Protein S -Bacillithiolation Functions in Thiol Protection and Redox Regulation of the Glyceraldehyde-3-Phosphate Dehydrogenase Gap in Staphylococcus aureus Under Hypochlorite Stress

Identification of 58 NaOCl-sensitive proteins using the quantitative redox proteomic approach OxICAT in S. aureus USA300

We were interested to study the role of BSH for S-bacillithiolation and the global thiol oxidation state under hypochlorite stress in the major pathogen S. aureus. Thus, we performed a quantitative thiol redox proteomic approach based on OxICAT (48, 49) and analyzed the percentages of thiol oxidation levels in S. aureus USA300 in response to 150 μM NaOCl stress, as determined previously (51). OxICAT is based on the differential thiol labeling of reduced Cys residues with light isotope-coded affinity tag (¹²C-ICAT), followed by reduction of reversible thiol oxidation (e.g., protein disulfides and S-thiolation) with Tris (2-carboxyethyl) phosphine (TCEP) and subsequent labeling of previously oxidized thiols with heavy ¹³C-ICAT reagent (48). Light and heavy ICAT-labeled peptide pairs show a mass difference of 9 Da after separation using mass spectrometry (MS). The quantification of the percentage of thiol oxidation for each Cys peptide is based on the calculation of the intensity of the heavy ICAT-labeled Cys peptide in relation to the total intensity of the light and heavy ICAT-labeled Cys peptides.

The OxICAT analysis enabled the quantification of the percentages of reversible thiol oxidation for 228 Cys peptides in the thiol redox proteome of S. aureus USA300 (Supplementary Table S1; Supplementary Data; Supplementary Data are available online at www.liebertpub.com/ars). The percentages of thiol oxidation were color coded and visualized in Voronoi redox treemaps according to the TIGRfam classification of S. aureus USA300 ( Fig. 1).

OPEN IN VIEWER

FIG. 1.

Percentages of thiol oxidation for 228 Cys peptides that are identified in Staphylococcus aureus USA300 and visualized using Voronoi redox treemaps . The percentages of thiol oxidation of 228 Cys residues that are identified using OxICAT in S. aureus USA300 in the control (A) and 30 min after exposure to 150 μM NaOCl stress (B) are visualized using Voronoi redox treemaps. The gray–red color gradient denotes 0–100% oxidation. The Voronoi redox treemap in (C) shows the percentages of oxidation changes under NaOCl stress using a blue–red color gradient ranging from −75% to +75% oxidation. The treemap in (D) serves as the legend showing the functional classifications of proteins. The treemaps are generated using the Paver software (Decodon) based on the OxICAT data presented in Supplementary Tables S1 and proteins were classified according to the S. aureus USA300 TIGRfam annotation. NaOCl, sodium hypochlorite.

In untreated S. aureus cells, we identified 193 Cys residues (84.6%) with a thiol oxidation level of <25%, including 107 Cys residues (46.9%) with <10% oxidation, indicating that the majority of thiols are in a reduced state (Tables 1 and 2; Supplementary Table S1). Only 35 Cys residues (15.3%) showed basal-level oxidation of >25% in the control. These basal-level oxidized proteins include predicted redox-sensitive proteins (21), such as the thiol peroxidase Tpx, the alkyl hydroperoxide reductase large subunit AhpF, the arsenate reductase ArsC1, and the thioredoxin reductase TrxB1. Tpx and AhpCF were previously found as basal-level oxidized in the redox proteomes of Escherichia coli and Bacillus species (16, 48). Tpx was also S-mycothiolated in Corynebacterium glutamicum at the conserved active site Cys60 (14). In addition, the topoisomerase TopA and the DnaJ chaperone are basal-level oxidized at their Zn-binding Cys residues.

To discover novel NaOCl-sensitive proteins, we analyzed the percentages of thiol oxidation levels under NaOCl stress and its oxidation increase using OxICAT (Fig. 1 and Tables 2; Supplementary Table S1). The OxICAT approach enabled the identification of 58 NaOCl-sensitive Cys residues (25.4%) with >10% increased oxidation, including 19 Cys residues with 20–30% oxidation change under NaOCl stress (Tables 1 and 2 and Supplementary Table S1). Several NaOCl-sensitive proteins have antioxidant functions, such as the AhpCF peroxiredoxins, the thioredoxin reductase TrxB1, and the arsenate reductase ArsC. Furthermore, interesting proteins are the nitric oxide synthase (USA300HOU_1916) and the CoASH disulfide reductase Cdr (USA300HOU_0929), the latter is oxidized at the conserved Cys16. Apart from Cdr, the putative BSH disulfide reductase YpdA (USA300GOU_1417) was oxidized at the same conserved Cys14, but its oxidation is not increased under NaOCl stress (Supplementary Table S1). Moreover, we observed a slightly increased oxidation of the deacetylase BshB2 involved BSH biosynthesis and of the bacilliredoxin YqiW (BrxB) under NaOCl stress. The oxidation of Cdr, YpdA, BshB2, and BrxB could indicate increased S-bacillithiolation and CoASH mixed protein disulfides under NaOCl stress.

