Cystathionine γ-Lyase Deficiency Exacerbates CCl 4 -Induced Acute Hepatitis and Fibrosis in the Mouse Liver

Abstract

Aims:

The present study examined the role of cystathionine γ-lyase (CSE) in carbon tetrachloride (CCl₄)-induced liver damage.

Results:

A CSE gene knock-out and luciferase gene knock-in (KI) mouse model was constructed to study the function of CSE and to trace its expression in living status. CCl₄ or lipopolysaccharide markedly downregulated CSE expression in the liver of mice. CSE-deficient mice showed increased serum alanine aminotransferase and aspartate aminotransferase levels, and liver damage after CCl₄ challenge, whereas albumin and endogenous hydrogen sulfide (H₂S) levels decreased significantly. CSE knockout mice showed increased serum homocysteine levels, upregulation of inflammatory cytokines, and increased autophagy and IκB-α degradation in the liver in response to CCl₄ treatment. The increase in pro-inflammatory cytokines, including tumor necrosis factor-alpha in CSE-deficient mice after CCl₄ challenge, was accompanied by a significant increase in liver tissue hydroxyproline and α-smooth muscle actin and histopathologic changes in the liver. However, H₂S donor pretreatment effectively attenuated most of these imbalances.

Innovation:

Here, a CSE knock-out and luciferase KI mouse model was established for the first time to study the transcriptional regulation of CSE expression in real time in a non-invasive manner, providing information on the effects and potential mechanisms of CSE on CCl₄-induced liver injury.

Conclusion:

CSE deficiency increases pro-inflammatory cytokines in the liver and exacerbates acute hepatitis and liver fibrosis by reducing H₂S production from L-cysteine in the liver. The present data suggest the potential of an H₂S donor for the treatment of liver diseases such as toxic hepatitis and fibrosis. Antioxid. Redox Signal. 27, 133–149.

Introduction

The liver is the central metabolic organ in mammals and regulates many physiological processes. Loss of liver function is, therefore, a major health risk factor. Carbon tetrachloride (CCl₄)-induced acute hepatic injury is a widely used model to study hepatotoxic mechanisms (32). In response to damage, dysfunctional tissue repair processes can lead to degenerative liver diseases, and acute and chronic liver injuries, including fibrosis, cirrhosis, and hepatocellular carcinoma.

In chronic liver disease, liver fibrosis acts as a sign of liver damage and is associated with liver dysfunction that is caused by progressive cirrhosis (28, 30). Hepatic stellate cells (HSCs) play a key role in hepatic fibrogenesis, remain quiescent in the normal liver, whereas they are activated and transformed into fibrogenic myofibroblast-like cells in response to liver damage. The treatment of liver injuries remains a significant challenge in clinical medicine. Although liver transplantation is currently the most effective therapy, its application is severely limited by the shortage of donor organs, surgery-related complications, and immunological rejection (2, 21).

Innovation

As the liver is a major organ producing endogenous hydrogen sulfide (H₂S) under normal conditions, investigation of the effects of H₂S and its producing enzymes on inflammatory liver injury is important. The present study is the first to establish a cystathionine γ-lyase (CSE) knock-in mouse model for non-invasive monitoring of CSE expression in real time, facilitating the analysis of the effects of CSE and H₂S on carbon tetrachloride (CCl₄)-induced liver injury. The cytoprotective effects of NaHS and L-cysteine indicated that H₂S may be an important candidate for the treatment of toxic hepatic damage.

Hydrogen sulfide (H₂S) is a toxic, colorless gas with a rotten-egg odor that has been recognized as a signaling molecule as well as a cytoprotectant. The mammalian enzymes cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE) catalyze the release of H₂S from the sulfur-containing amino acid, cysteine (15). These enzymes are abundantly expressed in various organs: CBS is mainly expressed in the brain, peripheral nervous system, and liver; whereas CSE is mostly found in the liver and in vascular and nonvascular smooth cells (11, 29). H₂S possesses a very diverse biological profile, which includes anti-inflammatory, cytoprotective, and anti-fibrotic properties (23).

In the present study, the anti-inflammatory and anti-fibrotic roles of CSE and its product H₂S were investigated in a luciferase gene knock-in (KI) and CSE gene knock-out mouse model generated by inserting the luciferase reporter gene downstream of the mouse CSE promoter. Luciferase bioluminescence was captured in real time by using a highly sensitive and non-invasive camera system to trace CSE expression in living animals (17, 33).

Our data indicated that this model can be successfully used to study the transcriptional regulation of CSE expression in various inflammatory disease processes. The homozygous mutant mice were fertile and indistinguishable from their wild-type (WT) littermates in terms of growth, feeding, and weight. However, CSE deficiency significantly aggravated liver inflammation and fibrosis, and it increased autophagy in mice subjected to CCl₄ challenge, whereas exogenous and endogenous H₂S preconditioning had the opposite effects.

Results

A CSE knock-out luciferase gene KI mouse model was generated by gene targeting

A schematic diagram of the CSE knock-out luciferase gene KI model is shown in Supplementary Figure S4A (Supplementary Data are available online at www.liebertpub.com/ars). The luciferase coding sequence was inserted at the site of the ATG translational initiation codon of the mouse CSE gene. The positive CSE KI mice were identified by PCR (Supplementary Fig. S4B) and confirmed by sequencing. The insertion disrupted the transcription of the CSE gene, and luciferase expression was driven by the endogenous CSE promoter. The genotype of CSE mice was identified by PCR (Supplementary Fig. S4C) and confirmed by DNA sequencing. RNA was isolated from the major tissues of CSE^−/−, CSE^+/−, and CSE^+/+ mice.

Real-time quantitative PCR was used to quantify the levels of CSE mRNA in the different tissues, which showed the highest CSE mRNA expression in the liver and the kidney. CSE expression was lower in CSE^+/− mice than in CSE^+/+ mice, and it was almost undetectable in CSE^−/− mice. The intensity of the CSE protein band from liver extracts of CSE^+/− mice was ∼50% lower than that of CSE^+/+ mice; the band was absent in blots from CSE^−/− mice (Supplementary Figs. S1 and S4D, E). As previously reported (25), CSE^−/− mice had significantly higher levels of serum homocysteine than WT mice (Supplementary Fig. S4F).

Luciferase expression was high in CSE^+/− mice, and it was significantly reduced by an intraperitoneal (i.p.) injection of lipopolysaccharide (LPS). The luminescent signal gradually declined, reaching a nadir at 10 h post injection in both males and females (Supplementary Fig. S5A, B). The signal nadir was ∼59% of the baseline in male mice, and it was ∼40% in females. The signal returned to the baseline level at 72 h of treatment (Supplementary Fig. S5C). Both male and female mice showed a significantly reduced luciferase signal compared with the baseline level from 3 to 12 h after LPS treatment, and they showed a similar tendency of LPS-induced signal change.

To confirm the in vivo data obtained with the imaging system, luciferase activity was measured in dissected organs at 10 h after LPS injection. Luciferase activity was significantly low in the heart, liver, kidneys, and large intestine. Compared with saline-treated mice, LPS treatment inhibited luciferase activity by 0.4-fold in the heart, spleen, and kidneys, and 0.5-fold in the liver and large intestine (Supplementary Fig. S5D). Quantification of mouse endogenous CSE expression by real-time PCR (Supplementary Fig. S5E) showed that in parallel with that effect on luciferase activity, LPS treatment downregulated endogenous CSE gene expression by 0.5-fold in the heart, lung, and kidneys, and it caused a 0.1-fold reduction in the liver. These results indicated that the mouse model was successfully established.

CSE deficiency aggravated CCl₄-induced liver injury

To detect the CSE expression in vivo in the CCl₄-induced acute hepatic injury model, luciferase activity was detected by live imaging. Male CSE^+/− mice showed significantly reduced luciferase activity across the body after CCl₄ i.p. injection. The luminescent signal gradually declined and then reached a nadir at 24 h post injection (Fig. 1A, B). Liver function was assessed by measuring serum albumin, alanine aminotransferase (ALT), and aspartate aminotransferase (AST) levels (Fig. 1C). After CCl₄ injection, the levels of ALT and AST increased rapidly compared with those in the control group. Serum albumin level decreased significantly after CCl₄ treatment compared with that in the control group. CSE mRNA levels in the liver were significantly decreased in the CCl₄ treatment group compared with those in the control group (Fig. 1D).

FIG. 1.

CSE deficiency aggravated CCl₄-induced acute hepatic injury. (A) Images of male CSE^+/− mice were captured at 0, 1, 3, 8, 12, 24, 48, 72, 120, and 168 h after CCl₄ treatment. The color scale in intensity/s is shown at the right. (B) Fold changes of CCl₄ reduced luciferase activity, n = 6 in each group. (C) Serum albumin, ALT, and AST were measured as described in the Materials and Methods section. (D) CSE mRNA expression was detected by real-time PCR. Gene expression was normalized to β-actin expression levels. (E) Representative photographs (200 × ) of H&E-stained liver sections and (F) group averages of the Suzuki scores. *p < 0.05, **p < 0.01, and ***p < 0.001. (a) WT; (b) CSE^−/−; (c) WT/CCl₄; (d) CSE^−/−/CCl₄. ALT, alanine aminotransferase; AST, aspartate aminotransferase; CCl₄, carbon tetrachloride; CSE, cystathionine γ-lyase; H&E, hematoxylin and eosin; WT, wild-type. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Histopathological changes in the liver tissues from the four groups were examined by hematoxylin and eosin (H&E) staining (Fig. 1E). The structure of liver tissues was maintained in the control group, whereas a disordered lobular structure with sinusoidal congestion, neutrophil invasion, and ballooning degeneration were observed in the CCl₄ group. These pathological features were significantly enhanced in the CSE^−/− group, including significant hemorrhage of the liver, periportal neutrophil infiltration, and large sections of ballooning degeneration.

Real-time quantitative PCR was used to quantify the levels of tumor necrosis factor-alpha (TNF-α), interleukin-1beta (IL-1β), and IL-6 mRNA in the liver (Fig. 2A). The data showed that TNF-α, IL-1β, and IL-6 were upregulated rapidly by CCl₄ treatment. Furthermore, CSE deficiency significantly increased the expression of the cytokines compared with that in the WT group after CCl₄ treatment. Next, the expression of LC3-II, an important marker of autophagy, was measured in liver tissues by real-time PCR. The results showed a significant increase in LC3-II levels after CCl₄ treatment, and this effect was further enhanced in the CSE^−/− group (Fig. 2B).

