A Novel HIV-1 CRF01_AE/B Recombinant Among Men Who Have Sex with Men in Jiangsu Province,China

Abstract

CRF01_AE and subtype B are the two of major HIV-1 clades circulating in China. HIV spread more rapidly among men who have sex with men (MSM) than among populations with other risk behaviors. In Jiangsu province in China, the HIV-1 incidence among MSM was more than 3.8%. Our previous study showed that almost equal proportions of CRF01_AE, B, and CRF07_BC were circulating among MSM. Moreover, many kinds of CRF01Bs have been identified among MSM in Southeast Asia in recent years. It is therefore inevitable that recombination between CRF01_AE and subtype B will emerge among MSM in Jiangsu province in China. Here we identify a novel recombinant of CRF01_AE/B that has a distinctly different genome structure from other CRF01Bs and unique recombinant forms (URFs) previously identified. An analysis of the near full-length sequence of JS2010001 showed that it is composed of at least three interlaced CRF01_AE and B segments. Recently, many kinds of URFs and C circulating recombinant forms (CRFs) have emerged among MSM in China within a short period of time, which suggests that dual infection of HIV-1 among MSM in China is very common and that more effective intervening measures to prevent the spread of HIV among MSM should be taken.

The recombination between different subtypes of HIV-1 is one of the major factors causing the high diversity of HIV. Up to now, more than 55 circulating recombinant forms (CRFs) have been identified.^1,2 From 2011 to the present, six CRF_01Bs were identified in succession. These CRF_01Bs are formed by the recombination between CRF01_AE and the B subtype HIV. In China, several recombinants of CRF01_AE and the B subtype have been reported.^3
–5 The recombinants between CRF01_AE and B include CRF55_01B, CRF59_01B, and other unique recombinant forms (URFs).

CRF01_AE originated in central Africa in the 1970s and spread in Thailand in the 1980s through heterosexual transmission.⁶ It was subsequently confirmed as the first large-scale epidemic of a recombinant HIV-1 strain in the world. In the early 1990s, CRF01_AE strains were first identified in China among people at risk for sexual transmission and injecting drug users (IDUs) in Yunnan Province and Guangxi Zhuang Autonomous Region, which is located in the southwest of China and borders Myanmar and Vietnam.^7,8 Subsequently, CRF01_AE strains spread quickly in China, accounting for approximately 28% of nationwide HIV infections in 2006, and becoming the predominant subtype.⁹ More recently, CRF01_AE strains have also become the predominant strain among men who have sex with men (MSM) in China.

Subtype B′, the Thailand variant of subtype B, is also referred to as Thai B.¹⁰ It was originally identified among IDUs in Thailand, and spread into neighboring regions including Myanmar, Malaysia, eastern India, and China.¹¹ It plays a unique role in the genesis of the HIV-1 epidemic in China. Subtype B′ is a single founding strain responsible for HIV-1 outbreaks among former plasma donors (FPD) in central China. In 2005, about 70,000 people living with HIV had been infected through unhygienic plasma collection from the early to the mid-1990s.¹² Subsequently, HIV subtype B began to spread through heterosexual or homosexual transmission.

Among the newly diagnosed HIV-positive population, MSM has been one of the major populations in China since 2009. Sentinel surveillance data also clearly demonstrated the rapidly increasing prevalence of HIV-1 among MSM. Dual infection in one person with HIV-1 among MSM is common due the lack of protective sex behavior and multiple sexual partners.¹³ Therefore, the HIV-1 recombinant is more likely among MSM than among other at-risk populations in China.

Jiangsu province is located in eastern China. The first HIV case was recorded in 1992. By the end of September 2012, 8,960 HIV-1-positive cases had been reported. Among the HIV cases reported in 2012, 93.6% of them acquired their HIV infection through sexual transmission. Of sexual transmissions, homosexual transmission accounted for 48%. Now the high incidence of HIV occurred among MSM in Jiangsu province.^14
–16 Our previous study showed that CRF01_AE and the B subtypes were the two major HIV forms circulating among MSM in Jiangsu province.¹⁶ Recently, many recombinants between CRF01_AE and B have been reported in many regions of the world.^{3,4,17

–20} To determine whether the recombination events appeared among MSM in Jiangsu province, we enrolled HIV-positive MSM who were diagnosed in 2010 to conduct this study.