NaOCl-sensitive proteins are often oxidized in CxxC motifs and at conserved Zn-binding sites. Examples for Zn redox switches are the Zn-containing alcohol dehydrogenase Adh (USA300HOU_0610), the ribosomal proteins RpmG3 (USA300HOU_1553), and RpmJ (USA300HOU_2218). Zn-containing ribosomal proteins share three to four Cys residues that are suggested to serve as reservoir for Zn storage (54). As another Zn redox switch, we identified the ferric uptake repressor Fur that showed 16.6% increased oxidation at its Zn-binding site at Cys 140 and Cys143 under NaOCl stress (Tables 2; Supplementary Table S1; Figs. 1–2). Fur contains two CxxC motifs that form a structural Cys4:Zn site and are required for stability. In addition, two regulatory iron-binding sites are present in Fur (32). FurA of Anabaena was described as redox switch under oxidative stress and Cys101 in the CxxC motif is essential for iron-sensing and DNA-binding activity (7).

OPEN IN VIEWER

FIG. 2.

Close-ups of the redox treemaps of S. aureus USA300 showing S -bacillithiolated enzymes and redox regulators (SarZ, MgrA, and Fur). Enlarged sections of the redox treemaps are shown that include the identified S-bacillithiolated proteins (Gap, AldA, GuaB, RpmJ) and NaOCl-sensitive redox-sensing regulators (MgrA, SarZ, and Fur). The close-ups show the percentages of thiol oxidation under control, NaOCl stress, and the percentage of oxidation change under NaOCl stress versus control as revealed in Figure 1 using the same color gradient. The symbol * denotes conserved Cys.

The copper chaperone CopZ was 19.8% oxidized in its CxxC motif that is required for Cu binding (67). The interaction of the B. subtilis CopZ homolog with BSH has been recently studied leading to the formation of S-bacillithiolated apo-CopZ and Cu(i)-bound forms of CopZ (42). In addition, NaOCl-sensitive Cys residues often coordinate FeS clusters or function in FeS cluster biogenesis. The FeS cluster scaffold protein NifU showed 26% increased oxidation at Cys41 that binds the FeS cluster during the assembly. The cysteine desulfurase NifS exhibits 20.6% higher oxidation levels at the catalytic Cys371 that forms the persulfide with the sulfur released during cysteine desulfuration (5). In addition, the FeS cluster assembly protein SufB is oxidized in its FeS cluster binding Cys302. It is interesting to note that the nifS-nifU-sufB genes are cotranscribed in an operon.

As NaOCl-sensing redox regulators, the MarR/OhrR family repressors, MgrA and SarZ (USA300HOU_0709 and USA300HOU_2368), were identified that showed 10.5% and 6.5% increased oxidation levels under NaOCl stress at their redox-sensing single Cys (Fig. 2). The DNA-binding activity of MgrA and SarZ was inhibited by S-thiolation using a synthetic thiol in vitro (11, 13, 35). In this study, increased oxidation of MgrA and SarZ was found in S. aureus under NaOCl stress, indicating that both could be redox controlled by S-bacillithiolation analogous to OhrR of B. subtilis (47). OhrR and SarZ both control a homologous ohrA peroxiredoxin gene that confers resistance to organic hydroperoxides and NaOCl in B. subtilis (13). Northern blot analyses revealed increased transcription of ohrA under NaOCl stress, indicating that SarZ oxidation leads to its inactivation and derepression of ohrA transcription (Fig. 3). We further noted the 15% increased oxidation of the virulence factor and secretory antigen SsaA2 at its conserved single Cys171 under NaOCl stress. The homologous SceB precursor (Sca_1790) of S. carnosus was previously S-bacillithiolated at the conserved Cys in NaOCl-treated cells (16). Thus, SsaA2 is most likely also S-bacillithiolated in S. aureus.

OPEN IN VIEWER

FIG. 3.

Northern blot analysis showing transcriptional induction of the SarZ-regulated ohrA gene (USA300HOU_0835) under NaOCl stress. RNA was isolated from S. aureus USA300 grown in Belitsky minimal medium under control and NaOCl stress conditions and subjected to Northern blot analysis for ohrA (USA300HOU_0835) transcription. Transcription of ohrA is upregulated due to SarZ thiol oxidation and inactivation under NaOCl stress as revealed by OxICAT analysis in vivo.

The NaOCl-sensitive proteins of S. aureus include many metabolic enzymes that function in energy metabolism and in different biosynthesis pathways for amino acids, fatty acids, nucleotides, and cofactors. NaOCl-sensitive enzymes involved in energy metabolism include the glycolytic glyceraldehyde-3-phosphate (G3P) dehydrogenase Gap and phosphofructokinase PfkA (USA300HOU_1685), the alcohol dehydrogenase Adh, the aldehyde dehydrogenase AldA (USA300HOU_2110), the formate dehydrogenase FdhA (USA300HOU_2291), and the malate dehydrogenase Mqo (USA300HOU_2348). Gap and AldA both showed the highest oxidation increase of 29% and 26% under NaOCl stress at their catalytic active sites at Cys151 and Cys279, respectively. Furthermore, the IMP dehydrogenase GuaB and the purine nucleosidase USA300HOU_2265 both displayed 25% increased oxidation under NaOCl stress (Tables 2; Supplementary Table S1).

Among the cell wall biosynthesis enzymes, the alanine racemase Alr2 (USA300HOU_2065) and the UDP-N-acetylglucosamine 1-carboxyvinyltransferase MurZ (USA300HOU_2112) were identified as NaOCl-sensitive proteins. The glucose-inhibited division protein MnmG showed 20.8% increased oxidation under NaOCl stress. Many aminoacyl-tRNA synthetases were strongly oxidized under NaOCl stress. We detected 18–24% higher oxidation levels for the histidine- and phenylalanine tRNA ligases (HisS and PheT2) and for the queuine tRNA ribosyltransferase (Tgt) under NaOCl stress.