FIG. 2.

Effects of CSE deficiency on the expression of inflammatory factors in CCl₄-induced acute hepatic injury. Relative gene expression levels of IL-1β, TNF-α, IL-6 (A), and LC3-II (B). Gene expression was normalized to β-actin expression levels. Representative immunoblots (C) and densitometric analyses (D) of CBS and IκB-α in CCl₄-induced hepatitis mice. Relative intensity was normalized to GAPDH expression levels, and the mean value for WT mice was set to 1. Lane 1, Lane 2, Lane 3, and Lane 4 represent WT, CSE^−/−, WT/CCl₄, and CSE^−/−/CCl₄, respectively. *p < 0.05, **p < 0.01, and ***p < 0.001. CBS, cystathionine β-synthase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IκB-α, nuclear factor-kappa-B inhibitor alpha; IL-1β, interleukin-1 beta; TNF-α, tumor necrosis factor-alpha.

To elucidate the mechanisms responsible for the upregulation of inflammatory cytokines induced by the CCl₄ challenge, we examined the levels of IκB-α. As shown in Figure 2C and D and Supplementary Figure S2, a low-intensity IκB-α band was detected in the CCl₄-induced group compared with the control group, indicating that nuclear factor-kappa B (NF-κB) was activated. CSE deficiency further decreased the intensity of the IκB-α band compared with that in the WT group after CCl₄ injection. Although CSE was downregulated by the CCl₄ challenge in WT mice, CBS expression was not affected by CSE deficiency and the CCl₄ challenge.

Next, the effects of CSE deficiency on CCl₄-induced liver fibrosis were examined. CSE expression in the liver was markedly inhibited in the CCl₄-treated WT group compared with that in the control group. The production of TNF-α and collagen 1 increased rapidly in the CCl₄ group compared with that in the control group (Fig. 3A). That hepatic architecture was disrupted, with sinusoidal congestion, neutrophil invasion, and ballooning degeneration in the CCl₄ group (Fig. 3B, C). Significant bridging fibrosis and fibrous septa were observed in liver sections of mice treated with CCl₄ (Fig. 3D).

FIG. 3.

Effects of CSE deficiency on CCl₄-induced liver fibrosis. (A) Relative gene expression levels of CSE, TNF-α, and collagen 1. Gene expression was normalized to β-actin expression levels. A representative liver section (B) stained with H&E after CCl₄ challenge in WT or CSE^−/− mice and histological scores (C) are shown. (D) Collagen deposition by Masson's trichrome staining and (E) quantitative analysis of the collagen area. (F) Collagen deposition in liver tissues of mice was quantified by measuring the content of hydroxyproline (μg/mg liver) in the different treatment groups. (G) Representative immunoblots and (H) densitometric analyses of CBS and α-SMA in CCl₄-induced liver fibrosis mice. Relative intensity was normalized to GAPDH expression levels, and the mean value for WT mice was set to 1. Lane 1, Lane 2, Lane 3, and Lane 4 represent (a) WT, (b) CSE^−/−, (c) WT/CCl₄, and (d) CSE^−/−/CCl₄, respectively. *p < 0.05, **p < 0.01, and ***p < 0.001. α-SMA, alpha-smooth muscle actin. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Quantitative analysis showed that areas of collagen were significantly increased in CCl₄-induced mice compared with those in control mice, and they were further increased in CSE-deficient mice (Fig. 3E). Collagen deposition was quantified by measuring the hepatic hydroxyproline content, which showed that CSE deficiency stimulated fibrogenesis after CCl₄ injection (Fig. 3F). CSE deficiency significantly upregulated α-smooth muscle actin (α-SMA) protein expression in fibrogenesis, indicating enhanced HSCs activation. As in acute liver injury, CSE was downregulated by the CCl₄ challenge in WT mice, whereas CBS expression was not affected by CSE deficiency and CCl₄ challenge (Fig. 3G, H and Supplementary Fig. S3).

NaHS pretreatment attenuated CCl₄-induced liver injury in WT and CSE^−/− mice

H₂S levels in serum and liver tissues were significantly decreased in CSE-deficient mice (Fig. 4A). To examine whether the low H₂S level in CSE-deficient mice was associated with the severity of the phenotype in CCl₄-induced acute hepatitis, mice were pretreated with NaHS, the H₂S donor (4). NaHS moderately increased serum and liver H₂S levels in WT and CSE^−/− mice. NaHS slightly increased serum albumin and inhibited the increase of serum ALT and AST in the acute hepatitis groups in both WT and CSE-deficient mice. Meanwhile, NaHS administration eliminated the difference in the levels of albumin, ALT, and AST between WT and CSE-deficient mice after CCl₄ challenge (Fig. 4B, C).

FIG. 4.

NaHS pretreatment attenuated CCl₄-induced acute hepatic injury. (A) (Left) serum H₂S, and (right) liver tissue H₂S were measured with and without CCl₄ treatment. (B) (Left) serum H₂S, and (right) liver tissue H₂S were measured with and without NaHS pretreatment after CCl₄ injection. (C) Serum albumin, ALT, and AST levels. (D) Representative photographs (200 × ) of H&E-stained liver sections and (E) group averages of the Suzuki scores. Representative immunoblots (F) and densitometric analyses (G) of IκB-α in CCl₄-induced hepatitis mice with or without NaHS treatment. Relative intensity was normalized to GAPDH expression levels, and the mean value for WT mice was set to 1. Lane 1, Lane 2, Lane 3, and Lane 4 represent WT/CCl₄, CSE^−/−/CCl₄, WT/NaHS+CCl₄, and CSE^−/−/NaHS+CCl₄, respectively. (H) The relative gene expression levels of IL-1β, IL-6, TNF-α, and LC3-II in the liver were measured after CCl₄ challenge without or with NaHS pretreatment. Gene expression was normalized to β-actin expression levels. *p < 0.05, **p < 0.01, and ***p < 0.001. (a) WT/CCl₄; (b) CSE^−/−/CCl₄; (c) WT+NaHS/CCl₄; (d) CSE^−/−+NaHS/CCl₄. H₂S, hydrogen sulfide. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

These results indicated that H₂S had a protective effect on hepatocytes and rescued the mouse phenotype of CSE deficiency. NaHS pretreatment attenuated the CCl₄-induced lobular structure disorder with sinusoidal congestion, neutrophil invasion, and ballooning degeneration observed in both WT and CSE-deficient mice (Fig. 4D, E). NaHS pretreatment inhibited IκB-α degradation, downregulated cytokine expression, and attenuated the conversion of LC3-II in the acute liver injury groups in both WT and CSE-deficient mice (Fig. 4F–H and Supplementary Fig. S2).

As in acute hepatitis, NaHS preconditioning significantly inhibited the H₂S decline during hepatic fibrogenesis (Fig. 5A, B). NaHS pretreatment inhibited the production of collagen 1 and TNF-α, and the increase in the hepatic hydroxyproline content induced by CCl₄. No significant differences in the levels of hepatic collagen 1 and TNF-α or the hydroxyproline content were observed between WT and CSE-deficient mice induced by CCl₄ after NaHS treatment (Fig. 5C, D). Moreover, NaHS attenuated CCl₄-induced the disruption of hepatic architecture characterized by sinusoidal congestion, neutrophil invasion, and ballooning degeneration, and the increase of collagen areas as well as HSCs activation.

FIG. 5.

NaHS pretreatment prevented CCl₄-induced liver fibrosis. (A) (Left) serum H₂S, and (right) liver tissue H₂S were measured with and without CCl₄ treatment. (B) (Left) serum H₂S and, (right) liver tissue H₂S were measured with and without NaHS pretreatment after CCl₄ injection. (C) Relative gene expression levels of collagen 1 and TNF-α in the liver were measured after CCl₄ challenge without or with NaHS pretreatment. Gene expression was normalized to β-actin expression levels. (D) Collagen deposition in liver tissues was quantified by measuring the content of hydroxyproline (μg/mg liver) in the different treatment groups. (E) A representative liver section stained with H&E is shown, and (F) collagen deposition by Masson's trichrome staining, (G) histological scores, and (H) quantitative analysis of collagen area after CCl₄ challenge in WT or CSE^−/− mice without or with administration of NaHS. (I) Representative immunoblots, and (J) densitometric analyses of α-SMA in CCl₄-induced liver fibrosis mice with or without NaHS treatment. Relative intensity was normalized to GAPDH expression levels, and the mean value for WT mice was set to 1. Lane 1, Lane 2, Lane 3, and Lane 4 represent WT/CCl₄, CSE^−/−/CCl₄, WT/NaHS+CCl₄, and CSE^−/−/NaHS+CCl₄, respectively. *p < 0.05, **p < 0.01, and ***p < 0.001. (a) WT/CCl₄; (b) CSE^−/−/CCl₄; (c) WT+NaHS/CCl₄; (d) CSE^−/−+NaHS/CCl₄. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

In addition, NaHS administration eliminated the differences in the disruption of hepatic architecture and collagen deposition, as well as the level of α-SMA between WT and CSE-deficient mice after CCl₄ challenge (Fig. 5E–J and Supplementary Fig. S3). Finally, NaHS did not affect the expression of CBS in CCl₄-induced acute hepatitis and liver fibrosis mice (Supplementary Figs. S2, S3, and S6A–D).

Administration of L-cysteine attenuated CCl₄-induced liver injury and increased the H₂S levels in WT mice

CSE catalyzes the pyridoxal 5′-phosphate-dependent synthesis of H₂S from cysteine. To further determine whether the role of CSE in liver injury is mediated by H₂S production, CCl₄-induced liver injury mice were treated with L-cysteine. Administration of L-cysteine, the substrate of CSE, markedly increased the serum and liver levels of H₂S in WT mice, whereas it had no significant effect on H₂S levels in CSE-deficient mice (Figs. 6A and 7A). Administration of L-cysteine moderately prevented CCl₄-induced increase of serum ALT levels and significantly attenuated CCl₄-induced histological liver injury in WT mice. However, the protective effects of L-cysteine were not observed in CSE-deficient mice (Fig. 6B–D). The beneficial effects of L-cysteine in WT mice may be associated with the inhibition of IL-1β, IL-6, TNF-α, and LC3-II expression (Fig. 6E).

FIG. 6.

