introduction

O ne of the greatest obstacles for the development of an effective vaccine against HIV-1 is the high genetic diversity of this pathogen,^1,2 which derives from elevated viral mutation and recombination rates. By means of these mechanisms, HIV-1 pandemic strains have diversified extensively into multiple clades, which include nine subtypes, six subsubtypes, at least 48 circulating recombinant forms (CRFs), and a great number of intrasubtype variants.^3,4 The epidemic importance of HIV-1 clades is variable, with only seven clades (subtypes A through D and G, and CRFs 01_AE and 02_AG) each estimated to represent more than 1% of global infections.⁵ Other clades, although of relatively minor importance at a global scale, are prevalent in regional epidemics, such as subtype F and BF recombinant forms in South America and BC recombinant forms in China.⁵ It is generally agreed that a globally effective HIV-1 vaccine will need to elicit broadly neutralizing antibody responses effective against the major pandemic clades.⁶ This is supported by the protection afforded by neutralizing antibodies infused into monkeys from infection by chimeric simian–human immunodeficiency viruses (SHIV)^7
–9 and by the reported correlations between antibody-mediated neutralization and HIV-1 genetic clades.^10

–16 Therefore, measurement of neutralizing antibody responses in vaccine-related studies requires the development of appropriate reagents representative of the major clades for use in standardized assays.¹⁷ One of the commonly used assays involves neutralization of primary viral isolates in peripheral blood mononuclear cell cultures. However, problems with reproducibility have been noted.¹⁸ Newer assay technologies utilize cloned strains of HIV-1 Env pseudoviruses that are generated by in vitro cotransfection of two plasmid DNA constructs, one expressing the gp160 envelope and the other encoding the remaining HIV-1 proteins within an Env-deficient proviral genome. Pseudoviruses can be used in standardized neutralizing antibody assay formats for single-cycle infection of target cell lines engineered to express CD4 and HIV-1 coreceptors, as well as a reporter gene whose expression is activated after HIV-1 infection.¹⁹ These clones can also be employed for studies on HIV-1 coreceptor usage and inhibition of viral entry or fusion by antiretroviral drugs.

It has been recommended that panels of well-characterized reference strains of HIV-1 be developed for each major genetic subtype to aid in the evaluation of the breadth and magnitude of neutralizing antibody responses elicited by candidate vaccines.¹⁷ Previously, panels of functional envelope clones of subtypes A,^14,20 B,^19,21 and C,^12,22,23 and CRF01_AE^24,25 have been developed. However, for subtypes G and F, only one and two functional envelope clones, respectively, have been reported in the literature, derived from in vitro cultured viruses (with low or borderline functionality in the case of the subtype F clones).²⁶ Subtype G has been estimated to represent the fourth most prevalent clade in the HIV-1 pandemic, corresponding to approximately 6% of global infections.⁵ It circulates widely (38–54% prevalence) in Nigeria,^27,28 the most populous African country and the second in the world in number of HIV-1 infections (approximately 2.6 million),²⁹ and also in Portugal (24%)³⁰ and Republic of Congo (21%).³¹ At lower prevalences, subtype G is also found in other Central and West African countries, Spain,^32,33 and Cuba (here frequently as BG recombinant forms).^34,35 Subtype F circulates in Romania (here as the predominant HIV-1 clade),³⁶ Central Africa,³⁷ and Brazil,^38,39 and, as part of BF recombinant forms, is highly prevalent in Argentina^40,41 and Uruguay,⁴² and is found at a lower prevalence in Chile.^43,44

Here we report the cloning of 15 subtype G and seven subtype F functional envelope clones, amplified from plasma of HIV-1-infected individuals, which were analyzed for phenotypic properties regarding neutralization and coreceptor usage.

Materials and Methods

Samples

Most samples were collected in Spain from 2002 through 2009, except one in Chile in 2001 and one in Russia in 2004. RNA was extracted from 1 ml plasma using reagents from Nuclisens kit (Biomerieux, Marcy l'Etoile, France) following the manufacturer's instructions. Samples formed part of studies involving genotypic determination of antiretroviral drug resistance, and therefore RNA was initially amplified by reverse transcriptase polymerase chain reaction (RT-PCR) and sequenced in protease and a 0.9-kb fragment of reverse transcriptase. Those samples, which were of subtypes G, F, or recombinants containing segments of these subtypes, were selected for full-length envelope RT-PCR amplification and sequencing. Viruses of subtypes G or F in bulk sequencing of the external portion of the envelope were selected for single genome amplification (SGA) and cloning.

SGA of the envelope

Primers were designed to recognize sequences conserved within HIV-1 group M. Names, sequences, and HXB2 positions of primers are, for RT-PCR, SG3-up TACAGTGCAGGGGAAAGAATAATAGACATAATA (4809–4841) and SG3-lo AGACCCAGTACAGGCRARAAGC (9523–9544); and for nested PCR, Env-up GTTTCTTAGGCATCTCCTATGGCAGGAAGAAG (5957–5983) and Env-lo GTTTCTTCCAGTCCCCCCTTTTCTTTTAAAAAG (9063–9088) (GTTTCTT appending at 5′ ends of nested primers is intended to increase 3′ adenosine addition by Taq DNA polymerase for TA cloning⁴⁵). RT-PCR components included SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) 4 U, BioTaq DNA Polymerase (BioLine, London, UK) 1 U, Pfu Turbo DNA Polymerase (Stratagene, La Jolla, CA) 0.1 U, RNasin (Promega, Madison, WI) 4 U, BioTaq 10 × buffer 2 μl, MgCl₂ 2 mM, dNTPs 0.2 pM each, primers 8 pmol each, and 2 μl RNA extract, in a 20 μl reaction volume. The RT-PCR thermal profile was 50°C 1 h; 94°C 2 min; 35 PCR cycles (94°C 15 s, 55°C 30 s, 72°C 5 min); 72°C 10 min. A 2-μl aliquot of RT-PCR product was used for nested PCR, containing the following reagents: BioTaq DNA polymerase 1 U, Pfu Turbo DNA Polymerase 0.1 U, BioTaq 10 × buffer 2.5 μl, MgCl₂ 2 mM, dNTPs 0.2 pM each, primers 10 pmol each, in a 25 μl reaction volume. The thermal profile was 94°C 2 min; 30 PCR cycles (94°C 15 s, 55°C 30 s, 72°C 3 min); 72°C 7 min. PCR products were visualized after 1% agarose gel electrophoresis under UV light with SYBR Safe (Invitrogen, Carlsbad, CA) staining. An SGA assay⁴⁶ was performed, with serial 2-fold RNA dilutions, assaying 8 to 16 replicates per dilution to obtain amplified products in less than 30% tubes, checking for the absence of mixed peaks in sequence electropherograms.

Envelope cloning

Bands were extracted from the gel with the MinElute Gel Extraction kit (Qiagen, Valencia, CA), minimizing UV light exposition, with 10 μl elution volume. Two microliters of DNA was used for ligation in pcDNA3.1/V5-His-TOPO TA expression vector (Invitrogen, Carlsbad, CA). MAX Efficiency Stbl2 competent cells (Invitrogen, Carlsbad, CA) were transformed with 4 μl of ligated product, seeded in LB-Amp plates, and incubated at 30°C overnight. Screening for colonies with the insert in the correct orientation was performed by colony PCR using primers recognizing the vector and the insert, respectively.

Pseudovirion production and functional testing

Envelope (300 ng) and pSG3Δenv backbone⁴⁷ (300 ng) plasmids were mixed with JetPEI (Polyplus Transfection, Illkirch, France) at a JetPEI:DNA (μl:μg) ratio of 4:1 in a volume of 100 μl. The mixture was added to 293T cells, seeded 1 day earlier at 3 × 10⁴ cells/well in a 24-well plate. After transfection, medium was removed and replaced with 220 μl of fresh Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (DMEM + 10% FBS). Fifty microliters supernatant with pseudovirions was collected at 48 h after transfection and used to infect TZM-bl cells,⁴⁷ seeded 1 day earlier at 5 × 10³ cells per well in a 96-well plate, which were assayed for luciferase activity 3 days after infection, using a Victor3 luminometer (Perkin Elmer, Waltham, MA). pSG3Δenv plasmid and TZM-bl cells were obtained through the NIH AIDS Research and Reference Reagent Program.

