Does Metformin Protect Diabetic Patients from Oxidative Stress and Leukocyte-Endothelium Interactions?

Abstract

Since metformin can exert beneficial vascular effects, we aimed at studying its effect on reactive oxygen species (ROS) production, antioxidant enzyme expression, levels of adhesion molecules, and leukocyte-endothelium interactions in the leukocytes from type 2 diabetic (T2D) patients. The study was carried out in 72 T2D patients (41 of whom were treated with metformin for at least 12 months at a dose of 1700 mg per day), and in 40 sex- and age-matched control subjects. Leukocytes from T2D patients exhibited enhanced levels of mitochondrial ROS and decreased mRNA levels of glutathione peroxidase 1 (gpx1) and sirtuin 3 (sirt3) with respect to controls, whereas metformin was shown to revert these effects. No changes were observed on total ROS production and the expression levels of superoxide dismutase 1 and catalase. Furthermore, increases in leukocyte-endothelial interactions and intercellular adhesion molecule-1 and P-selectin levels were found in T2D and were also restored in metformin-treated patients. Our findings raise the question of whether metformin could modulate the appearance of atherosclerosis in T2D patients and reduce vascular events by decreasing leukocyte oxidative stress through an increase in gpx1 and sirt3 expression, and undermining adhesion molecule levels and leukocyte-endothelium interactions. Antioxid. Redox Signal. 27, 1439–1445.

Introduction

Type 2 diabetes (T2D) has become one of the most important health concerns in developed countries. Although insulin resistance (IR) is the central causal process of T2D, the mechanisms relating IR and T2D are not yet fully understood. T2D is also associated with an enhanced infiltration of leukocytes and an exacerbated oxidative stress (1, 8).

Innovation

Metformin is known to exert beneficial effects on the vasculature. However, there are no studies that question the impact of this drug on the interactions between leukocytes and endothelium in type 2 diabetic patients, a key step in the beginning of the atherosclerotic process. The present study suggests that metformin can modulate the development of atherosclerosis by reducing mitochondrial impairment, adhesion molecule expression, and leukocyte-endothelium contact. In this way, metformin could potentially prevent the onset of atherosclerosis and, hence, cardiovascular disease.

Oxidative stress occurs when the balance between reactive oxygen species (ROS) production and the antioxidant system capacity is disrupted. ROS production plays a key role in the etiology of IR in the leukocytes of diabetic patients (4). Moreover, antioxidant enzymes such as superoxide dismutase 1 (SOD1), catalase (CAT), glutathione peroxidase 1 (GPX1), and sirtuin 3 (SIRT3), which are needed for detoxifying the reactive intermediates, have been seen to be modified in T2D.

During the development of T2D, a low-grade systemic inflammatory response occurs due, at least in part, to hyperglycemic effects on different tissues and cells such as white blood cells (8). The nuclear transcription factor NF-κB is activated under these conditions, especially when there is IR. In this chronic inflammatory state, inflammatory cells such as leukocytes can be damaged by hyperglycemia, and these actions increase the risk of infection by undermining innate immune function.

T2D patients have shown a high prevalence of endothelial dysfunction, which is a crucial feature of the initiation of the atherosclerotic process and is related to IR and cardiovascular disease. In the early stages of atherosclerosis, activated leukocytes roll along the wall of these inflamed vessels and finally adhere and transmigrate. Endothelial recruitment of leukocytes is mediated by adhesion molecules that are expressed on either endothelial or white blood cells. Adhesion molecules that are implicated in the atherogenic process include intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and selectins.

Metformin, a biguanide that acts as an insulin sensitizer, has long been used in the treatment of T2D due to its glucose-lowering properties. This drug increases insulin-stimulated glucose uptake in adipocytes and skeletal muscle, thus reducing hyperglycemia and improving IR. Metformin has been described to exhibit antioxidant and anti-inflammatory effects in T2D patients (7). Moreover, it improves endothelial function in patients with T2D or metabolic syndrome (5).