After obtaining written consent information, we spoke with the MSM in a private room and completed a structured questionnaire. Then 5 ml of whole blood was drawn using an EDTA-K3 vacuum tube (BD Company, USA). The plasma sample was separated by centrifugation at 3,000 rpm for 15 min. HIV antibody was screened using an ELISA kit (BioMerieux Ltd., France) and the positive samples were confirmed using a Western blot assay (Genelabs Diagnostics Pte Ltd., Singapore). Viral RNA was extracted from 140 μl of plasma with a QIAamp Viral RNA Mini Kit (Qiagen, GmbH, Germany) and reverse transcribed into cDNA using a SuperScript First-Strand Synthesis System for reverse transcription polymerase chain reaction (RT-PCR) (Invitrogen, USA) according to the manufacturer's instructions. Reverse transcription of the RNA was performed by priming with UNINEF7′ (GCACTCAAGGCAAGCTTTATTGAGGCTT, HBX2: nt 9,605–9,632). The amplification of HIV fragments was performed based on the previous method.²⁰ The following primers were used in the first round PCR: UNINEF7′, pro5F (AGAAATTGCAGGGCCCCT AGGAA, HBX2: 1,996–2,018), msf12b (AAATCTCTA GCAGTGGCGCCCGAACAG, HBX2: 623–649), and RT3474R (GAATCTCTCTGTTTT CTGCCAGTTC, HBX2: 3,453–3,477) to amplify HIV fragments. The primers were used in the second round PCR as follow: ENVinF1 (TGGAAGCATCCRGGAAGTCA GCCT, HBX2: 5,861–5,884), nefyn05 (GTGTGTAGTTCTGCCAATCAGGGAA, HBX2: 9,157–9,181), OLinF1 (AGGACCTA CRCCTGTCA ACATAATTGG, HBX2: 2,483–2,509), VIF-VPUinR (CTCT CATTGCCACTGTCTTCTGCTC, HBX2: 6,207–6,231), f2nst (GCGGAGGCTAGAAGGAGAGAGATGG, HBX2: 769–793), and proRT (TTTCCCCACTAACTTCTGTATG TCATTGAC A, HBX2: 3,308–3,338).

PCR products were purified using a gel extraction kit (Qiagen, GmbH, Germany) and then sequenced on an ABI 3730X DNA analyzer using BigDye terminators (Applied Biosystems, Foster City, CA). The sequences were blasted with all the sequences obtained in the laboratory for confirmation with previous results and to avoid possible cross-contamination. The sequences determined in this study are available in GenBank under accession number KF758551.

DNA sequences were assembled using Contig software. The sequences were blasted with all the sequences obtained in the laboratory for confirmation with previous results and to avoid possible cross-contamination. A codon-aligned nucleotide sequence alignment was constructed using the Gene Cutter tool from the Los Alamos HIV sequence database (www.hiv.lanl.gov/ content/GENE CUTTER /cutter.html) and then adjusted manually with BioEdit software.

Nucleotide sequences were aligned manually using MEGA version 5.1, with HIV-1 reference subtypes and CRFs from the HIV database (http://hiv-web.lanl.gov/). Phylogenetic trees were constructed by the neighbor-joining method based on the Kimura two-parameter model with a transition-to-transversion ratio of 2.0. The reliability of the branching orders was tested by bootstrap analysis of 1,000 replicates. Bootscanning and informative-site analyses were performed using SimPlot, version 3.5, with a sliding window of 300 nucleotides overlapped by 20 nucleotides to define the recombinant structure. The origin of each segment was analyzed by subregion neighbor-joining tree analysis. To characterize the detailed subtype structure of the new HIV-1 recombinant strain found in Jiangsu province of China, we determined the near full-length nucleotide sequences of HIV-1.