Sequencing and phylogenetic sequence analyses

Full-length gp160 sequences were obtained for all functional clones used in this study. The sequencing reactions were performed with an ABI Prism BigDye Terminator Kit (Applied Biosystems, Foster City, CA), with analysis in ABI PRISM 3700 automated sequencer (Applied Biosystems, Foster City, CA). Sequences were aligned with MAFFT v.6⁴⁸ and phylogenetically analyzed via maximum likelihood using the RAxML online program,⁴⁹ applying the GTR + CAT + I nucleotide substitution model. Recombination was analyzed by bootscanning using SimPlot v.3.5.1⁵⁰. For this analysis, a window of 300 nucleotides was used, moving in 20 nucleotide increments, and trees were constructed using Kimura's two-parameter distances and the neighbor-joining algorithm.

Neutralization assay

Neutralizing antibody responses against HIV-1 Env pseudoviruses were measured using a luciferase-based assay in TZM-bl cells as previously described.^19,51 Briefly, seven 3-fold serial dilutions of monoclonal antibodies (MAbs), starting from a concentration of 50 μg/ml, were performed in duplicate (96-well flat bottom plate) in DMEM + 10% FBS (100 μl/well). Then 200 TCID₅₀ (as determined in TZM-bl cells) of pseudovirus was added to each well in a volume of 50 μl and the plates were incubated for 1 h at 37°C. TZM-bl cells were then added (1 × 10⁴/well in a 100 μl volume) in DMEM + 10% FBS containing DEAE-Dextran (Sigma, St. Louis, MO) at a final concentration of 11 μg/ml. Assay controls included replicate wells of TZM-bl cells alone (cell control) and TZM-bl cells with virus (virus control). Following a 48-h incubation at 37°C, 150 μl of assay medium was removed from each well and 100 μl of Bright-Glo luciferase reagent (Promega, Madison, WI) was added and luminescence was measured. The 50% inhibitory concentration (IC₅₀) was calculated as the MAb dilution that caused a 50% reduction in relative luminescence units (RLU) compared to the virus control wells after subtraction of cell control RLUs. IC₅₀ were calculated with five-parameter curve fitting using neutralizing antibody analysis software provided by the CAVD Vaccine Immune Statistical Center. Susceptibility of pseudoviruses to soluble CD4 (sCD4) and polyclonal HIV immunoglobulin (HIVIG) was also determined in a similar way, using 3-fold serial dilutions of these reagents, starting from concentrations of 50 μg/ml sCD4 and 2500 μg/ml HIVIG. Pseudovirus expressing the envelope of subtype B isolate 6535.3, known to be sensitive to all four MAbs used in the assay, was included as positive control. MAbs 2F5, 4E10, 2G12, and b12 were obtained from Polymun (Vienna, Austria), sCD4 protein was obtained from Progenics (Tarrytown, NY), and HIVIG was obtained from the NIH AIDS Research and Reference Reagent Program.

Coreceptor usage determination and prediction

Coreceptor usage was tested using GHOST cells, which express CD4 and either CCR5 or CXCR4, and carry HIV-2 LTR-driven GFP. Infection was done as described^52,53 with minor modifications. GHOST-parental, GHOST-CCR5, and GHOST-CXCR4 cells were seeded in contiguous alternating rows of a 96-well plate with 5 × 10³ cells per well in 200 μl of DMEM supplemented with 7.5% fetal calf serum. The following day, medium was removed and replaced with 60 μl of fresh medium and a volume of pseudovirus-containing supernatant obtained from transfected 293T cells equivalent to 50 pg of p24 antigen. After overnight adsorption, virus was washed with phosphate-buffered saline and 200 μl of fresh medium was added. On day 3 after infection, GFP expression was observed by fluorescence microscopy, comparing contiguous wells of each GHOST cell line. Positive control viruses for each coreceptor were included in the assay.

Coreceptor usage prediction by genotypic methods was done by net V3 charge,⁵⁴ 11/25 rule,⁵⁵ and by using Web PSSM⁵⁶ and Geno2Pheno⁵⁷ online programs.

Results

Functional assay in TZM-bl cells

One hundred and thirty-seven envelope clones derived from subtype G amplicons obtained from 21 samples and 139 envelope clones derived from subtype F amplicons obtained from 18 samples were tested for functionality in TZM-bl cells. Of the tested clones, 34 from 21 SGAs derived from 15 individuals harboring viruses with subtype G envelopes and 20 from 12 SGAs derived from seven individuals harboring viruses with subtype F envelopes were highly functional (clone/background luminescence ratio ≥50). Epidemiological and clinical data of these individuals are shown in Table 1. One clone per sample (that yielding the highest luminescence signal in the TZM-bl assay) was used for further phylogenetic analyses and phenotypic assays.

Table 1.

Epidemiological and Clinical Data of Subjects

Clone ID	Subtype/CRF	Transmission route	Sex	Year of sample collection	Country of origin	CD4 ⁺ cell count
EX15_B5	G	HT	M	2009	Cuba	140
P402-2_C11	G	IDU	M	2002	Portugal	70
P1909_C5_6	G	HT	M	2008	Nigeria	148
P1981_C5_B3	G	IDU	F	2008	Spain	415
X558-8_B12_6	G	IDU	F	2006	n.a.	585
X1193_C1	G	IDU	M	2002	Spain	568
X1254_C3	G	IDU	M	2003	Spain	112
X1632_S2_B10	G	HT	M	2004	Spain	16
X1854_2_C10	G	IDU	M	2005	Spain	959
X2088_C9	G	HT	n.a	2006	Ghana	394
X2131_C1_B5	G	HT	M	2007	Spain	248
X2160_R25	G	IDU	M	2007	Spain	180
X2470_F8_12	G	IDU	M	2008	Spain	402
X2486_G12_3	G	IDU	M	2008	n.a.	40
X2558_A3	G	IDU	M	2004	Spain	589
CH12_C_2_6	44_BF	MTC	F	2001	Chile	n.a
MFU14_2_F7_7	F1	HT	M	2006	DRC	24
P1655_C8_B5_1	F1	TFS	M	2007	Romania	319
P2059_B12	F2	HT	M	2008	Nigeria	482
P2355_E4_2	12_BF	HT	F	2009	Paraguay	73
RUSP816_B3_ST11	F1	HT	M	2004	Russia	n.a.
X2687_F3	F1	HO	M	2009	Spain	39

IDU, injecting drug use; HT, heterosexual contact; HO, homosexual contact; MTC, mother-to-child transmission; TFS, blood transfusion; n.a., not available; DRC, Democratic Republic of Congo.

Phylogenetic analyses

In bootscan analyses functional cloned envelopes were uniformly of subtypes G or F, except P2355, which was a BF recombinant, with a short subtype B segment (∼0.2 kb) in the intracytoplasmic domain of gp41 (results not shown). In a phylogenetic tree, 11 of 15 subtype G envelopes clustered with the Spanish–Portuguese variant,^32,33 one with the Cuban variant,^34,35 one with a predominantly Nigerian cluster, one with a Cameroonian cluster, and one in a cluster comprising one Kenyan and two Cameroonian viruses (Fig. 1a). Among subtype F envelope clones, one (P2059_B12) branched with subsubtype F2 references and the remaining six branched with subsubtype F1 references (Fig. 1b). Among these, two viruses, one from an individual from the Democratic Republic of Congo (DRC) (MFU14_2_F7_7) and one from Russia (RUSP816_B3_ST11), clustered with a reference virus from Russia forming a sister clade of the F1 subsubtype. This clade corresponds to the recently identified Russian subtype F variant, which was designated F1′,⁵⁸ to reflect both its distinctive phylogenetic position and its close relationship to proper F1 viruses; however, for the sake of simplicity, in this article F1′ viruses will be ascribed to the F1 clade. Among the proper F1 viruses, one branched with the Romanian variant and three with South American viruses, among which one (P2355_E4_2) clustered with the CRF12_BF references and another (CH12_C2_6) with CH80, a CRF44_BF virus from Chile.⁴⁴

FIG. 1.