Effects of L-cysteine and/or CCl₄ on H₂S level, liver function, cytokines, and LC3-II gene expression levels. (A) Serum and liver tissue H₂S levels after CCl₄ challenge in WT or CSE^−/− mice without or with administration of L-cysteine. (B) Serum ALT and AST were measured. (C) Histological scores and (D) representative liver section stained with H&E after CCl₄ challenge in WT or CSE^−/− mice without or with administration of L-cysteine. (E) The relative gene expression levels of cytokines and LC3-II in the liver were measured. Gene expression was normalized to β-actin expression levels. *p < 0.05, **p < 0.01, and ***p < 0.001. (a) WT/CCl₄; (b) CSE^−/−/CCl₄; (c) WT+L-cysteine/CCl₄; (d) CSE^−/−+L-cysteine/CCl₄. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

FIG. 7.

Effects of L-cysteine on CCl₄-induced liver fibrosis, and changes in gene expression. (A) Serum and liver tissue H₂S levels after CCl₄ challenge in WT or CSE^−/− mice without or with administration of L-cysteine. (B) Collagen deposition in liver tissues of mice was quantified by measuring the content of hydroxyproline (μg/mg liver). (C) Relative gene expression levels of TNF-α and collagen 1 in the liver were measured after CCl₄ challenge without or with L-cysteine treatment. Gene expression was normalized to β-actin expression levels. (D) Histological scores and (E) a representative liver section stained with H&E, (F) quantitative analysis of collagen areas, and (G) collagen deposition by Masson's trichrome staining after CCl₄ challenge in WT or CSE^−/− mice without or with administration of L-cysteine. *p < 0.05, **p < 0.01, and ***p < 0.001. (a) WT/CCl₄; (b) CSE^−/−/CCl₄; (c) WT+L-cysteine/CCl₄; (d) CSE^−/−+L-cysteine/CCl₄. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

We next examined whether L-cysteine treatment prevented CCl₄-induced liver fibrosis in mice. L-cysteine pretreatment significantly inhibited the collagen deposition, as quantified by measuring the hepatic hydroxyproline content in WT mice but not in CSE-deficient mice (Fig. 7B). CCl₄-induced TNF-α and collagen 1 levels were significantly inhibited in WT mice after L-cysteine treatment, whereas no significant changes were observed in CSE-deficient mice (Fig. 7C). L-cysteine treatment significantly attenuated CCl₄-induced histological liver injury and reduced collagen areas in WT mice, and this effect was not observed in CSE-deficient mice. By contrast, significant bridging fibrosis and fibrous septa were observed in liver sections in CSE-deficient mice treated with CCl₄ with or without L-cysteine preconditioning (Fig. 7D–G).

Discussion

A luciferase gene KI and CSE gene knock-out mouse model was established to monitor the endogenous CSE expression and to analyze the function of CSE in liver disease. An in vivo bioluminescence camera system was used to show that luciferase activity was markedly inhibited after an i.p. injection of LPS. The results of ex vivo experiments indicated that LPS inhibited luciferase activity in the heart, liver, kidney, and large intestine. CSE mRNA expression was higher in the liver than in other organs.

The pattern of LPS-mediated inhibition of luciferase activity in CSE KI mice was consistent with the changes of endogenous murine CSE mRNA expression. However, the fold inhibition was not the same for luciferase activity and endogenous CSE mRNA. This result could be attributed to the fact that endogenous CSE mRNA expression is not exactly in linear correlation with protein levels (33). These data demonstrate that CSE KI mice are a sensitive, reliable, and convenient model for monitoring CSE gene expression in vivo in physiological or pathological processes.

The CCl₄-induced liver injury model has been used for decades, because the elementary lesions caused by this hepatotoxin mimic most cases of human liver disease (38). In the present study, the luciferase signal was monitored during the liver injury process induced by CCl₄ treatment. The pattern of CCl₄-mediated inhibition of luciferase activity in CSE KI mice was consistent with the changes of endogenous murine CSE mRNA expression. The transcription factor Sp1 plays a crucial role as activator of CSE gene transcription (34). Our results showed that CCl₄ significantly reduced the levels of Sp1, suggesting that the downregulation of CSE may be mediated by the modulation of Sp1 (Supplementary Fig. S7A, B).

The present study showed that CSE deficiency exacerbated CCl₄-induced liver injury, whereas NaHS pretreatment increased serum and liver H₂S levels and significantly attenuated the damage in both CSE-deficient and WT mice after CCl₄ challenge. The only substrate for the generation of endogenous H₂S is L-cysteine, and the reaction is catalyzed by three enzymes, CBS, CSE, and 3-mercaptopyruvate sulfurtransferase (3MST) (20, 24). Our results showed that CBS expression was not changed in CCl₄-induced liver injury; the relative gene expression of 3MST in WT and CSE^−/− mice was not significantly changed, whereas the level of H₂S was markedly decreased in CSE^−/− mice compared with WT mice, indicating that the 3MST was not involved in the H₂S production in the liver (Supplementary Fig. S8A, B).

L-cysteine preconditioning markedly increased the level of H₂S and prevented CCl₄-induced liver damage in WT mice. However, H₂S levels in the serum and liver of CSE-deficient mice were only slightly elevated, and no significant protective effect of L-cysteine on liver damage was observed, indicating that the increase in H₂S caused by L-cysteine challenge was mostly associated with CSE activity. These findings were consistent with previous reports (36).

As a gasotransmitter, H₂S diffuses freely across cell membranes in a receptor-independent manner and can activate various cellular signals that modulate metabolism, hepatoprotective effects, and homeostasis (8, 23, 37). In acute hepatitis, Kupffer cells (KCs) are tissue resident macrophages in the liver and the first line of defense. Injury stimulations can induce inflammatory activation of KCs, resulting in the cascade release of pro-inflammatory cytokines, including IL-1β, IL-6, and TNF-α.

Our results indicated that H₂S had an anti-inflammatory effect on KCs, and NF-κB is a key transcriptional regulator of the inflammatory response and plays an essential role in the regulation of inflammatory signaling pathways in the liver (9, 18). NF-κB, a heterodimer of P50 and P65 subunits, is retained in the cytoplasm via the masking of a nuclear localization signal by the inhibitor IκB-α (31). On activation, IKK phosphorylates IκB-α, which triggers its degradation and results in the expression of various pro-inflammatory cytokines. In this regard, our findings suggested that CSE deficiency activated the NF-κB pathway, whereas H₂S pretreatment inhibited the activation in both CSE-deficient and WT mice after CCl₄ challenge.

In addition, autophagy is involved in apoptotic cell death (10, 14). The accumulation of LC3-II in autophagosomes and the conversion of LC3-I to LC3-II are important markers of autophagy (13, 27). In the present study, we examined the effect of CSE deficiency on autophagy. The results showed that CSE deficiency markedly increased LC3-II gene expression after CCl₄ challenge, whereas H₂S pretreatment significantly inhibited the CCl₄-induced elevation of LC3-II mRNA.

Finally, oxidative stress plays an important role in liver injury due to excessive production of reactive oxygen species (ROS) and reactive nitrogen species, such as hydrogen peroxide (H₂O₂) and nitric oxide (NO). ROS is produced by NADPH oxidase (NOX), which is expressed in the liver, and NO is generated by inducible NO synthases (iNOS). Emerging data demonstrate that H₂S acts as the scavenger of oxidant species. Along these lines, we found that H₂S pretreatment tended to inhibit the gene expression of iNOS (Supplementary Fig. S9A), and NOX1, NOX2, NOX4 (Supplementary Fig. S10A–C), and decrease H₂O₂ (Supplementary Fig. S11A) in CCl₄-induced acute hepatitis mice.

Our experimental results suggest that an H₂S donor could be a promising therapeutic drug for CCl₄-induced acute hepatitis through the inhibition of autophagy, oxidative stress, KCs, and the NF-κB signaling pathway.

Hepatic fibrosis is a progressive pathological process that involves the accumulation of extracellular matrix proteins such as collagens (19). Mounting evidence from independent groups demonstrates that H₂S exhibits protective effects on the ex vivo hepatic fibrosis model and the rat hepatic fibrosis model (3, 6, 7, 39). However, the role of endogenous H₂S in liver fibrosis is incompletely explained due to the limited use of chemical inhibitors of H₂S-producing enzymes, including DL-propargylglycine (PAG) (5, 26).

In the present study, collagen deposition in the CCl₄ group was determined by the increased level of hydroxyproline, collagen 1 mRNA expression, and Masson's trichrome staining, whereas both endogenous and exogenous H₂S pretreatment markedly prevented this increase in collagen deposition in WT mice. As previously reported, several pro-inflammatory cytokines, including TNF-α and IL-6, play an important role in the activation of HSCs, which have been identified as major collagen-producing cells in the injured liver (1, 22). Our results showed that CCl₄ treatment significantly activated HSCs, as measured by α-SMA expression, especially in CSE-deficient mice, whereas NaHS pretreatment led to a clear impairment of HSC activation. Although CCl₄-induced fibrosis had no effect on IL-6 gene expression (data not show), it significantly increased the level of TNF-α, and H₂S pretreatment significantly inhibited the increase of TNF-α. We also found that H₂S pretreatment inhibited the mRNA expression of iNOS (Supplementary Fig. S9B), and NOX1, NOX2, and NOX4 (Supplementary Fig. S10D–F), and it tended to decrease H₂O₂ (Supplementary Fig. S11B) in the liver of hepatic fibrosis mice.

In summary, the current data show that CSE plays an important role as an inhibitor of inflammation in the liver by producing H₂S from L-cysteine. NaHS and L-cysteine showed protective effects against CCl₄-induced liver damage, suggesting their translational potential. CSE KI mice could be used to monitor CSE expression during pathological processes and may be useful in studying the effects of drug therapy.

Materials and Methods

Animals and genotyping

The targeting vector contained 2911 bp of the mouse CSE gene fragment just upstream from the translation initiation codon ATG as the 5′-homology arm, a 4093 bp insertion sequence coding for a floxed firefly luciferase and a neomycin selection cassette (FRT-Neo-FRT), and 2993 bp as a 3′-homology arm derived from the CSE gene just downstream of the translation initiation codon ATG. CSE knock-out and luciferase KI mice in the C57BL/6J background were generated by standard ES cell based gene targeting techniques and verified by PCR and DNA sequencing. Targeted offspring were genotyped from tail genomic DNA by using the triple primer PCR strategy. The position and sequence of P1–7 are described in Supplementary Figure S1A and Supplementary Table S1. Homozygous (CSE^−/−) mice, heterozygous (CSE^+/−), and WT control (CSE^+/+) mice from the same litter were used at 8 and 10 weeks of age.