Different studies have highlighted the importance of hyperglycemia and IR in enhanced ROS production by peripheral blood leukocytes, the decrease of antioxidant enzyme activities, the increase of proinflammatory cytokines, and a rise in the number of leukocyte-endothelium interactions (1, 4, 8). Nevertheless, we wonder whether metformin treatment protects T2D patient leukocytes from oxidative stress by regulating ROS production and antioxidant enzyme expression, and whether this drug modulates leukocyte-endothelium interactions and adhesion molecule expression in T2D patients.

Results

Anthropometric and metabolic parameters

The present study analyzed 40 healthy subjects and 72 T2D patients (41 of whom were taking metformin as their main antidiabetic treatment and 31 of whom were treated with other oral antidiabetic drugs or were drug naïve). Anthropometric and metabolic characteristics of the study population are shown in Table 1. No statistical significances were observed among the groups with respect to percentage of men, age, and diastolic blood pressure (DBP). Both T2D groups of patients had a higher weight (p < 0.05 in T2D without metformin and p < 0.001 in T2D with metformin), body mass index (BMI) (p < 0.01 in T2D without metformin and p < 0.001 in T2D with metformin), waist circumference (p < 0.001 in both T2D groups), and systolic blood pressure (SBP) (p < 0.05 for both T2D groups) than control subjects, and patients treated with metformin had higher waist circumference than those not treated with metformin (p < 0.05). Analysis of glucose metabolism revealed an increase in fasting glucose levels (p < 0.001 in both T2D groups), fasting insulin levels (p < 0.05 in T2D without metformin and p < 0.001 in T2D with metformin), homeostasis model assessment of insulin resistance (HOMA-IR) (p < 0.05 in T2D without metformin and p < 0.001 in T2D with metformin), and HbA1c (p < 0.001 in both T2D groups) with respect to controls. The lipid profile of T2D patients showed lower levels of total, high-density lipoprotein cholesterol (HDL-c) and low-density lipoprotein cholesterol (LDL-c) (p < 0.001 in both groups) than in controls. No significant differences in the levels of triglycerides were found between groups. T2D patients exhibited higher levels of C-reactive protein (CRP, p < 0.001 for both groups) than control subjects.

Table 1.

Anthropometric and Metabolic Characteristics of the Population

	Control	T2D without metformin	T2D with metformin	p	BMI-adjusted p-value
n	40	31	41
Male%	42.5	54.8	53.7	ns
Age (years)	55.9 ± 6.6	58.3 ± 9.6	54.6 ± 5.3	ns
Weight (kg)	73.5 ± 20.0	83.1 ± 15.8^*	92.0 ± 18.08^***	<0.001
BMI (kg/m²)	26.3 ± 5.1	31.0 ± 5.1^**	33.4 ± 5.7^***	<0.001
Waist circumference (cm)	85.9 ± 14.8	102.9 ± 13.6^***	110.6 ± 13.3^***,#	<0.001
SBP (mmHg)	125.0 ± 22.5	138.1 ± 12.0^*	134.1 ± 15.4^*	<0.05	ns
DBP (mmHg)	76.1 ± 11.4	82.9 ± 11.4	80.8 ± 8.5	ns	ns
Glucose (mg/dl)	94.3 ± 11.0	134.9 ± 51.8^***	136.8 ± 45.7^***	<0.001	<0.001
Insulin (μUI/ml)	8.1 ± 4.2	11.7 ± 3.4^*	14.3 ± 6.2^***	<0.001	<0.001
HOMA-IR	1.94 ± 1.2	3.71 ± 2.2^*	4.86 ± 2.4^***	<0.001	<0.001
HbA1c (%)	5.40 ± 0.4	6.83 ± 1.0^***	6.81 ± 1.4^***	<0.001	<0.001
Total cholesterol (mg/dl)	207.3 ± 35.6	171.3 ± 34.8^***	172.9 ± 34.4^***	<0.001	<0.001
HDL-c (mg/dl)	58.4 ± 21.3	45.5 ± 12.4^***	43.1 ± 9.6^***	<0.001	<0.05
LDL-c (mg/dl)	128.5 ± 28.6	101.8 ± 33.6^***	98.4 ± 28.1^***	<0.001	<0.001
Triglycerides (mg/dl)	104.0 (64.0–158.0)	108.0 (68.0–160.0)	133.9 (93.5–185.5)	ns	ns
hs-CRP (mg/l)	0.75 (0.36–1.58)	2.98 (1.97–6.72)^***	3.17 (1.72–6.92)^***	<0.001	ns
Treatment (%)
Statins		48.4	56.1	ns
Fibrate		12.9	14.6	ns
Ezetimibe		6.5	0	ns
DPP-4 inhibitors		25.8	39.0	ns
Glitazones		0	4.9	ns
Glinides		3.2	9.8	ns
GLP-1 agonists		9.7	17.1	ns