Phylogenetic trees of full-length gp160 sequences of functional subtype G and F envelope clones. The trees were constructed via maximum likelihood using the online version of RAxML.⁴⁹ Names of envelope clone sequences are in bold type. Reference subtype G and F isolate names are preceded by the two-letter code of the sampling country. Only bootstrap values ≥70% are shown. Intrasubtype clusters comprising clone sequences are bracketed on the right. (a) Phylogenetic tree of subtype G envelope clones. (b) Phylogenetic tree of subtype F envelope clones.

Neutralization phenotype

Neutralization phenotype of the cloned envelopes was characterized in a pseudovirus assay using TZM-bl cells, with four broadly neutralizing MAbs, b12, 2G12, 2F5, and 4E10 (all of them derived from subtype B-infected individuals^59,60), TriMab (an equimolar mixture of b12, 2G12, and 2F5), sCD4, and HIVIG (polyclonal immunoglobulin from HIV-1 subtype B-infected individuals) (Table 2).

Table 2.

Sensitivity of Pseudovirions to Neutralization by MAbs, sCD4, and HIVIG

		IC₅₀ (μg/ml) ^*
Env clone	Subtype/CRF	b12	2F5	4E10	2G12	TriMAb	sCD4	HIVIG
Ex15_b5	G	>50	19.91	44.64	>50	>25	40.58	>2500
P402_C11	G	>50	14.1	5.3	>50	>25	22.5	>2500
P1909_C5_6	G	>50	26.43	>50	>50	>25	13.93	>2500
P1981_F1	G	>50	>50	0.69	>50	>25	>50	1003
X558-8_B12_6	G	>50	31.75	>50	>50	>25	3.92	>2500
X1193_C1	G	>50	5.5	3.6	>50	18.9	32.9	>2500
X1254_C3	G	>50	19.7	19.4	>50	>25	15.1	>2500
X1632_S2_B10	G	>50	5.48	6.10	>50	14.14	2.21	>2500
X1854_2_C10	G	>50	2.3	1.4	>50	3.6	14.1	2265
X2088_C9	G	>50	>50	>50	>50	>25	7.7	1771
X2131_C1_B5	G	>50	9.10	2.76	>50	23.61	1.04	508
X2160_C25	G	>50	9.4	>50	>50	>25	3.9	>2500
X2470_F8_12	G	>50	14.10	14.80	>50	>25	40.02	>2500
X2486_G12_3	G	>50	14.38	22.29	>50	>25	38.87	>2500
X2558_A3	G	>50	19.24	>50	>50	>25	>50	>2500
CH12_C_2_6	44_BF	>50	>50	0.37	2.88	21.02	2.37	926
MFU14_2_F7_7	F1	>50	>50	0.68	>50	>25	0.72	2214
P1655_C8_B5_1	F1	>50	>50	10.71	>50	>25	0.28	448
P2059_B12	F2	>50	>50	0.29	>50	>25	0.74	337
P2355_E4_2	12_BF	>50	>50	8.93	>50	>25	>50	420
RUSP816_B3_ST11	F1	>50	>50	>50	>50	>25	13.53	>2500
X2687_F3	F1	>50	>50	14.17	>50	>25	13.58	911
6535.3	B	2.9	2.0	0.5	2.0	1.3	1.0	517

Values in bold indicate neutralization of pseudovirions.

Subtype G

All 15 subtype G-enveloped pseudoviruses were resistant to b12 and 2G12 at the highest concentration tested (50 μg/ml) and a majority (87% and 67%, respectively) were susceptible to 2F5 and 4E10 (Table 1). However, the activity of these two MAbs was relatively low for the susceptible pseudoviruses, with a mean IC₅₀ of 14.7 μg/ml and 12.1 μg/ml, respectively, and only one pseudovirus being neutralized by 4E10 at a concentration <1.0 μg/ml. TriMab neutralized only four (27%) viruses, and this activity correlated with that of the 2F5 component. sCD4, which blocks gp120 binding to the CD4 receptor, neutralized most (87%) pseudovirions, implying that the CD4 binding site is usually accessible on the pseudotyped subtype G envelope glycoproteins. HIVIG neutralized only four (27%) subtype G-enveloped pseudovirions.

Subtype F

All seven subtype F-enveloped pseudoviruses were resistant to b12 and 2F5 at the highest concentration tested (50 μg/ml); only one (CH12_C2_6) was susceptible to neutralization by 2G12, with an IC₅₀ of 2.88 μg/ml; and six were neutralized by 4E10, with an IC₅₀ of 0.29–14.17 μg/ml (mean 4.68 μg/ml) (Table 1). Only one pseudovirus (CH12_C2_6) was neutralized by TriMab, which correlated with susceptibility to 2G12. sCD4 and HIVIG each neutralized six subtype F pseudoviruses.

Correlation of neutralizing activities of MAbs with epitope sequences

We examined the correlation of the neutralizing activity of each MAb with the sequences of the corresponding epitopes on the envelope clones (Table 3).

Table 3.

Amino Acid Sequences in Positions of MAb Epitopes Important for Binding or Neutralization

		b12 epitope ^a						2G12 epitope ^b					2F5 epitope ^c	4E10 epitope ^d
		185	276	364	365	369	373,386	295	332	339	386	392	ELDKWA	nWFDITnwLW
Env clone	Subtype/CRF	D	N	S	S	P	M,N
Ex15_b5	G	.	.	P	A	L	.	+	−	−	+	+	A- - - - -	- - - - - -r- - -
P402_C11	G	G	.	.	A	L	T,D	−	+	−	−	+	A- - - - -	s- - - - -s- - -
P1909_C5_6	G	.	.	H	.	L	.	+	+	−	+	+	A- - - - -	- - - - - -s- - -
P1981_F1	G	.	.	.	.	V	.	−	+	−	+	−	A- -E-T	s- - - - - - - - -
X558-8_B12_6	G	N	.	.	.	L	.	−	+	−	+	+	A- - - - -	t- - - -S- - - -
X1193_C1	G	N	.	.	.	L	.	−	+	−	+	+	A- - - - -	- - - - - - - - - -
X1254_C3	G	T	.	P	.	L	.	−	+	−	+	+	A- - - - -	t- - - -S- - - -
X1632_S2_B10	G	N	.	.	.	L	.	−	+	−	+	+	A- - - - -	- - - - - - - - - -
X1854_2_C10	G	N	.	.	.	L	.	−	+	−	+	+	A- - - - -	s- - - - - - - - -
X2088_C9	G	N	.	P	A	L	.	−	+	−	+	+	T- -S- -	-LL- -Sh- -G
X2131_C1_B5	G	S	.	.	.	L	.	−	+	−	+	+	A- - - -T	- - - - - - - - - -
X2160_C25	G	N	.	.	A	S	.	−	−	−	+	+	A- - - - -	s- - - - - - - -R
X2470_F8_12	G	.	.	.	.	L	.	−	−	−	+	+	A- - - - -	- - - - - -k- - -
X2486_G12_3	G	N	.	.	.	V	.	−	+	−	+	+	S- - - - -	s- - - -S- - - -
X2558_A3	G	T	.	P	V	L	.	−	+	+	+	+	A- - - - -	- - - - - S - - - -
CH12_C2_6	44_BF	N	.	.	.	L	T,N	+	+	+	+	+	- - S - - -	t - - - - S - - - -
MFU14_2_F7_7	F1	.	.	H	P	L	.	+	+	+	+	−	- - - - - -	- - - - - Sh - - -
P1655_C8_B5_1	F1	N	.	.	.	L	.	+	+	+	+	−	A - - - - T	- - - - - Sk - - -
P2059_B12	F2	P	.	.	.	L	.	+	−	−	+	+	A - - - - D	s - - S - - k - - -
P2355_E4_2	12_BF	G	.	.	.	.	.	−	+	−	+	+	A - - - - T	s - - - - Sk - - -
RUSP816_B3_ST11	F1	S	.	.	.	L	.	+	+	+	+	+	- - - R- -	s - - - - S - - - -
X2687_F3	F1	N	.	.	.	L	.	+	+	+	+	+	A - - Q - -	- - - - - S - - - -

All positions correspond to the HXB2 envelope protein.