All animals were housed in a specific pathogen-free environment with a 12 h light/dark cycle with food and water ad libitum. This study was performed in strict accordance with institutional guidelines and approved by the Institutional Animal Care and Use Committee of the Shanghai Research Center for Model Organisms, and the IACUC permit number was 2012-0021-01.

Reagents

Bacterial LPS, NaHS, corn oil, and N-acetyl-L-cysteine (L-cysteine) were purchased from Sigma-Aldrich. CCl₄ was purchased from Sinopharm Chemical Reagent Co., Ltd. Potassium Luciferin (Gold Biotechnology) was dissolved in phosphate-buffered saline (PBS) (Beyotime) at 15 mg/ml and stored at −20°C.

Exogenous H₂S donor

H₂S was administered in the form of NaHS, which was diluted in normal saline.

In vivo imaging

In vivo imaging was performed as previously described by using a lumazone imaging system (Mag Biosystems) (17, 33). Briefly, mice with hair removed were injected 150 μl potassium luciferin intraperitoneally (dissolved in PBS), anesthetized with isoflurane/oxygen, and placed on the imaging stage. At 12 min after luciferin injection, mice were imaged in the dark chamber for 3 min. Photons emitted from specific regions were collected and quantified by using Lumazone software. Luciferase activity was expressed as photon intensity per second.

Acute septic shock model generated by i.p. injection of LPS

The acute septic shock model was produced by an i.p. injection of LPS (3 mg/kg body weight) into CSE heterozygous mice aged 8–12 weeks. Control mice were injected with saline. Luciferase activity was detected by imaging at 0, 1, 3, 6, 10, 12, 24, 30, 48, and 72 h post injection. At the selected time points after the injection, mice were i.p. injected with luciferin and imaged after 12 min with the Lumazone imaging system as described earlier.

Real-time quantitative PCR

Total RNA was isolated from selected mouse tissues by using Trizol (Tiangen) according to the manufacturer's instructions and kept at −80°C before use. Aliquots containing 1600 ng RNA from each sample were reverse transcribed into cDNA by using Quant Reverse Transcriptase (Tiangen). The SuperReal SYBR Green Premix Plus (Tiangen) was used for real-time PCR amplification. Real-time PCR was performed by using the Realplex system (Eppendorf). The reaction conditions were as follows: 95°C/15 min; 40 cycles of 95°C/15 s, X°C/20 s, 72°C/30 s; 95°C/15 s; and 60°C/15 s. Murine β-actin was used as a reference to normalize the targeted gene expression levels. The sequences of specific primers are listed in Table 1.

Table 1.

Primer Sequences Used For Real-Time Quantitative PCR

Gene	Sense	Anti-sense
CSE (M)	CCACGTGGGACAAGAGC	TAATCGTAATGGTGGCAGCAAGAC
IL-1β (M)	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG
IL-6 (M)	ACAACCACGGCCTTCCCTACT	GCCATTGCACAACTCTTTTCTCAT
TNF-α (M)	CCTGTAGCCCACGTCGTAG	GGGAGTAGACAAGGTACAACCC
LC3-II (M)	TTATAGAGCGTATACAAGGGGGAG	CGCCGTCTGATTATCTTGATGAG
Spl (M)	GCCGCCTTTTCTCAGACTC	TTGGGTGACTCAATTCTGCTG

CSE, cystathionine γ-lyase; IL-1β, interleukin-1 beta; M, mouse; TNF-α, tumor necrosis factor-alpha.

Ex vivo measurement of luciferase activity

Mouse tissues were dissected and lysed with 300 μl lysis buffer (Promega). Luciferase activity was measured by using the Luciferase Assay System (Promega) and a Luminometer (Lumat LB9507, EG&G; Berthold). Protein concentration was estimated by using the BCA Protein Assay Kit (Beyotime).

Animal models of acute hepatitis and liver fibrosis

Acute liver injury in mice was induced by an i.p. injection of CCl₄ at the dosage of 1 ml/kg body weight (1:3 diluted in corn oil). The mice in the control group were dosed with an equal volume of corn oil. The 42 mice were assigned to eight groups as follows: WT (n = 5), CSE^−/− (n = 4), WT/CCl₄ (n = 6), WT/NaHS+CCl₄ (n = 6), CSE^−/−/CCl₄ (n = 6), CSE^−/−/NaHS+CCl₄ (n = 6), WT/L-cysteine+CCl₄ (n = 5), and CSE^−/−/L-cysteine+CCl₄ (n = 4). The mice received an i.p. injection of NaHS solution (36 μmol/kg) or L-cysteine solution (15 mg/kg) at 1 h before CCl₄ treatment. The NaHS solution or L-cysteine solution was administered once per day. Mice were sacrificed on day 1 post-injection.

In the fibrosis experiment, 32 mice were assigned to eight groups as follows: WT, CSE^−/−, WT/CCl₄, WT/NaHS+CCl₄, CSE^−/−/CCl₄, CSE^−/−/NaHS+CCl₄, WT/L-cysteine+CCl₄, and CSE^−/−/L-cysteine+CCl₄. An i.p. injection of CCl₄ (1 ml/kg, dissolved in corn oil to reach a final concentration of 20%) was administered twice per week for 6 weeks. The mice received an i.p. injection of NaHS solution (36 μmol/kg) every 2 days or L-cysteine solution (15 mg/kg) once daily for up to 6 weeks. The mice were euthanized at the indicated time points. Liver samples were fixed with 10% formalin for histological examination. The same lobe of the liver was snap-frozen in liquid nitrogen and stored at −80°C for hydroxyproline content determination, and RNA and protein extraction. Blood samples were centrifuged at 3000 rpm for 15 min to collect serum.

Measurement of biochemical index and homocysteine concentration in serum

After blood collection, serum was separated by centrifugation at 3000 rpm for 15 min at 4°C. Serum albumin, AST, and ALT levels were measured by using an automated chemistry analyzer (Sysmex). Homocysteine concentration was measured with another automated chemistry analyzer (Hitachi).

Measurement of serum and liver tissue H₂S

H₂S production was measured as previously described (16, 35).

Histological assessment of liver injury

The degree of inflammation and tissue damage was observed in paraffin sections (5 μm thick) stained with H&E. For fibrosis, liver sections were processed by both H&E and Masson's trichrome staining to assess the architectural alterations and hepatic collagen deposition. Morphometric analysis was then performed on a computerized image analysis system (Image-Pro Plus; Media Cybernetics). The mean of blue stained areas in each section was calculated. The histological severity was graded according to the Suzuki's criteria described by Ke et al., in which sinusoidal congestion, hepatocyte necrosis, and cytoplasmic vacuolization are graded from 0 to 4 (12).

Hepatic hydroxyproline content

To quantify collagen content, a hepatic hydroxyproline assay was performed (Jiancheng Bioengineering Institute). Liver tissues were homogenized in lysis buffer at 95°C for 20 min. The hydrolysates were centrifuged for 10 min at 3500 rpm, the supernatant was removed, and hydroxyproline levels in the hydrolysates were measured at 550 nm.

Western blotting

Proteins were extracted in an RIPA buffer containing protease inhibitor cocktail (Selleck Chemicals) from the left lateral lobe of liver, and an equal number of protein (50 μg) from each sample was separated on 12% SDS-PAGE and transferred onto nitrocellulose membranes (GE Healthcare). Membranes were blocked with PBS containing 5% fat-free milk powder for 1 h at room temperature, and they were then incubated overnight at 4°C with different primary antibodies. After washing, membranes were incubated with fluorescent-conjugated secondary antibody for 1 h (1:10,000; LI-COR Biosciences).

Statistical analysis

Data were expressed as the mean ± SEM. Statistical differences between groups were analyzed by using one-way analysis of variance, followed by Bonferroni post hoc test.

Footnotes

Acknowledgments

This work was supported by grants from the National Key Project (2010CB945501), the Science and Technology Commission of Shanghai Municipality (16DZ2280800).

Author Disclosure Statement

No competing financial interests exist.

Abbreviations Used

References

Abdel-Moneim

, Al-Kahtani

, El-Kersh

, and Al-Omair

. Free radical-scavenging, anti-inflammatory/anti-fibrotic and hepatoprotective actions of taurine and silymarin against CCl4 induced rat liver damage. PLoS One, 10: e0144509, 2015.

Bataller

and Brenner

. Liver fibrosis. J Clin Invest, 115: 209–218, 2005.

Dursun

, Otunctemur

, Ozbek

, Sahin

, Besiroglu

, Ozsoy

, Cekmen

, Somay

, and Ozbay

. Protective effect of hydrogen sulfide on renal injury in the experimental unilateral ureteral obstruction. Int Braz J Urol, 41: 1185–1193, 2015.

Elrod

, Calvert

, Morrison

, Doeller

, Kraus

, Tao

, Jiao

, Scalia

, Kiss

, Szabo

, Kimura

, Chow

, and Lefer

. Hydrogen sulfide attenuates myocardial ischemia-reperfusion injury by preservation of mitochondrial function. Proc Natl Acad Sci U S A, 104: 15560–15565, 2007.

Fan

, Chen

, Shen

, Zhao

, and Zhang

. Endogenous hydrogen sulfide is associated with angiotensin II type 1 receptor in a rat model of carbon tetrachloride-induced hepatic fibrosis. Mol Med Rep, 12: 3351–3358, 2015.

Fan

, Wang

, Ren

, Dan

, Li

, Hou

, and Deng

. Decreased expression of p38 MAPK mediates protective effects of hydrogen sulfide on hepatic fibrosis. Eur Rev Med Pharmacol Sci, 17: 644–652, 2013.

Fan

, Wang

, Yang-Dan

, Ren

, Wang

, Li

, and Deng

. Protective effects of hydrogen sulfide on oxidative stress and fibrosis in hepatic stellate cells. Mol Med Rep, 7: 247–253, 2013.

Fiorucci

, Antonelli

, Mencarelli

, Orlandi

, Renga

, Rizzo

, Distrutti

, Shah

, and Morelli

. The third gas: H2S regulates perfusion pressure in both the isolated and perfused normal rat liver and in cirrhosis. Hepatology, 42: 539–548, 2005.