Values are expressed as mean ± standard deviation for parametric data, and median (25th–75th percentiles). For parametric data, comparisons between groups were made with one-way ANOVA followed by a Newman-Keuls multiple-comparison post hoc test; nonparametric data were compared by Kruskal-Wallis test followed by Dunn's test. Proportions between groups were compared by the chi-square test. Analysis of covariance was performed with a univariate general linear model by using BMI as a covariate. ^* p < 0.05, ^** p < 0.01, and ^*** p < 0.001 with respect to control; ^# p < 0.05 with respect to non-metformin-treated T2D.

ANOVA, analysis of variance; BMI, body mass index; DBP, diastolic blood pressure; DPP-4, dipeptidyl peptidase 4; GLP-1, glucagon-like peptide; HbA1c, glycated hemoglobin; HDL-c, high-density lipoprotein cholesterol; HOMA-IR, homeostasis model assessment of insulin resistance; hs-CRP, high-sensitive C-reactive protein; LDL-c, low-density lipoprotein cholesterol; SBP, systolic blood pressure; T2D, type 2 diabetes.

As T2D patients had a higher BMI than controls, the data were adjusted for BMI. Nevertheless, the differences between groups remained, with the exception of those of SBP and CRP, which were no longer significant.

Oxidative stress

Total and mitochondrial ROS production, as well as the mRNA expression levels of the antioxidant enzymes superoxide dismutase 1 (sod1), catalase (cat), glutathione peroxidase 1 (gpx1), and sirtuin 3 (sirt3) were measured to assess oxidative stress in the leukocytes of the studied subjects, and these are shown in Figure 1. Both metformin- and non-metformin-treated T2D patients showed higher levels of total ROS than control subjects (p < 0.05, Fig. 1A). In addition, an increase in mitochondrial ROS production was observed in both groups of T2D patients (p < 0.001 in non-metformin-treated group, and p < 0.05 in metformin-treated group, Fig. 1B) with respect to controls; however, patients treated with metformin presented statistically significant lower levels of mitochondrial ROS than those not treated with the drug (p < 0.001, Fig. 1B). Regarding antioxidant enzymes, the expression of gpx1 and sirt3 was reduced in non-metformin-treated T2D patients with respect to control subjects (p < 0.05 and p < 0.001, respectively, Fig. 1E, F); interestingly, those metformin-treated T2D patients presented significantly higher expression levels of both antioxidant enzymes when compared with the metformin-treated group (p < 0.01). No significant differences were found in the expression of sod1 and cat between T2D patients and the control group (Fig. 1C, D).

FIG. 1.

Evaluation of oxidative stress (ROS production and mRNA expression of antioxidant enzymes) in T2D patients with and without metformin treatment and healthy control subjects. n = 15 samples per group. (A) Total ROS production measured as arbitrary units of DCFH fluorescence. (B) Mitochondrial ROS production measured as arbitrary units of Mitosox Red fluorescence. Relative mRNA expression of (C) sod1, (D) cat, (E) gpx1, and (F) sirt3. *p < 0.05 and ***p < 0.001 with respect to control; ^## p < 0.01 and ^### p < 0.001 with respect to non-metformin-treated T2D, by using one-way ANOVA with a Student-Newman-Keuls multiple-comparison post hoc test. ANOVA, analysis of variance; cat, catalase; DCFH, dichlorodihydrofluorescein; gpx1, glutathione peroxidase 1; ROS, reactive oxygen species; sirt3, sirtuin 3; sod1, superoxide dismutase 1; T2D, type 2 diabetes.