Amino acid positions correspond to sites for which mutations have been shown to result in resistance to b12 (see main text for details). Dots indicate identity with the residue(s) on top, which correspond to the subtype B consensus sequence.

Amino acid positions correspond to potential N-linked glycosylation (PNLG) sites, with sequence NX(S/T). Those whose carbohydrate chains have been shown to be the most important for 2G12 binding are in bold type. Plus and minus signs indicate the presence or absence, respectively, of a PNLG site at the corresponding position.

Residues correspond to positions 662 through 667. Residues shown to be critical for binding and neutralization are in bold type. Dashes indicate identity with the residue on top.

Residues correspond to positions 671 through 680. Residues most important for binding or neutralization are in bold type. Residues dispensable for binding and neutralization are in lower case. Dashes indicate identity with the residue on top. T676S substitution does not interfere with neutralization by 4E10.^11,14

b12

This MAb targets a discontinuous epitope on gp120 overlapping the CD4 binding site.^61,62 By site-directed mutagenesis, gp120 amino acid substitutions D185N, N276A, S364H, S365A, P369L (but not P369A), and T373R combined with N386 have been shown to result in resistance or reduced susceptibility to b12.^63
–65 Among the subtype G envelopes, all had substitutions at residue P369 (12 to L, two to V, and one to S), 13 at residue D185 (nine to N, two to T, and one each to K, G, and S), and five each at residues S364 (three to P and one to H) and S365 (four to A and one to V), with all clones but one containing at least one of the mutations reported to impact b12 activity (P369L and/or D185N and/or S364H). Among the subtype F envelopes, six had the substitution P369L, six had substitutions at residue D185 (three to N and one each to P, G, and S), and one each had the S364H and S365P substitutions, with all clones but one containing at least one of the mutations reported to affect b12 activity. (However, it should be pointed out that P369L has recently been shown to be tolerated in the context of subtype C envelopes without a major impact on b12 binding or neutralizing activity,⁶⁶ which makes uncertain the role of this mutation in b12 resistance of subtype G and F envelopes.)

2G12

This MAb recognizes a mannose-dependent epitope on gp120, with N-linked glycans attached to residues 295, 332, and 392 being the most important for binding.^67,68 Thirteen subtype G and four subtype F envelope clones lacked one or more potential N-linked glycosylation (PNLG) sites (NXS/T) at these positions, which may explain their resistance to 2G12. However, one subtype G and two subtype F 2G12-resistant clones had all three mentioned PNLG sites, with the F clones also containing two additional PNGL sites, at 339 and 397 positions, known to contribute to 2G12 binding.⁶⁸

2F5

This MAb recognizes the core epitope ELDKWA at the membrane-proximal external region (MPER) of gp41,⁶⁹ with DKW residues (at positions 664–666) being critical for 2F5 binding and neutralization activity.^70,71 Among the subtype G clones, there was a perfect correlation between mutations at the DKW motif and resistance to neutralization, with both resistant clones containing mutations at K665. Among the subtype F clones, only three had mutations at the DKW motif, and one maintained all residues of the previously defined core epitope (ELDKWA), although all were resistant to 2F5.

4E10

This MAb binds to a linear epitope at the MPER of gp41 adjacent to the 2F5 epitope, with the core sequence NWF(D/N)IT (residues 671–676).⁷¹ Site-directed mutagenesis using an alanine scanning strategy has shown that mutations at residues W672, F673, at the core epitope, and W680, seven residues C-terminal of these two, result in resistance to neutralization by 4E10.⁷¹ Among the four subtype G envelope clones resistant to 4E10, two had mutations at one or more of the mentioned residues. However, the three other subtype G and the only subtype F 4E10-resistant clones lacked mutations at these residues or other mutations known to decrease 4E10 binding.⁷²

Coreceptor usage

In vitro assays of pseudoviruses using GHOST-CCR5 and GHOST-CXCR4 cells revealed that all tested subtype G clones were CCR5-tropic, including seven from patients with CD4⁺ T cell counts <200 cells/ml. The results were generally consistent with four genotypic prediction methods, although for two envelopes the Geno2Pheno program predicted CXCR4 usage when using false-positive rate cut-offs ≥2.5% and ≥10%, respectively (Table 4). Regarding the subtype F envelopes, six clones were CCR5-tropic and one was dual CCR5- and CXCR4-tropic. Four genotypic methods were concordant in predicting the R5 phenotype for all seven subtype F envelopes (Table 4).

Table 4.

Coreceptor Usage in GHOST Cells and Genotypic Prediction of Envelope Clones

			Genotypic coreceptor usage prediction
Clone	Subtype/CRF	Coreceptor usage (GHOST) ^a	V3 net charge ^b	11/25 rule ^c	PSSM ^d	Geno2Pheno ^e
EX15_B5	G	R5	+2	R5	R5	R5
P402-2_C11	G	R5	+3	R5	R5	R5
P1909_C5_6	G	R5	+4	R5	R5	R5
P1981_C5_B3	G	R5	+3	R5	R5	R5
X558-8_B12_6	G	R5	+3	R5	R5	R5
X1193_C1	G	R5	+2	R5	R5	R5
X1254_C3	G	R5	+2	R5	R5	R5
X1632_S2_B10	G	R5	+4	R5	R5	R5
X1854_2_10	G	R5	+2	R5	R5	R5
X2088_9	G	R5	+4	R5	R5	R5
X2131_C1_B5	G	R5	+2	R5	R5	R5/X4
X2160_R25	G	R5	+2	R5	R5	R5
X2470_F8_12	G	R5	+3	R5	R5	R5
X2486_G12_3	G	R5	+2	R5	R5	R5/X4
X2558_A3	G	R5	+3	R5	R5	R5
CH12_C_2_6	44_BF	R5	+3	R5	R5	R5
MFU14_2_F7_7	F1	R5	+4	R5	R5	R5
P1655_C8_B5_1	F1	R5X4	+4	R5	R5	R5
P2059_B12	F2	R5	+3	R5	R5	R5
P2355_E4_2	12_BF	R5	+4	R5	R5	R5
RUSP816_B3_ST11	F1	R5	+4	R5	R5	R5
X2687_F3	F1	R5	+4	R5	R5	R5

R5: CCR5. R5X4: CCR5 and CXCR4.

Calculated by subtracting negatively charged residues from positively charged ones in the V3 loop of Env: (R + K)−(D + E). V3 net charge ≥+5 is associated with CXCR4 usage.⁵⁴

Presence of basic amino acids residues at the 11 or 25 position in the V3 loop (corresponding to positions 306 and 322 in HXB2 Env) is associated with CXCR4 usage or syncytium-inducing phenotype.⁵⁵

The subtype B X4R5 matrix was used for the analysis.

R5/X4: CXCR4 tropism is predicted when using a false-positive rate cutoff ≥ 2.5% (X2486) or ≥ 10% (X2131).

Discussion

Here we report the construction of 15 subtype G and seven subtype F functional envelope clones, which were analyzed for coreceptor usage and neutralization properties. Previously, only one subtype G and two subtype F functional envelope clones, derived from in vitro cultured viruses, had been reported in the literature.²⁶ The newly derived clones were obtained from plasma by a single genome amplification assay, cloned into an expression vector, and tested for functionality in a pseudovirus assay using TZM-bl reporter cells.¹⁹ All clones selected for high functionality, each from a different individual, yielded a luminescence signal at least 50 times above background levels, which renders them usable in neutralization assays.