Ghosh

and Karin

. Missing pieces in the NF-kappaB puzzle. Cell, 109 Suppl: S81–S96, 2002.

10.

Ishihara

, Kanai

, Tanaka

, Kawashita

, and Akiba

. Group IVA phospholipase A2 deficiency prevents CCl4-induced hepatic cell death through the enhancement of autophagy. Biochem Biophys Res Commun, 471: 15–20, 2016.

11.

Kamoun

. Endogenous production of hydrogen sulfide in mammals. Amino Acids, 26: 243–254, 2004.

12.

, Shen

, Gao

, Qiao

, Ji

, Busuttil

, Volk

, and Kupiec-Weglinski

. Small interfering RNA targeting heme oxygenase-1 (HO-1) reinforces liver apoptosis induced by ischemia-reperfusion injury in mice: HO-1 is necessary for cytoprotection. Hum Gene Ther, 20: 1133–1142, 2009.

13.

Klionsky

, Abdelmohsen

, Abe

, Abedin

, Abeliovich

, Acevedo Arozena

, Adachi

, Adams

, Adeli

, Adhihetty

, Adler

, Agam

, Agarwal

, Aghi

, Agnello

, Agostinis

, Aguilar

, Aguirre-Ghiso

, Airoldi

, Ait-Si-Ali

, Akematsu

, Akporiaye

, Al-Rubeai

, Albaiceta

, Albanese

, Albani

, Albert

, Aldudo

, Algul

, Alirezaei

, Alloza

, Almasan

, Almonte-Beceril

, Alnemri

, Alonso

, Altan-Bonnet

, Altieri

, Alvarez

, Alvarez-Erviti

, Alves

, Amadoro

, Amano

, Amantini

, Ambrosio

, Amelio

, Amer

, Amessou

, Amon

, An

, Anania

, Andersen

, Andley

, Andreadi

, Andrieu-Abadie

, Anel

, Ann

, Anoopkumar-Dukie

, Antonioli

, Aoki

, Apostolova

, Aquila

, Aquilano

, Araki

, Arama

, Aranda

, Araya

, Arcaro

, Arias

, Arimoto

, Ariosa

, Armstrong

, Arnould

, Arsov

, Asanuma

, Askanas

, Asselin

, Atarashi

, Atherton

, Atkin

, Attardi

, Auberger

, Auburger

, Aurelian

, Autelli

, Avagliano

, Avantaggiati

, Avrahami

, Awale

, Azad

, Bachetti

, Backer

, Bae

, Baehrecke

, Baek

, Baghdiguian

, Bagniewska-Zadworna

, Bai

, Bailly

, Balaji

, Balduini

, Ballabio

, Balzan

, Banerjee

, Banhegyi

, Bao

, Barbeau

, Barrachina

, Barreiro

, Bartel

, Bartolome

, Bassham

, Bassi

, Bast

Jr. , Basu

, Batista

, Batoko

, Battino

, Bauckman

, Baumgarner

, Bayer

, Beale

, Beaulieu

, Beck

Jr. , Becker

, Beckham

, Bedard

, Bednarski

, Begley

, Behl

, Behrends

, Behrens

, Behrns

, Bejarano

, Belaid

, Belleudi

, Benard

, Berchem

, Bergamaschi

, Bergami

, Berkhout

, Berliocchi

, Bernard

, Bernassola

, Bertolotti

, Bess

, Besteiro

, Bettuzzi

, Bhalla

, Bhattacharyya

, Bhutia

, Biagosch

, Bianchi

, Biard-Piechaczyk

, Billes

, Bincoletto

, Bingol

, Bird

, Bitoun

, Bjedov

, Blackstone

, Blanc

, Blanco

, Blomhoff

, Boada-Romero

, Bockler

, Boes

, Boesze-Battaglia

, Boise

, Bolino

, Boman

, Bonaldo

, Bordi

, Bosch

, Botana

, Botti

, Bou

, Bouche

, Bouchecareilh

, Boucher

, Boulton

, Bouret

, Boya

, Boyer-Guittaut

, Bozhkov

, Brady

, Braga

, Brancolini

, Braus

, Bravo-San Pedro

, Brennan

, Bresnick

, Brest

, Bridges

, Bringer

, Brini

, Brito

, Brodin

, Brookes

, Brown

, Broxmeyer

, Bruhat

, Brum

, Brumell

, Brunetti-Pierri

, Bryson-Richardson

, Buch

, Buchan

, Budak

, Bulavin

, Bultman

, Bultynck

, Bumbasirevic

, Burelle

, Burke

, Burmeister

, Butikofer

, Caberlotto

, Cadwell

, Cahova

, Cai

, Calatayud

, Camougrand

, Campanella

, Campbell

, Campello

, Candau

, Caniggia

, Cantoni

, Cao

, Caplan

, Caraglia

, Cardinali

, Cardoso

, Carew

, Carleton

, Carlin

, Carloni

, Carlsson

, Carmona-Gutierrez

, Carneiro

, Carnevali

, Carra

, Carrier

, Carroll

, Casas

, Cassinelli

, Castets

, Castro-Obregon

, Cavallini

, Ceccherini

, Cecconi

, Cederbaum

, Cena

, Cenci

, Cerella

, Cervia

, Cetrullo

, Chaachouay

, Chae

, Chagin

, Chai

, Chakrabarti

, Chamilos

, Chan

, Chandra

, Chang

, Chatham

, Chatterjee

, Chauhan

, Che

, Cheetham

, Cheluvappa

, Chen

, Cheng

, Cheong

, Cherry

, Chesney

, Cheung

, Chevet

, Chi

, Chiacchiera

, Chiang

, Chiarelli

, Chiariello

, Chieppa

, Chin

, Chiong

, Chiu

, Cho

, Choi

, Chou

, Chouaib

, Choubey

, Chow

, Chowdhury

, Chu

, Chuang

, Chun

, Chung

, Chwae

, Cianfanelli

, Ciarcia

, Ciechomska

, Ciriolo

, Cirone

, Claerhout

, Clague

, Claria

, Clarke

, Clementi

, Cleyrat

, Cnop

, Coccia

, Cocco

, Codogno

, Coers

, Cohen

, Colecchia

, Coletto

, Coll

, Colucci-Guyon

, Comincini

, Condello

, Cook

, Coombs

, Cooper

, Coppens

, Corasaniti

, Corazzari

, Corbalan

, Corcelle-Termeau

, Cordero

, Corral-Ramos

, Corti

, Cossarizza

, Costelli

, Costes

, Cotman

, Coto-Montes

, Cottet

, Couve

, Covey

, Cowart

, Cox

, Coxon

, Coyne

, Cragg

, Craven

, Crepaldi

, Crespo

, Criollo

, Crippa

, Cruz

, Cuervo

, Cuezva

, Cui

, Cutillas

, Czaja

, Czyzyk-Krzeska

, Dagda

, Dahmen

, Dai

, Dalby

, Dalla Valle

, Dalmasso

, D'Amelio

, Damme

, Darfeuille-Michaud

, Dargemont

, Darley-Usmar

, Dasarathy

, Dasgupta

, Dash

, Dass

, Davey

, Davids

, Davila

, Davis

, Dawson

, Daza

, de Belleroche

, de Figueiredo

, de la Fuente

, De Martino

, De Matteis

, De Meyer

, De Milito

, De Santi

, de Souza

, De Tata

, De Zio

, Debnath

, Dechant

, Decuypere

, Deegan

, Dehay

, Del Bello

, Del Re

, Delage-Mourroux

, Delbridge

, Deldicque

, Delorme-Axford

, Deng

, Dengjel

, Denizot

, Dent

, Der

, Deretic

, Derrien

, Deutsch

, Devarenne

, Devenish

, Di Bartolomeo

, Di Daniele

, Di Domenico

, Di Nardo

, Di Paola

, Di Pietro

, Di Renzo

, DiAntonio

, Diaz-Araya

, Diaz-Laviada

, Diaz-Meco

, Diaz-Nido

, Dickey

, Dickson

, Diederich

, Digard

, Dikic

, Dinesh-Kumar

, Ding

, Dini

, Distler

, Diwan

, Djavaheri-Mergny

, Dmytruk

, Dobson

, Doetsch

, Dokladny

, Dokudovskaya

, Donadelli

, Dong

, Donohue

Jr. , Doran

, D'Orazi

, Dorn

2nd , Dosenko

, Dridi

, Drucker

, Du

, du Toit

, Dua

, Duan

, Duann

, Dubey

, Duchen

, Duchosal

, Duez

, Dugail

, Dumit

, Duncan

, Dunlop

, Dunn

Jr. , Dupont

, Dupuis

, Duran

, Durcan

, Duvezin-Caubet

, Duvvuri

, Eapen

, Ebrahimi-Fakhari

, Echard

, Eckhart

, Edelstein

, Edinger

, Eichinger

, Eisenberg

, Eisenberg-Lerner

, Eissa

, El-Deiry

, El-Khoury

, Elazar

, Eldar-Finkelman

, Elliott

, Emanuele

, Emmenegger

, Engedal

, Engelbrecht

, Engelender

, Enserink

, Erdmann

, Erenpreisa

, Eri

, Eriksen

, Erman

, Escalante

, Eskelinen

, Espert

, Esteban-Martinez

, Evans

, Fabri

, Fabrias

, Fabrizi

, Facchiano

, Faergeman

, Faggioni

, Fairlie

, Fan

, Fang

, Fanto

, Fanzani

, Farkas

, Faure

, Favier

, Fearnhead

, Federici

, Fei

, Felizardo

, Feng

, Ferguson

, Fernandez

, Fernandez-Barrena

, Fernandez-Checa

, Fernandez-Lopez

, Fernandez-Zapico

, Feron

, Ferraro

, Ferreira-Halder

, Fesus

, Feuer

, Fiesel

, Filippi-Chiela

, Filomeni

, Fimia

, Fingert

, Finkbeiner

, Finkel

, Fiorito

, Fisher

, Flajolet

, Flamigni

, Florey

, Florio

, Floto

, Folini

, Follo

, Fon

, Fornai

, Fortunato

, Fraldi

, Franco

, Francois

, Frankel

, Fraser

, Frey

, Freyssenet

, Frezza

, Friedman

, Frigo

, Fu

, Fuentes

, Fueyo

, Fujitani

, Fujiwara

, Fujiya

, Fukuda

, Fulda

, Fusco

, Gabryel

, Gaestel

, Gailly

, Gajewska

, Galadari

, Galili

, Galindo

, Galliciotti

, Galluzzi

, Galy

, Gammoh

, Gandy

, Ganesan

, Ganley

, Gannage