Leukocyte-endothelium interactions

Non-metformin-treated T2D patients displayed reduced levels of leukocyte rolling velocity (p < 0.001, Fig. 2A) and enhanced levels of leukocyte rolling flux and adhesion (p < 0.001, Fig. 2B, C, respectively) with respect to control subjects. Interestingly, leukocyte rolling velocity was increased (p < 0.05, Fig. 2A) and rolling flux (p < 0.001) and adhesion (p < 0.01) decreased in metformin-treated patients with respect to non-metformin-treated subjects.

FIG. 2.

Assessment of leukocyte-endothelium interactions in T2D patients with and without metformin treatment and healthy control subjects. n = 25 subjects per group. (A) Leukocyte rolling velocity expressed as μm/s. (B) Leukocyte rolling flux measured as cells/min. (C) Leukocyte adhesion expressed as cells/mm². ***p < 0.001 with respect to control; ^# p < 0.05, ^## p < 0.01, and ^### p < 0.001 with respect to non-metformin-treated T2D, by using one-way ANOVA with a Student-Newman-Keuls multiple-comparison post hoc test.

Adhesion molecules

The adhesion molecules ICAM-1, VCAM-1, and P-Selectin were measured to determine a possible mechanism by which metformin treatment reduces leukocyte-endothelium interactions (Fig. 3). Non-metformin-treated T2D patients showed a peak in the levels of ICAM-1 (p < 0.01, Fig. 3A) and P-Selectin (p < 0.05, Fig. 3C) when compared with controls. Metformin reduced ICAM-1 levels (Fig. 3A, p < 0.05), and a downward trend was observed in the levels of P-selectin (Fig. 3C, p = 0.08) in metformin-treated patients with respect to those not receiving the drug. No significant differences were found in serum levels of VCAM-1 among the three study groups (Fig. 3B).

FIG. 3.

Evaluation of soluble adhesion molecules in the serum of T2D patients with and without metformin treatment and healthy control subjects. n = 30 samples per group. (A) ICAM-1 levels, (B) VCAM-1 levels, and (C) P-Selectin levels expressed as ng/ml. *p < 0.05 and **p < 0.01 with respect to control; ^# p < 0.05 with respect to non-metformin-treated T2D, by using one-way ANOVA with a Student-Newman-Keuls multiple-comparison post hoc test. ICAM-1, intercellular adhesion molecule 1; VCAM-1, vascular cell adhesion molecule-1.

Discussion

The present study has evaluated the effects of metformin treatment on total ROS production, mitochondrial ROS, mRNA expression levels of sod1, cat, gpx1, and sirt3, leukocyte-endothelium interactions, and adhesion molecules in T2D patients. Metformin- and non-metformin-treated T2D patients showed similar glycemic status, as manifested by HbA1c levels.

We show that metformin-treated T2D patients exhibit a decrease in mitochondrial ROS production, an increase in mRNA expression levels of gpx1 and sirt3, and reduced leukocyte-endothelium interactions (reduced leukocyte rolling flux and adhesion, and increased leukocyte rolling velocity), and serum levels of ICAM-1 and P-selectin with respect to non-metformin-treated T2D patients.

T2D is related to different cardiovascular risk factors, such as excess weight and/or obesity, hypertension, hyperglycemia, IR, and dyslipidemia. Metformin has been shown to have beneficial effects by decreasing the progression of T2D in patients with impaired glucose tolerance. This drug has also demonstrated beneficial effects on lipoprotein subfractions by decreasing LDL and reducing the risk of atherogenesis (2). Nevertheless, little is known about the effect of metformin treatment on leukocyte oxidative stress, as well as on the leukocyte-endothelium interactions and adhesion molecule expression in T2D patients.

The atherosclerotic process and oxidative stress are related to leukocyte recruitment to the arterial wall, processes that contribute to the development of vascular diseases. In this line, the aim of the present study was to assess the possible beneficial effects of metformin treatment on the initial steps of the atherosclerotic process in T2D patients by using a model that allows leukocyte-endothelium interactions to be evaluated. This model reproduces the leukocyte rolling and adhesion processes that take place during the in vivo inflammatory focus generation. It has been widely employed to study the different steps implicated in interactions between leukocytes and the endothelium, as it allows possible alterations to be detected and potential mechanisms of action to be identified (4).