Using phylogenetic analysis, the near full-length sequences of JS2010001 form a monophyletic branch supported by a bootstrap value of 100%, separate from other global subtypes and known CRFs in the world (Fig. 1). SimPlot analysis reveals that the breakpoint corresponded to HXB2 nucleotide positions 2,759 and 4,876 (Fig. 2). Phylogenetic analysis of the subgenomic fragments confirms the two breakpoints identified (Fig. 3). The genomic fragments 769 to 2,758, 2,759 to 4,875, and 4,876 to 9,181 branched with references CRF01_AE, B, and CRF01_AE, respectively. The breakpoints are completely different from the CRF01B previously reported.

FIG. 1.

The phylogenetic tree of near full-length sequences showing the relationship between JS2010001 and other circulating recombinant forms and subtypes of HIV-1 previously identified.

FIG. 2.

Bootscanning analysis of the near full-length sequence of JS2010001. Top: bootscanning plot of JS2010001 using A1 (PS1044_Day0), B′ (AA040a_WG11), CRF01_AECM240), C (YNRL9840), and H (VI997) as references. Bottom: mosaic map of JS2010001. Breakpoint positions were numbered according to the HXB2 numbering engine (www.hiv.lanl.gov/content/sequence/LOCATE/locate.html). The parameters of SimPlot bootscan analysis were as follows: window size, 300 bps; step size, 20 bps; tree algorithm, neighbor; distance model, Kimura; replicate, 100; reference type, 50% consensus.

FIG. 3.

Phylogenetic analyses of three mosaic segments defined by bootscanning. The phylogenetic trees of three mosaic segments were constructed with MEGA 5.1 using the neighbor-joining method. The stability of the nodes was assessed by bootstrap analysis with 1,000 replications, and only bootstrap values of >75 were shown at the corresponding nodes.

In genomic regions I and III, JS2010001 forms a cluster distinct from the reference CRF01_AE, supported by a strong bootscan value of 100%. In genomic region II, JS2010001 forms a cluster distinct from the reference subtype B, supported by a strong bootscan value of 96%.

The recombinants of CRF01_AE and the B subtype have been reported in some regions of China,^3
–5,19 and they were all formed in the MSM population. Currently, sexual transmission is the predominant mode of HIV-1 transmission in most regions of China. Among the 7.8 million people living with HIV-1 in 2011, 46.5% were infected by heterosexual transmission and 17.4% were infected by homosexual transmission. The incidence of HIV-1 increased among MSM more rapidly than among populations with other risk behaviors. The proportion of cases resulting from sexual transmission increased from 33.1% in 2006 to 76.3% in 2011. The proportion arising from homosexual transmission increased from 2.5% in 2006 to 13.7% in 2011. Of MSM 85% have engaged in sexual activity with multiple homosexual partners within the past 6 months, and only 43% of MSM consistently use condoms during anal sex. Even more, 31.8% of them had regular female partners and 25.9% were currently married to a woman. MSM have played a bridge role in spreading HIV-1 among various populations. Therefore, the multiplicity of infection in HIV is more likely to occur among MSM, which leads to the formation of the new recombinant between subtype and CRF.

In summary, we have identified a novel recombinant form derived from CRF01_AE and subtype B among MSM. Phylogenetic analysis showed that it has the distinct genomic structure of other CRF_01B and URFs reported. Many types of URFs and CRFs have emerged among MSM in a short period in China, which suggests that more effective intervention measures to prevent the spread of HIV-1 among MSM should be taken, and highlights the importance of ongoing molecular epidemiological surveillance among MSM in China.

Sequence Data

The near full-length genomic sequence of JS2010001 has been submitted to GenBank with accession number KF758551.

Footnotes

Acknowledgments

This work is supported by Jiangsu Province's Key Provincial Talents Program (RC2011083), the National Natural Science Foundation of China (NSFC81373125 and NSFC81302466), and the Preventive Medicine Program funded by the Department of Health of Jiangsu Province (Y2012069).

Author Disclosure Statement

No competing financial interests exist.

References

Santosa

, Sousaa

, et al.: Characterization of a new circulating recombinant form comprising HIV-1 subtypes C and B in southern Brazil. AIDS, 2006; 20(16):2011–2019.