Five S-bacillithiolated proteins were identified using shotgun proteomics in S. aureus, including the glycolytic Gap as major target

We used the previously applied shotgun proteomic approach for identification of S-bacillithiolated proteins under nonreducing conditions based on the 396 Da mass increase at Cys residues (16). Five S-bacillithiolated proteins were identified in NaOCl-treated cells of S. aureus USA300, including Gap, AldA, GuaB, RpmJ, and the manganese-dependent inorganic pyrophosphatase PpaC (Table 3; Supplementary Fig. S1). GuaB was S-bacillithiolated at its active site Cys307, which forms the thioimidate intermediate with the substrate and is S-thiolated also in other gram-positive bacteria (Table 3; Supplementary Fig. S1).

Gap and AldA were S-bacillithiolated at their catalytic active sites at Cys151 and Cys279, respectively (Fig. 2 and Table 3; Supplementary Fig. S1). The AldA homolog of S. carnosus was previously found S-bacillithiolated at Cys279 (16). The active site Cys of Gap is a conserved target for S-glutathionylation in eukaryotic Gap homologs. Cys151 of Gap showed 29.5% oxidation increase under NaOCl stress in the OxICAT analysis, which is reflected also by the mass spectra of the ICAT-labeled Cys151-peptides (Fig. 4A ). Nonreducing BSH-specific Western blots further identified that Gap is the most abundant S-bacillithiolated protein under hypochlorite stress based on the size and supported by the MS results (Fig. 4B; Supplementary Fig. S1). Gap-SSB was detected in the S. aureus USA300 and COL strains, but is absent in the bshA mutant as expected.

OPEN IN VIEWER

FIG. 4.

OxICAT analysis revealed a 29% increased oxidation of the Gap Cys151 peptide (A) and Gap was identified as most abundant S -bacillithiolated protein in S. aureus under NaOCl stress as shown by BSH-specific Western blot analysis (B). (A) The OxICAT mass spectrometry results are shown for the Gap Cys151 peptide in S. aureus USA300 under control and 30 min after NaOCl stress. The reduced Gap Cys151 peptides in the cell extract are labeled with light ¹²C-ICAT, followed by reduction of all reversible thiol oxidation, including the S-bacillithiolated Cys151 peptides and subsequent labeling of previously oxidized Cys151 peptide by heavy ¹³C-ICAT reagent. According to the quantification by the MaxQuant software, the Cys151 peptide was 8.3% oxidized in the control and its oxidation level increased to 37.7% under NaOCl stress. (B) Nonreducing BSH-specific Western blot analysis identified Gap as most abundant S-bacillithiolated protein in S. aureus USA300 and COL strains under NaOCl stress. Two independent biological replicates are shown for S. aureus COL denoted as COL-1 and COL-2. Gap is S-bacillithiolated at the active site Cys151 under NaOCl stress as revealed by subsequent LC-MS/MS analysis (Supplementary Fig. S1A). BSH, bacillithiol; LC-MS/MS, liquid chromatography tandem mass spectry.

Gap contributes as most abundant Cys protein with 4% to the total Cys proteome

We were further interested in the contribution of Gap and other S-bacillithiolated proteins to the total Cys proteome of S. aureus. S. aureus USA300 encodes for 2694 proteins. These include 1864 proteins with 4935 Cys residues, indicating that the Cys content is 0.64% in the theoretical proteome (Supplementary Fig. S2A, B). Using shotgun proteomics, the spectral protein abundance for 600 proteins, including 398 Cys-containing proteins, was determined in the proteome of S. aureus USA300 (Supplementary Table S2 and Supplementary Fig. S2C). The protein abundance in the proteome is visualized using Voronoi treemaps (Fig. 5 ). The cell size corresponds to the spectral protein abundance and the color code denotes the numbers of Cys residues. The majority of 226 Cys proteins identified in the proteome possess only 1–2 Cys residues. However, there are also six proteins with >10 Cys residues. The most Cys-rich protein was identified as the formate dehydrogenase FdhA that contains 26 Cys residues coordinating several FeS clusters. Based on their spectral abundance, we identified 50 abundant Cys-containing proteins that contribute to 60% of the total S. aureus Cys proteome (Supplementary Fig. S2C). The redox state for the majority of these Cys peptides was quantified using the OxICAT approach (Supplementary Table S1). The Cys abundance treemap also shows that many ribosomal proteins and the pyruvate dehydrogenase do not possess Cys residues (Fig. 5).

OPEN IN VIEWER

FIG. 5.

Voronoi treemaps visualize Gap as the most abundant Cys protein in the total Cys proteome of S. aureus USA300. The treemap legend (left) indicates the classification of the S. aureus USA300 proteome into functional categories according to TIGRfam annotations. The cell size corresponds to the spectral counts of each protein identified in the proteome of S. aureus USA300 and classified according to TIGRfam. The Cys-containing proteins are color coded using a yellow–red color gradient based on their numbers of Cys residues (Supplementary Table S2). Proteins without Cys residues are displayed in gray.