Our metformin-treated T2D patients showed an improved subclinical atherosclerotic marker profile with respect to patients not treated with metformin, as seen by a significant decrease of oxidative stress (reduced mitochondrial ROS levels, probably as a consequence of increased expression of antioxidant enzymes gpx1 and sirt3), leukocyte-endothelium interactions, and ICAM-1 serum levels, which, in turn, might prevent the development of an atherogenic process. Furthermore, the adhesion molecule P-selectin, which was increased in the patients not treated with metformin, was also slightly reduced (p = 0.08) in the metformin-treated group.

Our results are in accordance with previous studies showing that metformin exerts antioxidant effects by decreasing ROS from different sources, including NAD(P)H oxidase and mitochondria (6). Understanding the mechanisms by which metformin decreases mitochondrial ROS levels is important as ROS are implicated in the pathogenesis of atherosclerotic vascular disease. Our study demonstrates that metformin might exert its beneficial antioxidant mechanisms by modulating the expression of gpx1 and sirt3, but not cat or sod1. SIRT3 is an NAD⁺-dependent deacetylase specifically located in the mitochondria that, when overexpressed, reduces ROS production in several tissues. For this reason, we postulate that metformin might enhance the mRNA expression of sirt3, leading to a reduction of mitochondrial ROS production. At the same time, this drug might also increase the expression of the cytoplasmatic selenoprotein gpx1, thus protecting leukocytes against oxidative stress by a reduction of hydroperoxides.

Metformin has been postulated to contribute to endothelial protection in a way that is mediated by improved endothelium-dependent vascular responses (5). This drug has been shown to reduce/reverse the impact of hyperglycemia on endothelial function in aortic tissue and microvascular endothelial cells by increasing phosphorylation of eNOS and Akt. At the molecular level, a recent study concluded that metformin exerts its cardiovascular protective effect by reducing the activity of poly (ADP-ribose) polymerase 1 (PARP1) via the AMP-activated protein kinase (AMPK)-PARP1 cascade (9). All these findings suggest that metformin has beneficial effects by impeding the atherosclerotic process and, consequently, cardiovascular events.

Soluble adhesion molecules, such as E-selectin, VCAM-1, and ICAM-1, are expressed by endothelial cells and leukocytes in response to inflammation. These molecules are key markers of endothelial activation, as they participate directly in the recruitment of leukocytes to the site of inflammation. In fact, impairment of endothelial activation is related to increased susceptibility to infection and, therefore, morbidity. Several studies have described increased levels of adhesion molecules and proinflammatory cytokines in T2D patients (4, 8). Our data confirm that both P-selectin and ICAM-1 expression levels are upregulated in T2D populations, thus implying an etiological role of endothelial dysfunction in the pathogenesis of T2D. Interestingly, we have observed that metformin-treated T2D patients present decreased levels of ICAM-1 and slightly declined P-selectin levels (p = 0.08) with respect to non-metformin-treated T2D subjects, which are in accordance with a reduction in leukocyte-endothelium interactions in the metformin-treated group. In fact, it has been reported that metformin inhibits the activation of NF-κB in human umbilical vein endothelial cell (HUVEC) exposed to inflammatory cytokines, thus reducing the expression of genes that encode adhesion and proinflammatory molecules (3).

In conclusion, our data support the beneficial effects of metformin on oxidative stress, endothelial function, and leukocyte-endothelium interactions, which suggest that they might prevent the vascular damage and development of an atherogenic process in T2D. Future studies should evaluate whether treatment with insulin sensitizers, such as metformin, can improve cardiovascular function in T2D.

Notes

Subjects of the study and sample collection

The present work is an observational study of 72 T2D patients recruited at the Endocrinology and Nutrition Department of the University Hospital Doctor Peset (Valencia, Spain) and 40 healthy volunteers. In the diabetic group, 41 patients were taking metformin as their main antidiabetic treatment (at a dose of 1700 mg for at least 12 months) and 31 patients were not taking metformin. All subjects were informed before signing a written consent form, and the protocols followed were approved by the Ethics Committee of the University Hospital Doctor Peset and conducted in accordance with the Helsinki Declaration. T2D was diagnosed by following the American Diabetes Association's criteria (fasting glycemia ≥126 mg/dl on at least two occasions, or glycemia 2 h after 75 g glucose oral load of ≥200 mg/dl, or HbA1c ≥6.5%). Subjects with any of the following conditions were excluded from the study: autoimmune disease; history of cardiovascular disease (including ischemic heart disease, peripheral vascular disease, stroke, and chronic disease related to cardiovascular risk); presence of morbid obesity; or infectious, hematological, malignant, organic, or inflammatory disease and insulin treatment.