, Gao

, Garcia Nannig

, Garcia Vescovi

, Garcia-Macia

, Garcia-Ruiz

, Garg

, Gargini

, Gassen

, Gatica

, Gatti

, Gavard

, Gavathiotis

, Ge

, Gean

, Gelmetti

, Genazzani

, Geng

, Genschik

, Gerner

, Gestwicki

, Gewirtz

, Ghavami

, Ghigo

, Ghosh

, Giammarioli

, Giampieri

, Giampietri

, Giatromanolaki

, Gibbings

, Gibellini

, Gibson

, Ginet

, Giordano

, Giorgini

, Giovannetti

, Girardin

, Gispert

, Giuliano

, Gladson

, Glavic

, Gleave

, Godefroy

, Gogal

Jr. , Gokulan

, Goldman

, Goletti

, Goligorsky

, Gomes

, Gomez

, Gomez-Manzano

, Gomez-Sanchez

, Goncalves

, Goncu

, Gong

, Gongora

, Gonzalez

, Gonzalez-Alegre

, Gonzalez-Cabo

, Gonzalez-Polo

, Goping

, Gorbea

, Gorbunov

, Goring

, Gorman

, Gorski

, Goruppi

, Goto-Yamada

, Gotor

, Gottlieb

, Gozes

, Gozuacik

, Graba

, Graef

, Granato

, Grant

, Gravina

, Green

, Greenhough

, Greenwood

, Grimaldi

, Gros

, Grose

, Groulx

, Gruber

, Grumati

, Grune

, Guan

, Guerra

, Guillen

, Gulshan

, Gunst

, Guo

, Gust

, Gustafsson

, Gutierrez

, Gwak

, Haas

, Haber

, Hadano

, Hagedorn

, Hahn

, Halayko

, Hamacher-Brady

, Hamada

, Hamai

, Hamann

, Hamasaki

, Hamer

, Hamid

, Hammond

, Han

, Handa

, Hanover

, Hansen

, Harada

, Harhaji-Trajkovic

, Harper

, Harrath

, Harris

, Hasler

, Hasselblatt

, Hasui

, Hawley

, He

, Heath

, Hebert

, Heinzen

, Helgason

, Hensel

, Henske

, Her

, Herman

, Hernandez

, Hernandez-Tiedra

, Hetz

, Hiesinger

, Higaki

, Hilfiker

, Hill

, Hino

, Hofius

, Hofman

, Hoglinger

, Hohfeld

, Holz

, Hong

, Hood

, Hoozemans

, Hoppe

, Hsu

, Hu

, Hua

, Huang

, Huber

, Huebbe

, Huh

, Hulmi

, Hur

, Hurley

, Husak

, Hussain

, Hwang

, Ichihara

, Imai

, Imbriano

, Inomata

, Into

, Iovane

, Iovanna

, Iozzo

, Ip

, Irazoqui

, Iribarren

, Isaka

, Isakovic

, Ischiropoulos

, Isenberg

, Ishaq

, Ishida

, Ishii

, Ishmael

, Isidoro

, Isobe

, Isono

, Issazadeh-Navikas

, Itahana

, Itakura

, Ivanov

, Iyer

, Izquierdo

, Izumi

, Izzo

, Jaattela

, Jaber

, Jackson

, Jacob

, Jacques

, Jagannath

, Jain

, Jana

, Jang

, Jani

, Janji

, Jannig

, Jansson

, Jean

, Jendrach

, Jeon

, Jessen

, Jeung

, Jia

, Jiang

, Jimenez

, Jin

, Jinwal

, Jo

, Johansen

, Johnson

, Jonasch

, Jones

, Joosten

, Jordan

, Joseph

, Joubert

, Ju

, Juan

, Juenemann

, Juhasz

, Jung

, Jungbluth

, Justice

, Jutten

, Kaakoush

, Kaarniranta

, Kaasik

, Kabuta

, Kaeffer

, Kagedal

, Kahana

, Kajimura

, Kakhlon

, Kalia

, Kalvakolanu

, Kamada

, Kambas

, Kaminskyy

, Kampinga

, Kandouz

, Kang

, Kanki

, Kanneganti

, Kanno

, Kanthasamy

, Kantorow

, Kaparakis-Liaskos

, Kapuy

, Karantza

, Karim

, Karmakar

, Kaser

, Kaushik

, Kawula

, Kaynar

, Ke

, Kehrl

, Keller

, Kemper

, Kenworthy

, Kepp

, Kern

, Kesari

, Kessel

, Ketteler

, Kettelhut Ido

, Khambu

, Khan

, Khandelwal

, Khare

, Kiang

, Kiger

, Kihara

, Kim

, Kimchi

, Kimmelman

, Kimura

, King

, Kirkegaard

, Kirkin

, Kirshenbaum

, Kishi

, Kitajima

, Kitamoto

, Kitaoka

, Kitazato

, Kley

, Klimecki

, Klinkenberg

, Klucken

, Knaevelsrud

, Knecht

, Knuppertz

, Ko

, Kobayashi

, Koch

, Koechlin-Ramonatxo

, Koenig

, Koh

, Kohler

, Kohlwein

, Koike

, Komatsu

, Kominami

, Kong

, Konstantakou

, Kopp

, Korcsmaros

, Korhonen

, Korolchuk

, Koshkina

, Kou

, Koukourakis

, Koumenis

, Kovacs

, Koya

, Kraft

, Krainc

, Kramer

, Kravic-Stevovic

, Krek

, Kretz-Remy

, Krick

, Krishnamurthy

, Kriston-Vizi

, Kroemer

, Kruer

, Kruger

, Ktistakis

, Kuchitsu

, Kuhn

, Kumar

, Kundu

, Kung

, Kuno

, Kuo

, Kuret

, Kurz

, Kwok

, Kwon

, Kyrmizi

, La Spada

, Lafont

, Lahm

, Lakkaraju

, Lam

, Lamark

, Lancel

, Landowski

, Lane

, Lanzi

, Lapaquette

, Lapierre

, Laporte

, Laukkarinen

, Laurie

, Lavandero

, Lavie

, LaVoie

, Law

, Layfield

, Lazo

, Le Cam

, Le Roch

, Le Stunff

, Leardkamolkarn

, Lecuit

, Lee

, Leeuwenburgh

, Lefort

, Legouis

, Lei

, Leib

, Leibowitz

, Lekli

, Lemaire

, Lemasters

, Lemberg

, Lemoine

, Leng

, Lenz

, Lenzi

, Lerman

, Lettieri Barbato

, Leu

, Leung

, Levine

, Lewis

, Lezoualc'h

, Li

, Lian

, Liang

, Liao

, Liberal

, Liberski

, Lie

, Lieberman

, Lim

, Lima

, Lin

, Linden

, Lindholm

, Lindqvist

, Lingor

, Linkermann

, Liotta

, Lipinski

, Lira

, Lisanti

, Liton

, Liu

, Liuzzi

, Lizard

, Ljujic

, Lodhi

, Logue

, Lokeshwar

, Long

, Lonial

, Loos

, Lopez-Otin

, Lopez-Vicario

, Lorente

, Lorenzi

, Lorincz

, Los

, Lotze

, Lovat

, Lu

, Luciano

, Luckhart

, Lucocq

, Ludovico

, Lugea

, Lukacs

, Lum

, Lund

, Luo

, Luparello

, Lyons

, Ma

, Machado

, Machado-Santelli

, Macian

, MacIntosh

, MacKeigan

, Macleod

, MacMicking

, MacMillan-Crow

, Madeo

, Madesh

, Madrigal-Matute

, Maeda

, Maegawa

, Maellaro

, Maes

, Magarinos

, Maiese

, Maiti

, Maiuri

, Maki

, Malli

, Malorni

, Maloyan

, Mami-Chouaib

, Man

, Mancias

, Mandelkow

, Mandell

, Manfredi

, Manie

, Manzoni

, Mao

, Marambaud

, Marconi

, Marelja

, Marfe

, Margeta

, Margittai

, Mari

, Mariani

, Marin

, Marinelli

, Marino

, Markovic

, Marquez

, Martelli

, Martens

, Martin

, Martin-Acebes

, Martin-Sanz

, Martinand-Mari

, Martinet

, Martinez

, Martinez-Lopez

, Martinez-Outschoorn

, Martinez-Velazquez

, Martinez-Vicente

, Martins

, Mashima

, Mastrianni

, Matarese

, Matarrese

, Mateo

, Matoba

, Matsumoto

, Matsushita

, Matsuura

, Matsuzawa

, Mattson

, Matus

, Maugeri

, Mauvezin

, Mayer

, Maysinger

, Mazzolini

, McBrayer

, McCall

, McCormick

, McInerney

, McIver

, McKenna

, McMahon

, McNeish

, Mechta-Grigoriou

, Medema

, Medina

, Megyeri

, Mehrpour

, Mehta

, Mei

, Meier

, Meijer

, Melendez

, Melino

, de Melo

, Mena

, Meneghini

, Menendez

, Menezes

, Meng

, Menghini

, Menko

, Menna-Barreto

, Menon

, Meraz-Rios

, Merla

, Merlini

, Merlot

, Meryk

, Meschini

, Meyer

, Mi

, Miao

, Micale

, Michaeli

, Michiels

, Migliaccio

, Mihailidou

, Mijaljica

, Mikoshiba

, Milan

, Miller-Fleming

, Mills

, Minakaki

, Minassian

, Ming

, Minibayeva

, Minina

, Mintern

, Minucci

, Miranda-Vizuete

, Mitchell

, Miyamoto

, Miyazawa

, Mizushima

, Mnich

, Mograbi

, Mohseni

, Moita

, Molinari

, Moller

, Mollereau

, Mollinedo

, Mongillo

, Monick

, Montagnaro

, Montell

, Moore

, Mora-Rodriguez

, Moreira

, Morel

, Morelli

, Moreno

, Morgan

, Moris

, Moriyasu

, Morrison

, Morselli

, Moscat

, Moseley

, Mostowy

, Motori

, Mottet

, Mottram

, Moussa

, Mpakou

, Mukhtar

, Mulcahy Levy

, Muller

, Munoz-Moreno

, Munoz-Pinedo

, Munz

, Murphy

, Murray

, Murthy

, Mysorekar

, Nabi

, Nabissi

, Nader

, Nagahara

, Nagai

, Nagata

, Nagelkerke

, Nagy

, Naidu

, Nair

, Nakano

, Nakatogawa

, Nanjundan

, Napolitano

, Naqvi

, Nardacci

, Narendra

, Narita

, Nascimbeni

, Natarajan

, Navegantes

, Nawrocki

, Nazarko

, Neill

, Neri

, Netea

, Netea-Maier

, Neves

, Ney

, Nezis

, Nguyen

, Nicot

, Nilsen

, Nilsson

, Nishimura

, Nishino

, Niso-Santano

, Niu

, Nixon

, Njar

, Noda

, Noegel

, Nolte

, Norberg

, Norga

, Noureini