The methods employed to obtain the functional Env clones were similar to those that have previously been described.^19,46 However, several modifications were introduced to increase the efficiency of amplification and cloning and to reduce costs. First, PCR primers were designed to recognize sequences highly conserved in group M. Second, amplification was done by one-step RT-PCR using a mixture of Taq and Pfu DNA polymerases and a small amount (1/20 that recommended by the manufacturer) of SuperScript III reverse transcriptase (this protocol was modified from the one used for amplification of hepatitis C virus RNA⁷³); this resulted in much reduced costs and a greater efficiency of amplification, compared to a published two-step RT-PCR protocol⁴⁶ (results not shown). And third, a seven nucleotide extension, GTTTCTT, was appended to 5′ ends of nested primers to increase adenosine addition to the 3′ ends of PCR products⁴⁵; this modification proved to be essential for high efficiency cloning.

Analysis of neutralization by broadly neutralizing MAbs using a pseudovirion assay revealed that subtype G envelopes were uniformly resistant to b12 and 2G12, targeted to gp120, and a majority was susceptible to 2F5 and 4E10, targeted to the MPER of gp41. However, the activities of these MAbs were relatively low, with pseudoviruses derived from only one envelope clone being neutralized by 4E10 at concentrations <1.0 μg/ml. These results are similar to those reported using 15 plasmids expressing subtype G Env libraries,⁷⁴ which showed low frequency (13% and 20%, respectively) susceptibility to b12 and 2G12 and high frequency (80% and 100%, respectively) neutralization by 2F5 and 4E10, although, in contrast to the previous study, susceptibility to 4E10 was not uniform among the clones tested by us. The pattern of susceptibility to broadly neutralizing MAbs observed for subtype G envelope clones resembles that previously described for subtype A²⁰ and CRF01_AE^24,25 clones. With regard to the subtype F clones, only 4E10 neutralized most pseudoviruses (six of seven), with 2F5 and b12 being uniformly ineffective and 2G12 being effective only against pseudoviruses derived from one clone. These results point to subtype F as the group M clade showing the widest resistance to the four broadly neutralizing MAbs raised against subtype B used in this study, since other clades are frequently neutralized by at least two of these MAbs, as shown in previous reports and in this study, with only subtype B being frequently neutralized by all four MAbs.^11,19,21 The results also show that 4E10 is the only broadly neutralizing MAb used in this study capable of neutralizing viruses across all major group M clades, including subtypes G and F, although its potency is considerably lower than that of the recently reported broadly neutralizing MAbs PG9, PG16, VRC01, and VRC02.^74,75 Previous studies have shown that most subtype C viruses are resistant to 2F5^76,11,12 and here we show that subtype F viruses are also resistant to this MAb. The MAbs targeted to gp120 show even more restricted activities, with 2G12 being frequently effective only against subtype B viruses and b12 only against viruses of subtypes B, D, and C.

Analysis of the sequences of epitopes targeted by the MAbs showed that clones containing mutations at residues known to be critical for MAb binding and neutralization were resistant to neutralization by the corresponding MAbs. However, some clones resistant to 2G12, 2F5, and 4E10 lacked known resistance-associated mutations at the epitopes (Table 3), a phenomenon previously reported by other authors.^{11,12,14,20,72} This was most frequently seen among subtype F envelope clones, all of which were resistant to 2F5, although four of them lacked mutations at the DKW motif critical for 2F5 binding.^70,71 This suggests that conformational changes determined by extraepitopic substitutions may influence resistance to MAbs in these clones.

HIVIG, consisting of polyclonal immunoglobulin from HIV-1 subtype B-infected individuals, neutralized only four (27%) of 15 subtype G-enveloped pseudoviruses but six (86%) of seven subtype F-enveloped pseudoviruses. This suggests a limited B–G cross-clade neutralizing activity of sera from HIV-1-infected individuals (similar to what has been reported for other serum–pseudovirus clade pairs^12,14) but a relatively high degree of B–F cross-clade neutralizing activity, which could reflect the closer phylogenetic relatedness of subtype B to subtype F relative to other subtypes (except D).⁷⁷

While the subtype G and F Env pseudoviruses described here do not appear to be unusually sensitive to antibody-mediated neutralization (as compared to sensitive tissue culture laboratory adapted viruses), it will be important to more thoroughly characterize the neutralization profile of these viruses using genetically diverse HIV-1⁺ serum samples to assess whether they exhibit a Tier 1- or Tier 2-like phenotype.¹⁶

The envelope clones were also tested for the usage of coreceptors for cell entry in GHOST cells. Entry of HIV-1 into target cell is mediated through the interaction of the envelope with CD4 and a coreceptor, usually the β-chemokine receptors CCR5 and CXCR4. Initial infection is almost invariably established by CCR5-tropic (R5) variants, which predominate until late stages of the infection, when CXCR4-tropic (X4) or dual-tropic (R5X4) viruses frequently emerge, concomitantly with a faster CD4⁺ T cell decline. It has been reported that CXCR4 coreceptor usage is common in advanced HIV-1 infection in most major HIV-1 clades, except in subtype C.^78
–80 However, data on coreceptor usage for subtype G viruses are insufficient, and were not reviewed in a recent article,⁸¹ probably due to the relatively low number of isolates analyzed, particularly at late stages of infection. We found that all 15 subtype G envelope clones exhibited an R5 phenotype, including those from seven patients with CD4⁺ cell counts below 200/ml. This result is concordant with previous studies performed with subtype G isolates suggesting an overrepresentation of the R5 phenotype, which was observed in 22 of 24 viruses, including eight from Cameroon,^82,83 six from Ghana (all from AIDS patients),⁸⁴ and eight from Spain.^85
–87 One envelope clone from Uganda²⁶ and one isolate from Russia⁸⁸ exhibited a non-syncytium-inducing phenotype, usually associated with CCR5-tropism. Only two subtype G viruses have been reported to use CXCR4.^78,82 Thus, out of 41 analyzed subtype G viruses or envelope clones, all but two were of the R5 phenotype, including 13 from 15 patients with AIDS or CD4⁺ T cell counts <200/ml. The results reported here, together with those reported previously using primary viral isolates, suggest that, similarly to subtype C,^78
–80 CXCR4 coreceptor usage is uncommon in subtype G, even at late stages of the infection.

With regard to coreceptor utilization by subtype F envelope clones, we found that six exhibited an R5 phenotype and one an R5X4 phenotype. The dual-tropic envelope corresponds to a patient with AIDS, while three other AIDS patients had R5 envelopes. A literature review reveals that of a total of 55 viruses of subtype F or with a subtype F envelope whose phenotype was analyzed, 47 were of R5 or non-syncytium-inducing phenotype and eight were of X4, R5X4, or syncytium-inducing phenotype.^{78,82,83,85,87,89

–92} These studies included four viruses from adult patients reported to have AIDS^82,85 and 34 vertically infected children with “serious infections,”^89,90 eight of which (three adults and five children) were of R5X4 or X4 phenotypes. Taken together, our results with envelope clones and those reported by other authors with viral isolates suggest that CXCR4 usage by subtype F viruses may be relatively common in late stages of the infection in adult individuals, although analysis of more viruses from patients with AIDS or late-stage infection would be necessary to estimate the frequency of CXCR4 utilization by this subtype in advanced disease. Four genotypic methods for coreceptor usage prediction were correct in predicting the R5 phenotype in six subtype F envelopes, but CXCR4 usage by P1655_C8_B5_1 failed to be predicted by all methods. In this regard, it should be pointed out that genotypic methods have been shown to perform poorly for predicting CXCR4 usage in non-subtype B clades⁹³ and that the 11/25 rule⁵⁴ failed to predict CXCR4 usage in all five Romanian subtype F X4 viruses when DNA from peripheral blood mononuclear cell cultures was analyzed and in three of five of these viruses when virion RNA was analyzed.^89,90 Our own analyses of V3 sequences from previously reported subtype F X4 or R5X4 viruses using Geno2Pheno and Web PSSM programs further confirm the low sensitivity of genotypic methods for predicting CXCR4 usage by subtype F viruses (results not shown).

