Identification of a New HIV-1 Circulating Recombinant Form CRF65_cpx Strain in Jilin,China

The global HIV-1 epidemic is featured by the co-circulation of highly diversified HIV-1 subtypes, leading to emergence of new circulating recombinant forms (CRFs). ¹ So far, more than ninety CRFs have been identified in the world (www.hiv.lanl.gov). When multiple subtypes and CRFs co-circulate in the same region, unique recombinant forms (URFs) will be found. ²

Jilin province is located on the northeast of China. Since the first HIV-1-infected case was found in early 1990s, HIV-1 epidemic in Jilin is still in a low level, but new cases have been increasing slowly year by year. ³ The risk groups for HIV-1 infection in Jilin experienced a series of changes. Between 2004 and 2010, the major risk has changed from former plasma donors to persons infected through sexual transmission. ⁴ Also, more remarkably, HIV-1 infections among men who have sex with men (MSM) have sharply increased, from 1.8% in 2005⁴ to 61.0% in 2010–2011. ⁵

Multiple subtypes and CRFs have been found in Jilin province, including subtype B, C, CRF01_AE, CRF07_BC, CRF08_BC, and CRF02_AG. ⁵ Co-circulation of these genotypes promoted the generation of new CRFs and URFs in Jilin. In recent years, CRF01_AE become the dominant genotype in Jilin and rapidly spread among MSM and heterosexuals. ^5,6 Co-circulation of CRF01_AE and other subtypes speeded up the generation of more and more new CRFs and URFs, such as CRF01_AE/CRF07_BC, ⁷ CRF61_BC, ⁸ B′/C, ⁹ and CRF01/B′/C, ¹⁰ which further complicated the HIV-1 epidemic in Jilin province.

In this study, a new and more complex recombinant CRF65_cpx virus was identified by near full-length genome (NFLG) analysis from an HIV-1-infected MSM JL15030. The JL15030 virus consisted of 14 mosaic gene structures derived from CRF01_AE, subtype B′ (Thai B) and subtype C viruses. This study was approved by the institutional research board of Changchun Infectious Disease Hospital. A written informed consent was obtained from each participant.

The whole peripheral blood was collected from an antiretroviral treatment-naive, 28-year-old patient JL15030 shortly after he was diagnosed as HIV-1 serologically positive at Changchun Infectious Disease Hospital of Jilin province in 2015. Viral genomic RNA was extracted from the plasma by the QIAamp Viral RNA Mini kit (Qiagen, Valencia, CA) according to the manufacturer's instructions and then subjected to reverse transcription reaction to synthesize cDNA by the PrimeScript™ II First Strand cDNA Synthesis Kit (TaKaRa Bio, Inc., Beijing, China). The NFLG of JL15030 virus was amplified into two halves with an ∼500 bp overlapping region by the PrimeStar GXL DNA polymerase (TaKaRa Bio, Inc.), using the cDNA as the PCR template. Four pairs of primers ¹¹ were used for the gene amplifications as shown in Table 1. The purified PCR products were subjected to direct sequencing.

OPEN IN VIEWER

Table 1.

Primers Used for Gene Amplification

Genes	Primers	Primer sequence (5′-3′)	Position in HXB2	Direction
5′-fragment	Gag-OF	TCGACGCAGGACTCGGCTTGC	686–706	Forward (outer)
	Gag-IF	AGGAGAGAGATGGGTGCGAGAGCGTC	781–806	Forward (inner)
	Env-OR	CACTTCTCCAATTGTCCITCA	7,652–7,668	Reverse (outer)
	Env-IR	RATGGGAGGRGYATACAT	7,524–7,541	Reverse (inner)
3′-fragment	Env-OF	ACAGTRCARTGYACACATGG	6,954–6,973	Forward (outer)
	Env-IF	CTGTTIAATGGCAGICTAGC	7,002–7,021	Forward (inner)
	Nef-OR	CACAACAGACGGGCACACAC	9,641–9,660	Reverse (outer)
	Nef-IR	AGCTCCCAGGCTCAGATC	9,559–9,576	Reverse (inner)

The JL15030 NFLG sequence of 8,519 bp length was obtained and aligned with reference genome sequences using the Clustal W and manually adjusted using the BioEdit 7.2.5 (T. Hall, North Carolina State University, Raleigh, NC). The reference sequences of various subtypes (A–D, F–H, J, and K) and CRF01_AE and N group were downloaded from the Los Alamos National Laboratory (LANL) HIV Database (www.hiv.lanl.gov). Phylogenic tree was constructed in MEGA 6.06 using the neighbor-joining method based on the Kimura two-parameter model and 1,000 bootstrap replicates test. The bootstrap values higher than 70% were considered the phylogenetic clusters. As shown in Figure 1, the JL15030 NFLG sequence clustered with recently identified four CRF65_cpx references in China, ¹² with a bootstrap value of 100%, and these five sequences gathered into a monophyletic cluster.

OPEN IN VIEWER

FIG. 1.

Phylogenetic analysis of the near full-length genome of the JL15030 virus. The neighbor-joining tree was constructed with the near full-length genome of JL15030 (labeled with a black dot) and references of multiple subtypes in MEGA 6.06 based on the Kimura two-parameter model and 1,000 bootstrap replicates test. The bootstrap values higher than 70% are shown. The tree branches of CRF65_cpx and JL15030 are displayed as bold lines.