, Notomi

, Notterpek

, Nowikovsky

, Nukina

, Nurnberger

, O'Donnell

, O'Donovan

, O'Dwyer

, Oehme

, Oeste

, Ogawa

, Ogretmen

, Ogura

, Oh

, Ohmuraya

, Ohshima

, Ojha

, Okamoto

, Okazaki

, Oliver

, Ollinger

, Olsson

, Orban

, Ordonez

, Orhon

, Orosz

, O'Rourke

, Orozco

, Ortega

, Ortona

, Osellame

, Oshima

, Osiewacz

, Otomo

, Otsu

, Ou

, Outeiro

, Ouyang

, Overholtzer

, Ozbun

, Ozdinler

, Ozpolat

, Pacelli

, Paganetti

, Page

, Pages

, Pagnini

, Pajak

, Pak

, Pakos-Zebrucka

, Pakpour

, Palkova

, Palladino

, Pallauf

, Pallet

, Palmieri

, Paludan

, Palumbo

, Pampliega

, Pan

, Panaretakis

, Pandey

, Pantazopoulou

, Papackova

, Papademetrio

, Papassideri

, Papini

, Parajuli

, Pardo

, Parekh

, Parenti

, Park

, Parker

, Parlato

, Parys

, Parzych

, Pasquet

, Pasquier

, Pasumarthi

, Patschan

, Patterson

, Pattingre

, Pattison

, Pause

, Pavenstadt

, Pavone

, Pedrozo

, Pena

, Penalva

, Pende

, Peng

, Penna

, Penninger

, Pensalfini

, Pepe

, Pereira

, Perez-de la Cruz

, Perez-Perez

, Perez-Rodriguez

, Perez-Sala

, Perier

, Perl

, Perlmutter

, Perrotta

, Pervaiz

, Pesonen

, Pessin

, Peters

, Petersen

, Petrache

, Petrof

, Petrovski

, Phang

, Piacentini

, Pierdominici

, Pierre

, Pierrefite-Carle

, Pietrocola

, Pimentel-Muinos

, Pinar

, Pineda

, Pinkas-Kramarski

, Pinti

, Pinton

, Piperdi

, Piret

, Platanias

, Platta

, Plowey

, Poggeler

, Poirot

, Polcic

, Poletti

, Poon

, Popelka

, Popova

, Poprawa

, Poulose

, Poulton

, Powers

, Pozuelo-Rubio

, Prak

, Prange

, Prescott

, Priault

, Prince

, Proia

, Proikas-Cezanne

, Prokisch

, Promponas

, Przyklenk

, Puertollano

, Pugazhenthi

, Puglielli

, Pujol

, Puyal

, Pyeon

, Qi

, Qian

, Qin

, Qiu

, Qu

, Quadrilatero

, Quinn

, Raben

, Rabinowich

, Radogna

, Ragusa

, Rahmani

, Raina

, Ramanadham

, Ramesh

, Rami

, Randall-Demllo

, Randow

, Rao

, Rasmussen

, Rasse

, Ratovitski

, Rautou

, Ray

, Razani

, Reed

, Reggiori

, Rehm

, Reichert

, Rein

, Reiner

, Reits

, Ren

, Renna

, Reusch

, Revuelta

, Reyes

, Rezaie

, Richards

, Richardson

, Richetta

, Riehle

, Rihn

, Rikihisa

, Riley

, Rimbach

, Rippo

, Ritis

, Rizzi

, Rizzo

, Roach

, Robbins

, Roberge

, Roca

, Roccheri

, Rocha

, Rodrigues

, Rodriguez

, de Cordoba

, Rodriguez-Muela

, Roelofs

, Rogov

, Rohn

, Rohrer

, Romanelli

, Romani

, Romano

, Roncero

, Rosa

, Rosello

, Rosen

, Rosenstiel

, Rost-Roszkowska

, Roth

, Roue

, Rouis

, Rouschop

, Ruan

, Ruano

, Rubinsztein

, Rucker

, 3rd, Rudich

, Rudolf

, Ruegg

, Ruiz-Roldan

, Ruparelia

, Rusmini

, Russ

, Russo

, Rusten

, Ryabovol

, Ryan

, Ryter

, Sabatini

, Sacher

, Sachse

, Sack

, Sadoshima

, Saftig

, Sagi-Eisenberg

, Sahni

, Saikumar

, Saito

, Saitoh

, Sakakura

, Sakoh-Nakatogawa

, Sakuraba

, Salazar-Roa

, Salomoni

, Saluja

, Salvaterra

, Salvioli

, Samali

, Sanchez

, Sanchez-Alcazar

, Sanchez-Prieto

, Sandri

, Sanjuan

, Santaguida

, Santambrogio

, Santoni

, Dos Santos

, Saran

, Sardiello

, Sargent

, Sarkar

, Sarrias

, Sarwal

, Sasakawa

, Sasaki

, Sass

, Sato

, Satriano

, Savaraj

, Saveljeva

, Schaefer

, Schaible

, Scharl

, Schatzl

, Schekman

, Scheper

, Schiavi

, Schipper

, Schmeisser

, Schmidt

, Schmitz

, Schneider

, Schon

, Schonenberger

, Schonthal

, Schorderet

, Schroder

, Schuck

, Schulze

, Schwarten

, Schwarz

, Sciarretta

, Scotto

, Scovassi

, Screaton

, Screen

, Seca

, Sedej

, Segatori

, Segev

, Seglen

, Segui-Simarro

, Segura-Aguilar

, Seki

, Sell

, Seiliez

, Semenkovich

, Semenza

, Sen

, Serra

, Serrano-Puebla

, Sesaki

, Setoguchi

, Settembre

, Shacka

, Shajahan-Haq

, Shapiro

, Sharma

, She

, Shen

, Sheng

, Shepherd

, Shi

, Shibutani

, Shibuya

, Shidoji

, Shieh

, Shih

, Shimada

, Shimizu

, Shin

, Shinohara

, Shintani

, Shioi

, Shirabe

, Shiri-Sverdlov

, Shirihai

, Shore

, Shu

, Shukla

, Sibirny

, Sica

, Sigurdson

, Sigurdsson

, Sijwali

, Sikorska

, Silveira

, Silvente-Poirot

, Silverman

, Simak

, Simmet

, Simon

, Simone

, Simons

, Simonsen

, Singh

, Sinha

, Sinicrope

, Sirko

, Sirohi

, Sishi

, Sittler

, Siu

, Sivridis

, Skwarska

, Slack

, Slaninova

, Slavov

, Smaili

, Smalley

, Smith

, Soenen

, Soleimanpour

, Solhaug

, Somasundaram

, Son

, Sonawane

, Song

, Soo

, Sood

, Soong

, Soontornniyomkij

, Sorice

, Sotgia

, Soto-Pantoja

, Sotthibundhu

, Sousa

, Spaink

, Span

, Spang

, Sparks

, Speck

, Spector

, Spies

, Springer

, Clair

, Stacchiotti

, Staels

, Stang

, Starczynowski

, Starokadomskyy

, Steegborn

, Steele

, Stefanis

, Steffan

, Stellrecht

, Stenmark

, Stepkowski

, Stern

, Stevens

, Stockwell

, Stoka

, Storchova

, Stork

, Stratoulias

, Stravopodis

, Strnad

, Strohecker

, Strom

, Stromhaug

, Stulik

, Su

, Subauste

, Subramaniam

, Sue

, Suh

, Sui

, Sukseree

, Sulzer

, Sun

, Sundaramoorthy

, Sung

, Suzuki

, Swanson

, Swanton

, Sward

, Swarup

, Sweeney

, Sylvester

, Szatmari

, Szegezdi

, Szlosarek

, Taegtmeyer

, Tafani

, Taillebourg

, Tait

, Takacs-Vellai

, Takahashi

, Takats

, Takemura

, Takigawa

, Talbot

, Tamagno

, Tamburini

, Tan

, Tanaka

, Tang

, Tanida

, Tanji

, Tannous

, Tapia

, Tasset-Cuevas

, Tatar

, Tavassoly

, Tavernarakis

, Taylor

, Tchetina

, Tee

, Teixeira-Clerc

, Telang

, Tencomnao

, Teng

, Terro

, Tettamanti

, Theiss

, Theron

, Thomas

, Thome

, Thomes

, Thorburn

, Thorner

, Thum

, Thumm

, Thurston

, Tian

, Till

, Ting

, Titorenko

, Toker

, Toldo

, Tooze

, Topisirovic

, Torgersen

, Torosantucci

, Torriglia

, Torrisi

, Tournier

, Towns

, Trajkovic

, Travassos

, Triola

, Tripathi

, Trisciuoglio

, Troncoso

, Trougakos

, Truttmann

, Tsai

, Tschan

, Tseng

, Tsukuba

, Tsung

, Tsvetkov

, Tu

, Tuan

, Tucci

, Tumbarello

, Turk

, Turner

, Tveita

, Tyagi

, Ubukata

, Uchiyama

, Udelnow

, Ueno

, Umekawa

, Umemiya-Shirafuji

, Underwood

, Ungermann

, Ureshino

, Ushioda

, Uversky

, Uzcategui

, Vaccari

, Vaccaro

, Vachova

, Vakifahmetoglu-Norberg

, Valdor

, Valente

, Vallette

, Valverde

, Van den Berghe

, Van Den Bosch

, van den Brink

, van der Goot

, van der Klei

, van der Laan

, van Doorn

, van Egmond

, van Golen

, Van Kaer

, van Lookeren Campagne

, Vandenabeele

, Vandenberghe

, Vanhorebeek

, Varela-Nieto

, Vasconcelos

, Vasko

, Vavvas

, Vega-Naredo

, Velasco

, Velentzas

, Vellai

, Vellenga

, Vendelbo

, Venkatachalam

, Ventura

, Veras

, Verdier

, Vertessy

, Viale

, Vidal

, Vieira

, Vierstra

, Vigneswaran

, Vij

, Vila

, Villar

, Villarroya

, Vindis

, Viola

, Viscomi

, Vitale

, Vogl

, Voitsekhovskaja

, von Haefen

, von Schwarzenberg

, Voth

, Vouret-Craviari

, Vuori

, Vyas

, Waeber

, Walker

, Walter

, Wan

, Wang

, Wappner

, Ward

, Warnes

, Watada

, Watanabe

, Watase

, Weaver

, Weekes

, Wei

, Weide

, Weihl

, Weindl

, Weis

, Wen

, Westermann

, Weyand

, White

, Whitton

, Whitworth

, Wiels

, Wild

, Wildenberg

, Wileman

, Wilkinson

, Willbold

, Williams

, Williamson

, Winklhofer

, Witkin

, Wohlgemuth

, Wollert