In conclusion, 15 subtype G and seven subtype F functional envelope clones derived from plasma of HIV-1-infected individuals have been obtained, which could be used as references in studies on antibody-mediated neutralization, coreceptor usage, or susceptibility to viral entry inhibitor drugs. The envelopes could also be employed to construct chimeric simian–human immunodeficiency viruses for use in the macaque model and as immunogens in HIV-1 vaccines. In a pseudovirion assay all subtype G envelopes were resistant to broadly neutralizing MAbs b12 and 2G12, but were frequently neutralized by MAbs 2F5 and 4E10, a pattern resembling that previously reported for subtype A and CRF01_AE envelope clones, and all but one of the subtype F envelopes were resistant to at least three of the four MAbs, of which only 4E10 was active against most subtype F-enveloped pseudoviruses. Subtype G envelopes were uniformly of the R5 phenotype, including those from seven patients with CD4⁺ T cell counts below 200/ml, which, together with reported results using viral isolates, suggests that, similar to subtype C, switch to or acquisition of CXCR4 coreceptor usage along the course of infection is infrequent in subtype G, implying that CCR5 antagonist drugs are expected to be effective against most HIV-1 subtype G viruses.

Sequence Data

Sequences have been deposited in GenBank under accessions EU885759, EU885761–EU885765, FJ817368–FJ817371, GQ222684, GQ222685, GQ222687, GQ862780, GQ862781, GU332502–GU332507, GU332509, GU332513, HM068551, and HM068553.

Footnotes

Acknowledgments

We thank the personnel at the Genomic Unit, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Spain, for technical assistance in sequencing; Milagros Pinilla and Ana Sánchez for assistance in sample and data processing; and Rafael Delgado and Lorena Martínez Prats for help in setting up the envelope cloning method. This work was funded through Collaboration for AIDS Vaccine Discovery/Comprehensive Antibody-Viral Immune Monitoring Consortium (Bill and Melinda Gates Foundation, award #38619). Ana Revilla and Elena Delgado contributed equally to this work.

Author Disclosure Statement

No competing financial interests exist.

References

Thomson

, Pérez-Álvarez

, Nájera

. Molecular epidemiology of HIV-genetic forms and its significance for vaccine development and therapy. Lancet Infect Dis, 2002; 2:461–471.

Gaschen

, Taylor

, Yusim

et al. Diversity considerations in HIV-1 vaccine selection. Science, 2002; 296:2354–2360.

HIV Sequence Database. http://www.hiv.lanl.gov.

Thomson

, Nájera

. Molecular epidemiology of HIV-1 variants in the global AIDS pandemic: An update. AIDS Rev, 2005; 7:210–224.

Hemelaar

, Gouws

, Ghys

, Osmanov

. Global and regional distribution of HIV-1 genetic subtypes and recombinants in 2004. AIDS, 2006; 20:W13–W23.

Mascola

, Montefiori

. The role of antibodies in HIV vaccines. Annu Rev Immunol, 2010; 28:413–444.

Shibata

, Igarashi

, Haigwood

et al. Neutralizing antibody directed against the HIV-1 envelope glycoprotein can completely block HIV-1/SIV chimeric virus infections of macaque monkeys. Nat Med, 1999; 5:204–210.

Mascola

, Stiegler

, VanCott

et al. Protection of macaques against vaginal transmission of a pathogenic HIV-1/SIV chimeric virus by passive infusion of neutralizing antibodies. Nat Med, 2000; 6:207–210.

Baba

, Liska

, Hofmann-Lehmann

et al. Human neutralizing monoclonal antibodies of the IgG1 subtype protect against mucosal simian-human immunodeficiency virus infection. Nat Med, 2000; 6:200–206.

10.

Mascola

, Louwagie

, McCutchan

et al. Two antigenically distinct subtypes of human immunodeficiency virus type 1: Viral genotype predicts neutralization serotype. J Infect Dis, 1994; 169:48–54.

11.

Binley

, Wrin

, Korber

et al. Comprehensive cross-clade neutralization analysis of a panel of anti-human immunodeficiency virus type 1 monoclonal antibodies. J Virol, 2004; 78:13232–13252.

12.

, Salazar-González

, Derdeyn

et al. Genetic and neutralization properties of subtype C human immunodeficiency virus type 1 molecular env clones from acute and early heterosexually acquired infections in Southern Africa. J Virol, 2006; 80:11776–11790.

13.

Brown

, Wieczorek

, Sanders-Buell

et al. Cross-clade neutralization patterns among HIV-1 strains from the six major clades of the pandemic evaluated and compared in two different models. Virology, 2008; 375:529–538.

14.

Blish

, Jalalian-Lechak

, Rainwater

, Nguyen

, Dogan

, Overbaugh

. Cross-subtype neutralization sensitivity despite monoclonal antibody resistance among early subtype A, C, and D envelope variants of human immunodeficiency virus type 1. J Virol, 2009; 83:7783–7788.

15.

van Gils

, Edo-Matas

, Schweighardt

, Wrin

, Schuitemaker

. High prevalence of neutralizing activity against multiple unrelated human immunodeficiency virus type 1 (HIV-1) subtype B variants in sera from HIV-1 subtype B-infected individuals: Evidence for subtype-specific rather than strain-specific neutralizing activity. J Gen Virol, 2010; 91:250–258.

16.

Seaman

, Janes

, Hawkins

et al. Tiered categorization of a diverse panel of HIV-1 Env pseudoviruses for assessment of neutralizing antibodies. J Virol, 2010; 84:1439–1452.

17.

Mascola

, D'Souza

, Gilbert

et al. Recommendations for the design and use of standard virus panels to assess neutralizing antibody responses elicited by candidate human immunodeficiency virus type 1 vaccines. J Virol, 2005; 79:10103–10107.

18.

Polonis

, Schuitemaker

, Bunnik

, Brown

, Scarlatti

. Impact of host cell variation on the neutralization of HIV-1 in vitro. Curr Opin HIV AIDS, 2009; 4:400–407.

19.

, Gao

, Mascola

et al. Human immunodeficiency virus type 1 env clones from acute and early subtype B infections for standardized assessments of vaccine-elicited neutralizing antibodies. J Virol, 2005; 79:10108–10125.

20.

Blish

, Nedellec

, Mandaliya

, Mosier

, Overbaugh

. HIV-1 subtype A envelope variants from early in infection have variable sensitivity to neutralization and to inhibitors of viral entry. AIDS, 2007; 21:693–702.

21.

Schweighardt

, Liu

, Huang

et al. Development of an HIV-1 reference panel of subtype B envelope clones isolated from the plasma of recently infected individuals. J Acquir Immune Defic Syndr, 2007; 46:1–11.

22.

Gray

, Meyers

, Gray

, Montefiori

, Morris

. Insensitivity of paediatric HIV-1 subtype C viruses to broadly neutralising monoclonal antibodies raised against subtype B. PLoS Med, 2006; 3:e255.

23.

Kulkarni

, Lapedes

, Tang

et al. Highly complex neutralization determinants on a monophyletic lineage of newly transmitted subtype C HIV-1 Env clones from India. Virology, 2009; 385:505–520.

24.

Utachee

, Jinnopat

, Isarangkura-Na-Ayuthaya

et al. Phenotypic studies on recombinant human immunodeficiency virus type 1 (HIV-1) containing CRF01_AE env gene derived from HIV-1-infected patient, residing in central Thailand. Microbes Infect, 2009; 11:334–343.

25.

Nie

, Zhang

, Liu

et al. Genotypic and phenotypic characterization of HIV-1 CRF01_AE env molecular clones from infections in China. J Acquir Immune Defic Syndr, 2010; 53:440–450.