Recombinant breakpoints were analyzed using jpHMM (http://jphmm.gobics.de) on the LANL HIV Database. The genomic map of JL15030 was generated using the Recombinant HIV-1 Draw Tool (https://www.hiv.lanl.gov/content/sequence/DRAW_CRF/recom_mapper.html) available on the LANL HIV Database. The breakpoints were further confirmed by phylogenetic analyses of subregion gene fragments. The jpHMM analysis showed the JL15030 NFLG sequence was divided into 14 gene fragments (mosaics) by 13 breakpoints as follows: I-CRF_01AE (nt790–1,171), II-C (nt1,172–3,757), III-B (nt3,758–4,101), IV-C (nt4,102–5,641), V-CRF01_AE (nt5,642–5,855), VI-B (nt5,856–6,011), VII-CRF01_AE (nt6,012–6,396), VIII-C (nt6,397–7,583), IX-B (nt7,584–8,299), X-CRF01_AE (nt8,300–8,438), XI-C (nt8,439–8,587), XII-CRF01_AE (nt8,588–8,828), XIII-B (nt8,829–9,191), and XIV-C (nt9,192–9,411). All the nucleotide positions were according to HXB2 genome numbering (Fig. 2). The phylogenetic analyses with representative references of all known subtypes, CRF01_AE and CRF65_cpx, were performed to further verify the subtypes of these mosaic structures and gave the same results to jpHMM analysis (Fig. 3).

OPEN IN VIEWER

FIG. 2.

Recombinant analysis of the JL15030 genome. (A) The breakpoints were determined by the online jpHMM tool (http://jphmm.gobics.de). The inset shows different subtype references in different symbols and colors. (B) The genomic map of the JL15030 virus was generated by the online Recombinant HIV-1 Draw Tool (https://www.hiv.lanl.gov/content/sequence/DRAW_CRF/recom_mapper.html). Color images available online at www.liebertpub.com/aid

OPEN IN VIEWER

FIG. 3.

Phylogenetic analysis of subregion gene fragments. The neighbor-joining trees were constructed with fourteen subregion mosaic genes of JL15030 (named as I–XIV and labeled with a black dot) and references of multiple subtypes in MEGA 6.06 based on the Kimura two-parameter model and 1,000 bootstraps replicates test. The bootstraps values higher than 70% were shown. The branches closely related with JL15030 were displayed as lines with the subtype names on the right of the clusters.

Furthermore, the subregion phylogenetic analysis also showed that the subtype B gene fragments of the JL15030 virus (III, VI, and IX) were more closer with references of subtype B′ (Thai B, the Thailand variant of subtype B). The CRF01_AE fragments of the JL15030 virus (I, V, VII, X, and XII) were closer with CRF65_cpx references from heterosexuals in Yunnan and/or CRF01_AE references epidemic among heterosexuals in Fujian (CRF01–6) and Yunnan (CRF01–7), and distantly related to CRF01_AE references epidemic among MSM in Jilin, Liaoning (CRF01–5), Jiangsu, Tianjin, and Beijing (CRF01–4). ¹³

The circulating recombinant form CRF65_cpx was first reported among heterosexuals in Yunnan province by NFLG analysis. ¹² And then, more CRF65_cpx sequences have been found in China, including an NFLG sequence from an HIV-1-infected MSM in Anhui, ¹² and several gag-pol gene fragments from HIV-1-infected MSM in Beijing ¹⁴ and Hebei, ¹⁵ and from intravenous drug users (IDUs) in Yunnan. ¹⁴ Further phylogenetic analysis has shown that the CRF65_cpx viruses seemed to emerge in China in 2004, originally transmitted among heterosexuals in Yunnan province, and then spread to MSM population in other provinces of China. ¹⁴

In this study, we identified a new CRF65_cpx virus JL15030 from HIV-1-infected MSM in Jilin province. It was the first report of CRF65_cpx in this area. The NFLG of the JL15030 virus appeared highly similar to the NFLGs of CRF65_cpx found in Yunnan and Anhui provinces. More interestingly, the CRF01_AE gene fragments in JL15030 was phylogenetically closely related with the CRF01_AE references epidemic among heterosexuals in Yunnan and Fujian, but distantly related with references epidemic among MSM in Jilin and Liaoning. This result strongly supported the finding that the CRF65_cpx was not generated among MSM, but was spread to MSM after it was generated in Yunnan. ¹⁴ The high mobility of the MSM population promoted the spread of CRF65_cpx from the southern region to middle region and then to the northeast region of China.

So far, five recombinant forms have been found in Jilin province, including CRF61_BC, ⁸ B′/C, ⁹ and CRF01_AE/B′/C ¹⁰ among heterosexuals, and CRF01_AE/CRF07_BC ⁷ and CRF65_cpx (identified in this study) among MSM. The CRF65_cpx was the first complex recombinant virus identified in Jilin. This indicated that the HIV-1 epidemic in Jilin was more and more complicated. Real-time surveillance of new HIV-1 infections, especially among MSM population, in this area is quite required.

Sequence Data

The nucleotide sequence of the isolate JL15030 has been submitted to GenBank with the accession number MH051841.