The S-bacillithiolated Gap was identified among the most abundant Cys-containing proteins and contributes with 4% of the total Cys proteome (Supplementary Fig. S2C). This indicates that Gap makes the major contribution to the S-bacillithiolome of S. aureus as visualized also by the BSH Western blots. The other S-bacillithiolated proteins, AldA, RpmJ, GuaB, and PpaC, are less abundant and make with 0.1–0.7% of Cys abundance only a minor contribution to the total Cys proteome (Supplementary Table S2).

H₂O₂ and NaOCl-induced inactivation pathways of Gap in S. aureus due to overoxidation and S-bacillithiolation in vitro

The active site of Gap is usually present in a highly conserved CTTNC motif in different organisms (Supplementary Fig. S3). However, in the S. aureus Gap, the second cysteine is replaced by a serine. The identification of S-bacillithiolated Gap under hypochlorite stress was intriguing since a previous proteomic study has shown that Gap of S. aureus is very sensitive to overoxidation to the sulfonic acid form in the presence of 100 mM H₂O₂ in vivo (73). In another proteomic study, Gap was identified as reversibly oxidized by 10 mM H₂O₂ in S. aureus (19). Thus, we were interested to study the inhibition of Gap activity in vitro due to overoxidation and S-bacillithiolation under both H₂O₂ and NaOCl stresses.

Gap of S. aureus was purified as His-tagged protein from E. coli. The inhibition of Gap activity by increasing H₂O₂ concentrations was monitored spectrophotometrically with G3P as substrate in the presence of NAD⁺. The remaining Gap activity was determined by nicotinamide adenine dinucleotide (NADH) generation as absorbance change at 340 nm during the slope in the reaction, as described previously (61). Treatment of Gap with 100 μM H₂O₂ leads to a 50% decrease in Gap activity, while exposure to 1–10 mM H₂O₂ resulted in complete enzyme inactivation (Fig. 6A). Inactivation of Gap with 1–10 mM H₂O₂ alone was irreversible due to overoxidation since Gap activity could be not restored with 10 mM dithiothreitol (DTT) (Fig. 6C). To investigate whether S-bacillithiolation can protect the enzyme against irreversible overoxidation, Gap was pretreated with 10-fold molar excess of BSH before H₂O₂ exposure. Gap activity was already 90% inhibited after oxidation with 100 μM H₂O₂ in the presence of BSH, while treatment with 100 μM H₂O₂ alone only led to 50% decreased activity (Fig. 6A, B). Gap inactivation with H₂O₂ and BSH was caused by reversible S-bacillithiolation since DTT reduction resulted in recovery of Gap activity (Fig. 6C–E; Supplementary Fig. S9). These results support that the Gap active site is highly sensitive to overoxidation, which can be prevented by S-bacillithiolation in the presence of H₂O₂ and BSH.

OPEN IN VIEWER

FIG. 6.

Inactivation of Gap of S. aureus in response to H₂O₂ in vitro. (A, B) Reduced Gap (40 μM) was oxidized with 100 μM, 1, and 10 mM H₂O₂ for 5 min in the absence (A) or presence of 10-molar excess of BSH (400 μM) (B) in reaction buffer (100 mM Tris HCl, 1.35 mM EDTA, pH 8.0). The remaining Gap activity was measured in the presence of G3P and NAD⁺ spectrophotometrically, following NADH production at 340 nm. The Gap activity was calculated as absorbance change from the slope of the reaction in the first 80 s, as described in the Materials and Methods section. (C) To assess the reversibility of Gap inactivation by H₂O₂, Gap was treated with 1 and 10 mM H₂O₂ alone or with H₂O₂ and BSH, followed by reduction with 10 mM DTT. (D) Schematic showing the irreversible inhibition of Gap activity due to overoxidation of the active site Cys with H₂O₂ alone, while Gap activity was reversibly inhibited with H₂O₂ and BSH due to S-bacillithiolation. (E) S-bacillithiolation of Gap in the presence of 10 mM H₂O₂ and BSH was confirmed using a BSH-specific Western blot analysis before and after subsequent DTT reduction. DTT, dithiothreitol; EDTA, ethylenediaminetetraacetic acid; G3P, glyceraldehyde-3-phosphate; H₂O₂, hydrogen peroxide.

Next, we determined the time-dependent Gap inactivation by both H₂O₂-dependent oxidation pathways (Supplementary Fig. S4). Gap was treated with 1 mM H₂O₂ on ice with or without BSH and the remaining Gap activity was determined after different times of H₂O₂-dependent overoxidation and S-bacillithiolation. The Gap activity assays revealed that both S-bacillithiolation and overoxidation lead to 80% enzyme inhibition after 7.5 min of H₂O₂ treatment (Supplementary Fig. S4A). In addition, we analyzed the time course for the detection of Gap-SSB or the overoxidized Cys151 under H₂O₂ treatment with or without BSH using BSH-specific Western blots or MS, respectively. The MS results identified the overoxidized Cys151 sulfonic acid (Cys151-SO₃H) after 1 min of H₂O₂ treatment (Supplementary Fig. S5). The S-bacillithiolated Gap could be also detected after 1 min of treatment with BSH and H₂O₂ (Supplementary Figs. S4B and S9). These results suggest that overoxidation and S-bacillithiolation occur at similar rates under H₂O₂ treatment in vitro. However, the Gap activity assays after treatment with different H₂O₂ concentrations indicate that Gap inhibition is faster with 100 μM H₂O₂ in the presence of BSH compared with 100 μM H₂O₂ alone, which only leads to 50% enzyme inhibition (Fig. 6A, B). Thus, S-bacillithiolation of Cys151 by H₂O₂ in the presence of BSH serves to protect the active site against overoxidation.