26.

Gao

, Morrison

, Robertson

et al. Molecular cloning and analysis of functional envelope genes from human immunodeficiency virus type 1 sequence subtypes A through G. The WHO and NIAID Networks for HIV Isolation and Characterization. J Virol, 1996; 70:1651–1667.

27.

Agwale

, Zeh

, Robbins

et al. Molecular surveillance of HIV-1 field strains in Nigeria in preparation for vaccine trials. Vaccine, 2002; 20:2131–2139.

28.

Peeters

, Esu-Williams

, Vergne

et al. Predominance of subtype A and G HIV type 1 in Nigeria, with geographical differences in their distribution. AIDS Res Hum Retroviruses, 2000; 16:315–325.

29.

Entonu

, Agwale

. A review of the epidemiology, prevention and treatment of human immunodeficiency virus infection in Nigeria. Braz J Infect Dis, 2007; 11:579–590.

30.

Esteves

, Parreira

, Venenno

et al. Molecular epidemiology of HIV type 1 infection in Portugal: High prevalence of non-B subtypes. AIDS Res Hum Retroviruses, 2002; 18:313–325.

31.

Niama

, Toure-Kane

, Vidal

et al. HIV-1 subtypes and recombinants in the Republic of Congo. Infect Genet Evol, 2006; 6:337–343.

32.

Thomson

, Delgado

, Manjón

et al. HIV-1 genetic diversity in Galicia Spain: BG intersubtype recombinant viruses are circulating among injecting drug users. AIDS, 2001; 15:509–516.

33.

Delgado

, Thomson

, Villahermosa

et al. Identification of a newly characterized HIV-1 BG intersubtype circulating recombinant form in Galicia, Spain, which exhibits a pseudotype-like virion structure. J Acquir Immune Defic Syndr, 2002; 29:536–543.

34.

Pérez

, Thomson

, Bleda

et al. HIV Type 1 molecular epidemiology in Cuba: High genetic diversity, frequent mosaicism, and recent expansion of BG intersubtype recombinant forms. AIDS Res Hum Retroviruses, 2006; 22:724–733.

35.

Sierra

, Thomson

, Posada

et al. Identification of 3 phylogenetically related HIV-1 BG intersubtype circulating recombinant forms in Cuba. J Acquir Immune Defic Syndr, 2007; 45:151–160.

36.

Apetrei

, Necula

, Holm-Hansen

et al. HIV-1 diversity in Romania. AIDS, 1998; 12:1079–1085.

37.

Triques

, Bourgeois

, Saragosti

et al. High diversity of HIV-1 subtype F strains in Central Africa. Virology, 1999; 259:99–109.

38.

Thomson

, Sierra

, Tanuri

et al. Analysis of near full-length genome sequences of HIV type 1 BF intersubtype recombinant viruses from Brazil reveals their independent origins and their lack of relationship to CRF12_BF. AIDS Res Hum Retroviruses, 2004; 20:1126–1133.

39.

Sanabani

, Kleine

, Kalmar

, Diaz

, Janini

, Sabino

. Analysis of the near full length genomes of HIV-1 subtypes B, F and BF recombinant from a cohort of 14 patients in Sao Paulo, Brazil. Infect Genet Evol, 2006; 6:368–377.

40.

Thomson

, Villahermosa

, Vázquez de Parga

et al. Widespread circulation of a B/F intersubtype recombinant form among HIV-1-infected individuals in Buenos Aires, Argentina. AIDS, 2000; 14:897–899.

41.

Thomson

, Delgado

, Herrero

et al. Diversity of mosaic structures and common ancestry of human immunodeficiency virus type 1 BF intersubtype recombinant viruses from Argentina revealed by analysis of near full-length genome sequences. J Gen Virol, 2002; 83:107–119.

42.

Carr

, Avila

, Gomez

et al. Diverse BF recombinants have spread widely since the introduction of HIV-1 into South America. AIDS, 2001; 15:F41–F47.

43.

Ríos

, Delgado

, Pérez-Álvarez

et al. Antiretroviral drug resistance and phylogenetic diversity of HIV-1 in Chile. J Med Virol, 2007; 79:647–656.

44.

Delgado

, Rios

, Fernández

, Pérez-Álvarez

, Nájera

, Thomson

. Identification of a new HIV-1 BF intersubtype circulating recombinant form (CRF44_BF) in Chile. AIDS Res Hum Retroviruses, 2010; 26:821–826.

45.

Brownstein

, Carpten

, Smith

. Modulation of non-templated nucleotide addition by Taq DNA polymerase: Primer modifications that facilitate genotyping. Biotechniques, 1996; 20:1004–1010.

46.

Salazar-González

, Bailes

, Pham

et al. Deciphering human immunodeficiency virus type 1 transmission and early envelope diversification by single-genome amplification and sequencing. J Virol, 2008; 82:3952–3970.

47.

Wei

, Decker

, Liu

et al. Emergence of resistant human immunodeficiency virus type 1 in patients receiving fusion inhibitor (T-20) monotherapy. Antimicrob Agents Chemother, 2002; 46:1896–1905.

48.

Katoh

, Kuma

, Toh

, Miyata

. MAFFT version 5: Improvement in accuracy of multiple sequence alignment. Nucleic Acids Res, 2005; 33:511–518.

49.

Stamatakis

, Hoover

, Rougemont

. A rapid bootstrap algorithm for the RAxML Web servers. Syst Biol, 2008; 57:758–771.

50.

Lole

, Bollinger

, Paranjape

et al. Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J Virol, 1999; 73:152–160.

51.

Montefiori

. Evaluating neutralizing antibodies against HIV, SIV, and SHIV in luciferase reporter gene assays. Curr Protoc Immunol, 2004Chapter 12: Unit 12.11.

52.

Cecilia

, KewalRamani

, O'Leary

et al. Neutralization profiles of primary human immunodeficiency virus type 1 isolates in the context of coreceptor usage. J Virol, 1998; 72:6988–6996.

53.

Vodros

, Tscherning-Casper

, Navea

, Schols

, De Clercq

, Fenyo

. Quantitative evaluation of HIV-1 coreceptor use in the GHOST3 cell assay. Virology, 2001; 291:1–11.

54.

Briggs

, Tuttle

, Sleasman

, Goodenow

. Envelope V3 amino acid sequence predicts HIV-1 phenotype (co-receptor usage and tropism for macrophages) AIDS, 2000; 14:2937–2939.

55.

Fouchier

, Groenink

, Kootstra

et al. Phenotype-associated sequence variation in the third variable domain of the human immunodeficiency virus type 1 gp120 molecule. J Virol, 1992; 66:3183–3187.

56.

Jensen

, Li

, van't Wout

et al. Improved coreceptor usage prediction and genotypic monitoring of R5-to-X4 transition by motif analysis of human immunodeficiency virus type 1 env V3 loop sequences. J Virol, 2003; 77:13376–13388.

57.

Sing

, Low

, Beerenwinkel

et al. Predicting HIV coreceptor usage on the basis of genetic and clinical covariates. Antivir Ther, 2007; 12:1097–1106.

58.

Fernández-García

, Cuevas

, Vinogradova

et al. Near full-length genome characterization of a newly identified HIV type 1 subtype F variant circulating in St. Petersburg, Russia. AIDS Res Hum Retroviruses, 2009; 25:1187–1191.

59.

Buchacher

, Predl

, Strutzenberger

et al. Generation of human monoclonal antibodies against HIV-1 proteins; electrofusion and Epstein-Barr virus transformation for peripheral blood lymphocyte immortalization. AIDS Res Hum Retroviruses, 1994; 10:359–369.

60.

Burton

, Barbas

, Persson

, Koenig

, Chanock

, Lerner

. A large array of human monoclonal antibodies to type 1 human immunodeficiency virus from combinatorial libraries of asymptomatic seropositive individuals. Proc Natl Acad Sci USA, 1991; 88:10134–10137.

61.