Foley

, Leitner

, Apetrei

, et al.: HIV sequence compendium 2013. Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, NM, LA-UR 13-26007, 2013.

Han

, An

, Zhang

, et al.: Genome sequences of a novel HIV-1 circulating recombinant form (CRF59_01B) identified among men who have sex with men in northeastern China. Genome Announce, 2013; 1(3):e00315-00313.

Han

, An

, Zhang

, et al.: Genome sequences of a novel HIV-1 circulating recombinant form, CRF55_01B, identified in China. Genome Announce, 2013; 1(1):e00050-00012.

Wang

, Meng

, Zhou

, et al.: Near full-length sequence analysis of two new HIV type 1 unique (CRF01_AE/B) recombinant forms among men who have sex with men in China. AIDS Res Hum Retroviruses, 2012; 28(4):411–417.

McCutchan

, Hegerich

, Brennan

, et al.: Genetic variants of HIV-1 in Thailand. AIDS Res Hum Retroviruses, 1992; 8(11):1887–1895.

Piyasirisilp

, Mccutchan

, Carr

, et al.: A recent outbreak of human immunodeficiency virus type 1 infection in southern China was initiated by two highly homogeneous, geographically separated strains, circulating recombinant form AE and a novel BC recombinant. J Virol, 2000; 74(23):11286–11295.

Zhang

, Chen

, Cao

, et al.: Molecular characterization of human immunodeficiency virus type 1 and hepatitis C virus in paid blood donors and injection drug users in China. J Virol, 2004; 78(24):13591–13599.

, Xing

, Ruan

, et al.: A comprehensive mapping of HIV-1 genotypes in various risk groups and regions across China based on a nationwide molecular epidemiologic survey. PloS One, 2012; 7(10):e47289.

10.

Kalish

, Baldwin

, Raktham

, et al.: The evolving molecular epidemiology of HIV-1 envelope subtypes in injecting drug users in Bangkok, Thailand: Implications for HIV vaccine trials. AIDS, 1995; 9(8):851–857.

11.

, He

, Wang

, et al.: Tracing the origin and history of HIV-1 subtype B′ epidemic by near full-length genome analyses. AIDS, 2012; 26(7):877–884.

12.

Wang

, Wang

, Wu

, et al.: Estimating the number of people living with HIV/AIDS in China: 2003–09. Int J Epidemiol, 2010; 39(Suppl 2):ii21–28.

13.

Beyrer

, Sullivan

, Sanchez

, et al.: A call to action for comprehensive HIV services for men who have sex with men. Lancet, 2012; 380(9839):424–438.

14.

Yang

, Hao

, Huan

, et al.: HIV incidence and associated factors in a cohort of men who have sex with men in Nanjing, China. Sex Transmit Dis, 2010; 37(4):208–213.

15.

Peng

, Yang

, Norris

, et al.: HIV incidence and predictors associated with retention in a cohort of men who have sex with men in Yangzhou, Jiangsu Province, China. PloS One, 2012; 7(12):e52731.

16.

Guo

, Wei

, Yang

, et al.: Rapidly increasing prevalence of HIV and syphilis and HIV-1 subtype characterization among men who have sex with men in Jiangsu, China. Sex Transmit Dis, 2009; 36(2):120–125.

17.

, Ong

, Takebe

, et al.: Genome sequence of a novel HIV-1 circulating recombinant form 54_01B from Malaysia. J Virol, 2012; 86(20):11405–11406.

18.

Chow

, Al-Darraji

, Lee

, et al.: Genome sequences of a novel HIV-1 CRF53_01B identified in Malaysia. J Virol, 2012; 86(20):11398–11399.

19.

Liu

, Li

, Bao

, et al.: Identification of a novel HIV type 1 circulating recombinant form (CRF52_01B) in Southeast Asia. AIDS Res Hum Retroviruses, 2012; 28(10):1357–1361.

20.

Nadai

, Eyzaguirre

, Constantine

, et al.: Protocol for nearly full-length sequencing of HIV-1 RNA from plasma. PloS One, 2008; 2(1):e1420.