Since S-bacillithiolation of Gap was observed under NaOCl stress in vivo, we studied the dose-dependent Gap inactivation by NaOCl with or without prior exposure to BSH (Fig. 7). Treatment of Gap with 100–500 μM NaOCl led to 50–75% inhibition of Gap activity. Pretreatment of Gap with BSH before exposure to 100 μM NaOCl resulted in 70% activity decrease. Gap was fully inactivated with 1 mM NaOCl in the absence or presence of BSH. Treatment of Gap with 1 mM NaOCl alone resulted in irreversible inactivation due to overoxidation since Gap activity could be not restored using DTT. In the presence of BSH, Gap inactivation by NaOCl was caused by reversible S-bacillithiolation since 85% Gap activity could be restored by DTT reduction (Fig. 7C, D). Next, we studied the time course for NaOCl-induced overoxidation and S-bacillithiolation pathways in the presence of 1 mM NaOCl. The Gap activity assays with or without BSH showed that Gap inhibition is faster with BSH and NaOCl compared with NaOCl alone (Supplementary Fig. S6). These results indicate that S-bacillithiolation can efficiently prevent overoxidation of the Gap active site under NaOCl in vitro, supporting our in vivo finding.

OPEN IN VIEWER

FIG. 7.

Inactivation of Gap of S. aureus in response to NaOCl in vitro. (A, B) Reduced Gap was treated with 0.1–1 mM NaOCl for 5 min without (A) or with 10-molar excess of BSH (B) in reaction buffer (100 mM Tris HCl, 1.35 mM EDTA, pH 8.0). The remaining Gap activity was measured spectrophotometrically, following NADH production at 340 nm. The Gap activity was calculated as absorbance change from the slope of the reaction in the first 80 s, as described in the Materials and Methods section. (C) To analyze the reversibility of Gap inactivation by NaOCl, Gap was inactivated with 1 mM NaOCl in the absence or presence of BSH, followed by DTT reduction. Gap activity was irreversibly inhibited after treatment with NaOCl due to overoxidation since Gap activity could be not restored by DTT. In the presence of NaOCl and BSH, Gap was reversibly inactivated due to S-bacillithiolation since DTT reduction resulted in 85% recovery of Gap activity. (D) Schematic showing that NaOCl leads to the transient sulfenylchloride formation as unstable intermediate that reacts further with BSH to form S-bacillithiolated Gap. In the absence of BSH, Gap-SCl is quickly overoxidized resulting in irreversible inhibition of Gap activity in vitro.

Regeneration of S-bacillithiolated Gap using the bacilliredoxin Brx (SAUSA300_1321) in vitro

The reversal of S-bacillithiolation was shown to require the glutaredoxin-like bacilliredoxins, YphP (BrxA) and YqiW (BrxB), in B. subtilis (24). Using a Brx-roGFP2 biosensor, we demonstrated recently that the YphP homolog of S. aureus (SAUSA300_1321 or Brx) is highly specific as bacilliredoxin to recognize BSSB (51). Thus, Gap activity was measured after debacillithiolation of Gap-SSB with Brx and Brx Cys mutant proteins (BrxCGA, BrxAGC) and G3P oxidation was followed by NADH production as absorbance change at 340 nm (Fig. 8A). Gap activity could be restored to 70% and 60% during debacillithiolation with Brx and the BrxCGA resolving Cys mutant in vitro, respectively. However, Gap activity was only 25% recovered with the BrxAGC active site mutant protein supporting the specificity of the Brx active site for the attack of BSH mixed disulfide. Debacillithiolation of Gap-SSB by Brx and the BrxCGA mutant was verified in BSH-specific Western blots (Fig. 8B; Supplementary Fig. S9). These results indicate that S-bacillithiolation of Gap functions in protection and redox regulation of the active site Cys and can be reversed by the bacilliredoxin Brx in vitro (Fig. 8C).

OPEN IN VIEWER

FIG. 8.

Recycling of S -bacillithiolated Gap requires the bacilliredoxin Brx in vitro. (A) Gap activity is reversibly inhibited by S-bacillithiolation in vitro and can be restored by reduction using the bacilliredoxin Brx (SAUSA300_1321). Debacillithiolation required the Brx active site Cys. The BrxAGC mutant showed weak activity to reduce Gap-SSB, while the Brx resolving Cys mutant (BrxCGA) could restore Gap activity similar to the wild-type Brx protein. S-bacillithiolated Gap was generated in vitro by treatment of 25 μM Gap with 2.5 mM H₂O₂ in the presence of 250 μM BSH. For debacillithiolation, 2.5 μM Gap-SSB was incubated with 12.5 μM Brx, BrxAGC, and BrxAGC proteins for 30 min. Gap activity was measured after addition of G3P and NAD⁺ by spectrophotometric monitoring of NADH generation at 340 nm. (B) The level of debacillithiolation of Gap-SSB in vitro by Brx and BrxCys mutant proteins was monitored using nonreducing BSH-specific Western blot analysis. The SDS-PAGE is shown as loading control (right). The numbers 1–5 shown in the BSH Western blot and in the SDS-PAGE refer to the legend shown in (A). (C) Schematic for the reduction of S-bacillithiolated Gap using the bacilliredoxin Brx. SDS-PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis.