, Wolvetang

, Wong

, Woodcock

, Wright

, Wu

, Xavier

, Xia

, Xiao

, Xie

, Xilouri

, Xiong

, Xu

, Xue

, Yamada

, Yamamoto

, Yamanaka

, Yamashina

, Yamashiro

, Yan

, Yanagi

, Yang

, Yao

, Yasui

, Ye

, Yedvobnick

, Yeganeh

, Yeh

, Yeyati

, Yi

, Yin

, Yip

, Yoo

, Yoon

, Yoshida

, Yoshimori

, Young

, Yu

, Yuan

, Yue

, Zacks

, Zacksenhaus

, Zaffaroni

, Zaglia

, Zakeri

, Zecchini

, Zeng

, Zervos

, Zhang

, Zhao

, Zheng

, Zhivotovsky

, Zhong

, Zhou

, Zhu

, Zhuang

, Ziparo

, Zois

, Zoladek

, Zong

, Zorzano

, and Zughaier

. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy, 12: 1–222, 2016.

14.

Levine

. Eating oneself and uninvited guests: autophagy-related pathways in cellular defense. Cell, 120: 159–162, 2005.

15.

Levitt

, Abdel-Rehim

, and Furne

. Free and acid-labile hydrogen sulfide concentrations in mouse tissues: anomalously high free hydrogen sulfide in aortic tissue. Antioxid Redox Signal, 15: 373–378, 2011.

16.

, Bhatia

, Zhu

, Ramnath

, Wang

, Anuar

, Whiteman

, Salto-Tellez

, and Moore

. Hydrogen sulfide is a novel mediator of lipopolysaccharide-induced inflammation in the mouse. FASEB J, 19: 1196–1198, 2005.

17.

, Fei

, Ren

, Sun

, Liu

, Sheng

, Wang

, Sun

, Yu

, Wang

, and Fei

. Functional imaging of interleukin 1 beta expression in inflammatory process using bioluminescence imaging in transgenic mice. BMC Immunol, 9: 49, 2008.

18.

Luedde

and Schwabe

. NF-kappaB in the liver—linking injury, fibrosis and hepatocellular carcinoma. Nat Rev Gastroenterol Hepatol, 8: 108–118, 2011.

19.

Mallat

and Lotersztajn

. Cellular mechanisms of tissue fibrosis. 5. Novel insights into liver fibrosis. Am J Physiol Cell Physiol, 305: C789–C799, 2013.

20.

Mani

, Cao

, Wu

, and Wang

. Hydrogen sulfide and the liver. Nitric Oxide, 41: 62–71, 2014.

21.

Park

, Kim

, Woo

, Lee

, Yu

, Kim

, Park

, Jo

, Park

, Jung

, Lee

, Jeong

, and Ryu

. Tonsil-derived mesenchymal stem cells ameliorate CCl4-induced liver fibrosis in mice via autophagy activation. Sci Rep, 5: 8616, 2015.

22.

Peng

, Dai

, Huang

, He

, Yang

, and Chen

. Relationship between anti-fibrotic effect of Panax notoginseng saponins and serum cytokines in rat hepatic fibrosis. Biochem Biophys Res Commun, 388: 31–34, 2009.

23.

Predmore

, Lefer

, and Gojon

. Hydrogen sulfide in biochemistry and medicine. Antioxid Redox Signal, 17: 119–140, 2012.

24.

Renga

. Hydrogen sulfide generation in mammals: the molecular biology of cystathionine-beta-synthase (CBS) and cystathionine-gamma-lyase (CSE). Inflamm Allergy Drug Targets, 10: 85–91, 2011.

25.

Shirozu

, Tokuda

, Marutani

, Lefer

, Wang

, and Ichinose

. Cystathionine gamma-lyase deficiency protects mice from galactosamine/lipopolysaccharide-induced acute liver failure. Antioxid Redox Signal, 20: 204–216, 2014.

26.

Song

, Li

, Yin

, Lu

, Liu

, and Hu

. Hydrogen sulfide: a therapeutic candidate for fibrotic disease?. Oxid Med Cell Longev, 2015: 458720, 2015.

27.

Tanida

, Ueno

, and Kominami

. LC3 and autophagy. Methods Mol Biol, 445: 77–88, 2008.

28.

Tsai

, Chen

, Pan

, Wang

, Mersmann

, and Ding

. Alleviation of carbon-tetrachloride-induced liver injury and fibrosis by betaine supplementation in chickens. Evid Based Complement Alternat Med, 2015: 725379, 2015.

29.

Wagner

. Hydrogen sulfide: a new gaseous signal molecule and blood pressure regulator. J Nephrol, 22: 173–176, 2009.

30.

Wang

, Chu

, Chen

, Man

, Go

, Huang

, Lan

, Sung

, and Yu

. microRNA-29b prevents liver fibrosis by attenuating hepatic stellate cell activation and inducing apoptosis through targeting PI3K/AKT pathway. Oncotarget, 6: 7325–7338, 2015.

31.

Wang

, Wang

, Zhu

, Liu

, Fei

, and Wang

. Anti-inflammatory activity of curcumin-loaded solid lipid nanoparticles in IL-1beta transgenic mice subjected to the lipopolysaccharide-induced sepsis. Biomaterials, 53: 475–483, 2015.

32.

Weber

, Boll

, and Stampfl

. Hepatotoxicity and mechanism of action of haloalkanes: carbon tetrachloride as a toxicological model. Crit Rev Toxicol, 33: 105–136, 2003.

33.

Yang

, Jing

, Zhao

, Sun

, Liu

, Ying

, Ci

, Kuang

, Huang

, Wang

, and Fei

. Functional imaging of Rel expression in inflammatory processes using bioluminescence imaging system in transgenic mice. PLoS One, 8: e57632, 2013.

34.

Yin

, Zhao

, Li

, Mei

, Yao

, Liu

, Li

, Qi

, Wang

, Shi

, Qiu

, Fan

, and Zha

. Sp1 is involved in regulation of cystathionine gamma-lyase gene expression and biological function by PI3K/Akt pathway in human hepatocellular carcinoma cell lines. Cell Signal, 24: 1229–1240, 2012.

35.

Zhang

, Sio

, Moochhala

, and Bhatia

. Role of hydrogen sulfide in severe burn injury-induced inflammation in mice. Mol Med, 16: 417–424, 2010.

36.

Zhang

, Pan

, Zhou

, Yuan

, Wang

, Cui

, and Zhang

. Hydrogen sulfide as a potential therapeutic target in fibrosis. Oxid Med Cell Longev, 2015: 593407, 2015.

37.

Zhang

, Li

, Zhao

, Sun

, Zong

, Li

, Zhu

, Zou

, Yang

, and Ge

. Hydrogen sulfide attenuates the recruitment of CD11b(+)Gr-1(+) myeloid cells and regulates Bax/Bcl-2 signaling in myocardial ischemia injury. Sci Rep, 4: 4774, 2014.

38.

Zhu

, Zeng

, Chen

, Zhang

, Liu

, Chen

, and Li

. Oroxylin A accelerates liver regeneration in CCl(4)-induced acute liver injury mice. PLoS One, 8: e71612, 2013.

39.

Zhu

, Zhang

, Zhou

, Kong

, Chen

, Lu

, and Zheng

. Diallyl trisulfide attenuates carbon tetrachloride-caused liver injury and fibrogenesis and reduces hepatic oxidative stress in rats. Naunyn Schmiedebergs Arch Pharmacol, 387: 445–455, 2014.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.06 MB

0.10 MB

0.04 MB

0.07 MB

0.05 MB

0.13 MB

0.25 MB

0.07 MB

0.06 MB

0.05 MB

7.87 MB

Cystathionine γ-Lyase Deficiency Exacerbates CCl 4 -Induced Acute Hepatitis and Fibrosis in the Mouse Liver

Abstract

Aims:

Results:

Innovation:

Conclusion:

Introduction

Results

A CSE knock-out luciferase gene KI mouse model was generated by gene targeting

CSE deficiency aggravated CCl4-induced liver injury

NaHS pretreatment attenuated CCl4-induced liver injury in WT and CSE−/− mice

Administration of L-cysteine attenuated CCl4-induced liver injury and increased the H2S levels in WT mice

Discussion

Materials and Methods

Animals and genotyping

Reagents

Exogenous H2S donor

In vivo imaging

Acute septic shock model generated by i.p. injection of LPS

Real-time quantitative PCR

Ex vivo measurement of luciferase activity

Animal models of acute hepatitis and liver fibrosis

Measurement of biochemical index and homocysteine concentration in serum

Measurement of serum and liver tissue H2S

Histological assessment of liver injury

Hepatic hydroxyproline content

Western blotting

Statistical analysis

Footnotes

Acknowledgments

Author Disclosure Statement

Abbreviations Used

References

Supplementary Material

CSE deficiency aggravated CCl₄-induced liver injury

NaHS pretreatment attenuated CCl₄-induced liver injury in WT and CSE^−/− mice

Administration of L-cysteine attenuated CCl₄-induced liver injury and increased the H₂S levels in WT mice

Exogenous H₂S donor

Measurement of serum and liver tissue H₂S