Burton

, Pyati

, Koduri

et al. Efficient neutralization of primary isolates of HIV-1 by a recombinant human monoclonal antibody. Science, 1994; 266:1024–1027.

62.

Saphire

, Stanfield

, Crispin

et al. Crystal structure of an intact human IgG: antibody asymmetry, flexibility, and a guide for HIV-1 vaccine design. Adv Exp Med Biol, 2003; 535:55–66.

63.

, Stamatatos

, Ip

et al. Human immunodeficiency virus type 1 mutants that escape neutralization by human monoclonal antibody IgG1b12. J Virol, 1997; 71:6869–6874.

64.

Pantophlet

, Ollmann

, Poignard

, Parren

, Wilson

, Burton

. Fine mapping of the interaction of neutralizing and nonneutralizing monoclonal antibodies with the CD4 binding site of human immunodeficiency virus type 1 gp120. J Virol, 2003; 77:642–658.

65.

Duenas-Decamp

, Peters

, Burton

, Clapham

. Natural resistance of human immunodeficiency virus type 1 to the CD4bs antibody b12 conferred by a glycan and an arginine residue close to the CD4 binding loop. J Virol, 2008; 82:5807–5814.

66.

, Zhou

, O'Dell

, Wyatt

, Kwong

, Mascola

. Mechanism of human immunodeficiency virus type 1 resistance to monoclonal antibody b12 that effectively targets the site of CD4 attachment. J Virol, 2010; 83:10892–10906.

67.

Scanlan

, Pantophlet

, Wormald

et al. The broadly neutralizing anti-human immunodeficiency virus type 1 antibody 2G12 recognizes a cluster of alpha1 → 2 mannose residues on the outer face of gp120. J Virol, 2002; 76:7306–7321.

68.

Sanders

, Venturi

, Schiffner

et al. The mannose-dependent epitope for neutralizing antibody 2G12 on human immunodeficiency virus type 1 glycoprotein gp120. J Virol, 2002; 76:7293–7305.

69.

Muster

, Steindl

, Purtscher

et al. A conserved neutralizing epitope on gp41 of human immunodeficiency virus type 1. J Virol, 1993; 67:6642–6647.

70.

Tian

, Ramesh

, Ma

et al. Structure-affinity relationships in the gp41 ELDKWA epitope for the HIV-1 neutralizing monoclonal antibody 2F5: Effects of side-chain and backbone modifications and conformational constraints. J Pept Res, 2002; 59:264–276.

71.

Zwick

, Jensen

, Church

et al. Anti-human immunodeficiency virus type 1 (HIV-1) antibodies 2F5 and 4E10 require surprisingly few crucial residues in the membrane-proximal external region of glycoprotein gp41 to neutralize HIV-1. J Virol, 2005; 79:1252–1261.

72.

Zwick

, Labrijn

, Wang

et al. Broadly neutralizing antibodies targeted to the membrane-proximal external region of human immunodeficiency virus type 1 glycoprotein gp41. J Virol, 2001; 75:10892–10905.

73.

Payan

, Dupre

, Belec

. Detection of hepatitis C virus RNA by a reliable, optimized single-step reverse transcription polymerase chain reaction. Res Virol, 1995; 146:363–370.

74.

Walker

, Phogat

, Chan-Hui

et al. Broad and potent neutralizing antibodies from an African donor reveal a new HIV-1 vaccine target. Science, 2009; 326:285–289.

75.

, Yang

Z-Y

, Li

et al. Rational design of envelope identifies broadly neutralizing human monoclonal antibodies to HIV-1. Science, 2010; 329:856–861.

76.

Bures

, Morris

, Williamson

et al. Regional clustering of shared neutralization determinants on primary isolates of clade C human immunodeficiency virus type 1 from South Africa. J Virol, 2002; 76:2233–2244.

77.

Zhu

, Korber

, Nahmias

et al. An African HIV-1 sequence from 1959 and implications for the origin of the epidemic. Nature, 1998; 391:594–597.

78.

Tscherning

, Alaeus

, Fredriksson

et al. Differences in chemokine coreceptor usage between genetic subtypes of HIV-1. Virology, 1998; 241:181–188.

79.

Abebe

, Demissie

, Goudsmit

et al. HIV-1 subtype C syncytium- and non-syncytium-inducing phenotypes and coreceptor usage among Ethiopian patients with AIDS. AIDS, 1999; 13:1305–1311.

80.

Bjorndal

, Sonnerborg

, Tscherning

, Albert

, Fenyo

. Phenotypic characteristics of human immunodeficiency virus type 1 subtype C isolates of Ethiopian AIDS patients. AIDS Res Hum Retroviruses, 1999; 15:647–653.

81.

Esbjornsson

, Mansson

, Martínez-Arias

et al. Frequent CXCR4 tropism of HIV-1 subtype A and CRF02_AG during late-stage disease–indication of an evolving epidemic in West Africa. Retrovirology, 2010; 7:23.

82.

Tebit

, Zekeng

, Kaptue

, Salminen

, Krausslich

, Herchenroder

. Genotypic and phenotypic analysis of HIV type 1 primary isolates from western Cameroon. AIDS Res Hum Retroviruses, 2002; 18:39–48.

83.

Zhong

, Burda

, Konings

et al. Genetic and biological properties of HIV type 1 isolates prevalent in villagers of the Cameroon equatorial rain forests and grass fields: Further evidence of broad HIV type 1 genetic diversity. AIDS Res Hum Retroviruses, 2003; 19:1167–1178.

84.

Brandful

, Coetzer

, Cilliers

et al. Phenotypic characterization of HIV type 1 isolates from Ghana. AIDS Res Hum Retroviruses, 2007; 23:144–152.

85.

Pérez-Álvarez

, Muñoz

, Delgado

et al. Isolation and biological characterization of HIV-1 BG intersubtype recombinants and other genetic forms circulating in Galicia, Spain. J Med Virol, 2006; 78:1520–1528.

86.

Fernández-García

, Cuevas

, Muñoz-Nieto

et al. Development of a panel of well-characterized human immunodeficiency virus type 1 isolates from newly diagnosed patients including acute and recent infections. AIDS Res Hum Retroviruses, 2009; 25:93–102.

87.

Cuevas

, Fernández-García

, Pinilla

et al. Biological and genetic characterization of HIV-1 subtype B and non-subtype B transmitted viruses: Usefulness for vaccine candidate assessment. AIDS Res Human Retroviruses, 2010; 26:1019–1025.

88.

Leitner

, Korovina

, Marquina

, Smolskaya

, Albert

. Molecular epidemiology and MT-2 cell tropism of Russian HIV type 1 variant. AIDS Res Hum Retroviruses, 1996; 12:1595–1603.

89.

Holm-Hansen

, Grothues

, Rustad

, Røsok

, Pascu

, Åsjö

. Characterization of HIV type 1 from Romanian children: Lack of correlation between V3 loop amino acid sequence and syncytium formation in MT-2 cells. AIDS Res Hum Retroviruses, 1995; 11:597–603.

90.

Holm-Hansen

, Baan

, Åsjö

, Pascu

, Goudsmit

, De Jong

. Determinants form syncytium-inducing phenotype of HIV-1 subtype F isolates are located in the V3 region. AIDS Res Hum Retroviruses, 2000; 16:867–870.

91.

Tscherning-Casper

, Vodros

, Menu

et al. Coreceptor usage of HIV-1 isolates representing different genetic subtypes obtained from pregnant Cameroonian women. European Network for In Utero Transmission of HIV-1. J Acquir Immune Defic Syndr, 2000; 24:1–9.

92.

Ragupathy

, Zhao

, Wang

et al. Comparative analysis of cell culture and prediction algorithms for phenotyping of genetically diverse HIV-1 strains from Cameroon. AIDS Res Ther, 2009; 6:27.

93.

Garrido

, Roulet

, Chueca

et al. Evaluation of eight different bioinformatics tools to predict viral tropism in different human immunodeficiency virus type 1 subtypes. J Clin Microbiol, 2008; 46:887–891.