Structural features of the Gap active site during overoxidation and S-bacillithiolation

We were interested in structural changes of Gap after overoxidation and S-bacillithiolation. The crystals of H₂O₂-treated overoxidized Gap diffracted X-rays to 2.6 Å resolution and belonged to the P2₁2₁2₁ space group. Previously, several crystal structures of the Gap holo- and apoenzyme have been reported with the protein always crystallized in the P2₁ space group (57). The structure of the overoxidized Gap contains four monomers in an asymmetric unit, each consisting of the NAD⁺-binding domain (residues 1–150) and the catalytic domain (residues 151–336) (57) (Supplementary Fig. S7A). The overall fold of overoxidized Gap is almost identical to previously reported reduced Gap structures, with only slight conformational differences observed in the loop regions comprising residues 59–72, 75–90, and 111–118. The root-mean square deviation after global superposition of overoxidized Gap with the holo- (PDB code: 3LVF) or apoenzyme (PDB code: 3LC7) was 1.01 and 1.11 Å, respectively. Interestingly, during previous structural analyses, Gap always copurified with NAD⁺, which had to be removed via activated charcoal to obtain the apoenzyme (57). In contrast, the present Gap structure does not contain NAD⁺, thus representing an apo form of the enzyme. Thus, H₂O₂ treatment seems to have led to loss of the coenzyme.

According to our MS results and previous publications (73), the Gap sulfonic acid was identified by MS as overoxidized form. In the structure of overoxidized Gap, the sulfonic acid form could be modeled into the electron density of the active site Cys151 in each monomer (Supplementary Fig. S7B, C). Overoxidation of Cys151 results in enzyme inhibition as supported by our activity assays. During catalysis, the sulfhydryl group of Cys151 attacks the nucleophilic carbon of the G3P substrate to form a covalent intermediate, thiohemiacetal (72). In the active enzyme, His178 forms an ion pair with Cys151, which increases the acidity and nucleophilicity of the thiol group. During G3P oxidation, His178 hydrogen bonds with the acyl carbonyl of the substrate and stabilizes the hemithioacetal intermediate (57). Apart from interfering with the function of Cys151, the sulfonyl moiety of the hyperoxidized Cys151 also interacts with the main chain carbonyl of Asn316 and the imidazole ring of His178 (Fig. 9A; Supplementary Fig. S7D). Thus, hyperoxidation of Cys151 affects the function of two key catalytic residues of Gap, Cys151, and His178, leading to irreversible inactivation of the enzyme.

OPEN IN VIEWER

FIG. 9.

Structural insights into the Gap active site after overoxidation and S -bacillithiolation. (A) Crystal structure of the overoxidized active site Cys151 (Cys-SO₃H, oC151) of Gap. (B, C) Computational model of BSH docked into the active site of the Gap apoenzyme (B) and holoenzyme with the NAD⁺ coenzyme (C) using a covalent docking algorithm that takes into account the possibility of bond formation between ligand and receptor. Shown is the best pose of 10 best poses of the S-bacillithiolated active site. (D) Superposition of Gap-SO₃H with the S-bacillithiolated apo- and holoenzyme active sites. (E, F) The S-bacillithiolated active site pocket of the apoenzyme (E) and holoenzyme (F) structures rotated by 25° over y axis in respect to (B, C). (G, H) Surface representation of apoenzyme (G) and holoenzyme (H) with docked BSH.

To obtain insights into the structural changes upon S-bacillithiolation, BSH was modeled into the active site of the apo- and holoenzyme structures using molecular docking (Fig. 9B, C). We used a covalent docking algorithm that takes into account the possibility of bond formation between ligand and receptor. Docking of BSH into the apo- or holoenzyme structure resulted in a set of covalent complexes (10 best poses), in which the disulfide bond can readily form and which are structurally very similar at least in the vicinity of the disulfide bond, suggesting a high confidence in the docking pose (Supplementary Fig. S8). In the holoenzyme structure, the NAD⁺ cofactor partially occludes the binding pocket and narrows the space available for BSH binding. As a result, in the holo-Gap active site, where NAD⁺ is present, BSH takes up conformations, which differ significantly less compared with the ones in the apoenzyme. When superimposing the two best binding poses, BSH in the apoenzyme structure partially occupies the part of the pocket where NAD⁺ would be present (Fig. 9D). However, in both cases, S-bacillithiolation of the active site does not require major conformational changes of the protein (Fig. 9E–H). In addition, previous molecular dynamic simulations of human GAPDH (61) suggested little fluctuations of the protein. Taken together, we suggest that BSH can undergo disulfide formation with the active site at little energetic or entropic costs. This may further explain why Gap as the most abundant redox-sensitive protein in the proteome of S. aureus is also the most abundant S-bacillithiolated protein under NaOCl stress.

Bacterial strains and growth conditions

Bacterial strains used were S. aureus COL and USA300 and its isogenic bshA mutants as described previously (64). For cloning and genetic manipulation, E. coli DH5a and BL21 (DE3) plysS were cultivated in Luria Bertani (LB) medium. For NaOCl stress experiments, S. aureus USA300 and COL strains were cultivated in LB medium until an optical density at 540 nm (OD₅₄₀) of 2.0, transferred to Belitsky minimal medium, and treated with 150 μM NaOCl stress as described (51). NaOCl, diamide, DTT, N-ethylmaleimide (NEM), and H₂O₂ (35% w/v) were purchased from Sigma-Aldrich.

MS-based thiol redox proteomics using the OxICAT approach

S. aureus USA300 was harvested before and after exposure to 150 μM NaOCl for 30 min, respectively. The OxICAT method was performed according to the protocol of Lindemann and Leichert (49) with the modification that cells were disrupted using a ribolyzer. The ICAT-labeled peptides were dissolved in 0.1% (v/v) acetic acid and loaded onto self-packed LC columns with 10 μl of buffer A (0.1% (v/v) acetic acid) at a constant pressure of 220 bar without trapping. Peptides were eluted using a nonlinear 85-min gradient from 1% to 99% buffer B (0.1% (v/v) acetic acid in acetonitrile) with a constant flow rate of 300 nl/min and measured using Orbitrap MS as described (6). The S. aureus USA300 sequence database was extracted from Uniprot and used by the search engine Andromeda and the MaxQuant software (version 1.5.1.2) to quantify the ICAT-labeled Cys peptides. Two miscleavages were allowed, the parent ion mass tolerance was 10 ppm and the fragment ion mass tolerance was 1.00 Da. The average percentage of oxidation of each Cys peptide and the percentage change under NaOCl stress were calculated from 2 to 3 biological replicates using the intensity values provided by MaxQuant. Voronoi treemaps were generated using the Paver software to visualize the percentage oxidation of all identified ICAT-labeled peptide pairs. The OxICAT proteomic data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD004918.

Identification of S-bacillithiolated and overoxidized Cys peptides using LTQ-Orbitrap MS

For identification of S-bacillithiolated peptides, NEM-alkylated protein extracts were prepared from S. aureus USA300 cells after exposure to 150 μM NaOCl for 30 min as described (15). The protein extracts were separated by 15% nonreducing sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), followed by tryptic in-gel digestion and LTQ-Orbitrap-Velos MS, as described (15). Post-translational thiol modifications of proteins were identified by searching all tandem mass spectrometry (MS/MS) spectra in dta format against the S. aureus USA300 target–decoy protein sequence database extracted from UniprotKB release 12.7 (UniProt Consortium, Nucleic acids research 2007, 35, D193-197) using Sorcerer™-SEQUEST^® (Sequest v. 2.7 rev. 11, Thermo Electron, including Scaffold 4.0; Proteome Software, Inc., Portland, OR). The SEQUEST search parameters and thiol modifications were used as described (15). The scores and mass deviations of the S-bacillithiolated peptides are shown in detail in Supplementary Figure S1, including their fragmentation spectrum and ion tables.

MS of the H₂O₂-treated overoxidized Gap was performed after in-gel tryptic digestion using nLC-MS/MS by Orbitrap fusion, as described previously (45). For Cys151-SO₃H peptide identification and quantification, MS1 data were filtered to the precursor target masses applying an m/z window of 3 ppm. Isotopic distribution and fragmentation spectra were inspected manually in different charge states in successive MS2 scans in different overoxidized Gap samples.

Cloning, expression, and purification of the S. aureus Gap, Brx, and Brx Cys-Ala mutant proteins in E. coli

The previously constructed plasmids, pET11b-Brx-roGFP2, pET11b-BrxAGC-roGFP2, and pET11b-BrxCGA-roGFP2 (51), were used as template to amplify S. aureus brx (SAUSA300_1321), brxAGC, and brxCGA by PCR using primer pairs 1321-roGFP2-For-NheI (5′-CTAGCTAGCATGAATGCATATGATGCTTATATGAAAG-3′) and roGFP2-1321-Rev-BamHI (5′-CGCGGATCCTTAGTGATGGTGATGGTGATGTTTACAATTT TCGTCAAAGGC-3′). The reverse primer also encodes the C-terminal His₆-tag. The PCR products were digested with NheI and BamHI and inserted into plasmid pET11b (Novagen) that was digested using the same restriction enzymes to generate plasmids pET11b-brx, pET11b-brxAGC, and pET11b-brxCGA. The primer pairs gap-For-NdeI (5′-GGAATTCCATATGGCAGTAAAAGTAGCAATTAATG-3′) and gap-Rev-BamHI (5′-CGCGGATCCTTAGTGATGGTGATGGTGATGTTTAGAAAGTTCAGCTAAGTATGC-3′) were used to amplify the S. aureus gap gene (SAUSA300_0756) by PCR. Chromosomal DNA of S. aureus USA300 was used as template. The PCR products were digested with the restriction enzymes, NdeI and BamHI, and inserted into plasmid pET11b that was digested with the same enzymes to generate plasmids pET11b-gap. The correct sequences of the cloned genes were confirmed by sequencing. The plasmids were transformed into E. coli BL21 (DE3) plysS (Novagen).

For protein expression, E. coli BL21(DE3) plysS strains with the plasmids, pET11b-gap, pET11-brx, pET11b-brxAGC, and pET11b-brxCGA, were grown in 1 liter LB medium and 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added at the exponential phase (OD600 of 0.8) for 3 h at 37°C. His-tagged proteins were purified using His Trap™ HP Ni-NTA columns and the ÄKTA purifier liquid chromatography system (Amersham Bioscience). The proteins were further concentrated to 2–6 mg/ml using Amicon Ultra concentrators (Millipore). Before the activity assays, Gap and Brx proteins were reduced with 10 mM DTT for 30 min, followed by DTT removal using Micro Biospin 6 columns (Biorad).

Gap activity assay

Gap activity was monitored spectrophotometrically at 340 nm and 25°C by the production of NADH. The oxidation of G3P to 1,3-bisphosphoglycerate (1,3-BPG) was measured in an assay mixture containing 1.25 mM NAD⁺ and 0.25 μM Gap in argon-flushed 20 mM Tris-HCl, pH 8.7, with 1.25 mM ethylenediaminetetraacetic acid and 15 mM sodium arsenate. After preincubation, the reaction was started by addition of 0.25 mM D,L-G3P. Sodium arsenate was used as a cosubstrate to form unstable 1-arseno-3-phosphoglycerate, as described previously (61). Degradation of the product allows a favorable equilibrium for measuring the rate of Gap activity in the glycolytic forward reaction. Initial rates were determined by calculation of the slope in the linear part of the curve during the first 80 seconds at the beginning of the reaction (linear regression function, GraphPad) as described previously (61). Percentage of Gap activity was calculated as (Rate_inactivated/Rate_untreated x 100%). The results are presented as mean ± SEM from at least three separate experiments.

S-bacillithiolation of Gap in vitro and reduction by the bacilliredoxin Brx

About 25 μM of purified Gap was S-bacillithiolated with 250 μM BSH in the presence of 2.5 mM H₂O₂ for 5 min. Excess of BSH and H₂O₂ was removed with Micro Biospin 6 columns (Biorad). For the Brx debacillithiolation assay, Gap-SSB was incubated with Brx, BrxCGA, and BrxAGC at 37°C for 30 min, followed by Gap activity assays and nonreducing BSH-specific Western blot analysis, as described (16).

Western blot analysis

The S-bacillithiolated proteins were harvested from S. aureus USA300 wild-type and bshA mutant cells after exposure to 150 μM NaOCl, separated by nonreducing SDS-PAGE, and subjected to BSH-specific Western blot analysis using the polyclonal rabbit anti-BSH antiserum, as described previously (16).

Northern blot experiments

Northern blot analyses were performed as described before (15) using RNA isolated from S. aureus USA300 wild type under control conditions and after treatment with 150 μM NaOCl. Hybridization specific for ohrA (USA300HOU_0835) was performed with the digoxigenin-labeled RNA probe synthesized in vitro using T7 RNA polymerase from T7 promoter containing internal PCR products using the primer pairs ohrA-for, 5′ TGGCAATACATTATGAAACTAAAGC 3′, and ohrA-T7-rev, 5′ CTAATACGACTCACTATAGGGAGATTTAAATCGACATTAATATTTCCTTGA 3′.

Crystallographic procedures

Before crystallization, H₂O₂-treated overoxidized Gap was concentrated to 11 mg/ml. Crystals of overoxidized Gap were grown at 18°C using the hanging drop vapor diffusion technique and 30% (w/v) PEG 3350, 0.1 M Tris, pH 8.5, as the reservoir solution. Crystals were cryoprotected by transfer into mother liquor mixed with 50% (v/v) PEG 400 in a 1:1 ratio and flash-cooled in liquid nitrogen. X-ray diffraction data were collected from a single crystal at 100 K on beamline 14.1 of the BESSY II storage ring (Berlin, Germany) (56) equipped with a PILATUS 6M detector (Company-REF), with a 0.1 ° oscillation and exposure time of 0.3 s per frame. Diffraction images were processed using XDS (41). Crystal parameters and data collection statistics are given in Supplementary Table S3. The Gap-SO₃H structure was solved by molecular replacement with Molrep (71) using the structure of the Gap apoenzyme (PDB entry 3LC7; [57]) as a model. The final model of the Gap-SO₃H was generated by iterative rounds of manual model building using Coot (20) and automated refinement using the phenix.refine package in PHENIX (1) with the inclusion of TLS parameters generated by the TLSMD server (59). Coordinates and structure factor amplitudes have been deposited in the Protein Data Bank (4) under the accession code 5T73 and will be released upon publication.

Molecular docking of BSH into the Gap active site

To model a covalent complex between BSH and the S. aureus Gap active site Cys151, docking experiments were performed with the holo form containing NAD [PDB code: 3LVF chain R, (57)] as well as the apo form [PDB code: 3LC7 chain O, (57)] of the enzyme. Before molecular docking, both protein structures were prepared using the protein preparation wizard (68) in the Schrodinger software (Release 2016–1) graphical user interface Maestro. Hydrogen was added according to the protonation states at pH of 7.0 as predicted by PROPKA, bond orders were assigned, and disulfide bonds were allocated. Water with less than three hydrogen bonds to nonwater residues was removed and minimization of heavy atoms was performed using OPLS3. The BSH structure was obtained from Pubchem (ID: CID 42614123) and processed with the ligand preparation wizard. The ligand was protonated at pH of 7.0 ± 2.0 using Epik (28). Covalent molecular docking was performed using CovDock (79), which combines the two programs Glide (23) for docking and Prime (39, 40) for minimization. Cysteine 151 was set as reactive residue, and the reaction type was disulfide formation. All atom positions were fixed, except for the targeted residue and the ligand. Covalent docking was performed with default options and the poses were ranked according to the Prime energy.