Blood samples were taken in fasting conditions during a routine blood extraction and anthropometric parameters—weight (kg), height (m), waist circumference (cm), and SBP and DBP (mmHg)—were measured.

Biochemical parameters and adhesion molecules

Blood was extracted from the antecubital vein in serum separator tubes and centrifuged at 1500 g for 10 min at 4°C. Serum was collected and analyzed for glucose, total cholesterol, and triglyceride levels by using an enzymatic method. A Beckman LX20 analyzer (Beckman Corp., CA) was employed to quantify HDL-c levels, and Friedewald's formula was used to calculate LDL-c content. Insulin levels were obtained by an immunochemiluminescence assay (Abbott, IL), and HOMA-IR index [fasting insulin (μU/ml) × fasting glucose (mg/dl)/405] was calculated to estimate IR. An automatic glycohemoglobin analyzer (Arkray, Inc., Kyoto, Japan) and an immunonephelometric assay were used to determine the percentage of glycated hemoglobin (HbA1c) and the levels of high-sensitive C-reactive protein, respectively. ICAM-1, VCAM-1, and P-Selectin adhesion molecules were measured with XMAP technology by using a Luminex 200 flow analyzer device (Austin, TX).

Leukocyte isolation

Blood samples collected in heparinized tubes were incubated with 1:2 volumes of dextran solution (3% in NaCl 0.9%) (Sigma Aldrich, MO) for 45 min. The supernatant was carefully placed over Ficoll-Hypaque (GE Healthcare, Uppsala, Sweden) and then centrifuged at 650 g for 25 min. Pellets containing leukocytes were incubated with lysis buffer for 5 min to lyse remaining red blood cells and were then centrifuged at 240 g. After discarding supernatants, leukocytes were washed, resuspended in HBSS buffer (Sigma Aldrich, MO), and counted.

ROS production

Isolated leukocytes were incubated with 5 μM 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) and MitoSOX fluorescent probes (Thermo Fisher Scientific, MA) for 30 min to measure total ROS and mitochondrial superoxide production, respectively, by using a fluorescence microscope (IX81; Olympus, Hamburg, Germany) coupled with the static cytometry software “ScanR” (Olympus, Hamburg, Germany). Nuclei were stained with Hoechst 33342 (Sigma Aldrich, MO), and results were expressed as % of the control.

mRNA expression levels

The GeneAll^® Ribospin™ Total RNA extraction kit (Geneall Biotechnology, Hilden, Germany) was used to obtain total RNA from leukocytes by following the manufacturer's instructions. The amount and purity of RNA was assessed by using a NanoDrop 200c spectrophotometer (Thermo Fisher Scientific, Waltham, MA). One microgram of RNA was reverse transcribed into cDNA by using RevertAid first-strand cDNA synthesis kit (Thermo Scientific, Waltham, MA). RT-qPCRs using 1 μl of cDNA and the KAPA SYBR FAST universal master mix (KAPA Biosystems, MA) were performed in a 7500 Fast RT-PCR system (Life Technologies, Thermo Fisher Scientific, Waltham, MA). Primer sequences and protocol details are described in Table 2. Relative quantification was performed according to the comparative 2^−ΔΔCt method by using Expression Suite software (Thermo Fisher Scientific, Waltham, MA).

Table 2.

Sequences of the Primers Used and Details of the RT-PCR Protocol

Target	Direction	Sequence (5′–3′)
Primers
sod1	Forward	GGTGTGGCCGATGTGTCTAT
	Reverse	TTCCACCTTTGCCCAAGTCA
cat	Forward	CTTCGACCCAAGCAACATGC
	Reverse	CGGTGAGTGTCAGGATAGGC
gpx1	Forward	TTGAGAAGTTCCTGGTGGGC
	Reverse	CGATGTCAGGCTCGATGTCA
sirt3	Forward	CGGCTCTACACGCAGAACATC
	Reverse	CAGCGGCTCCCCAAAGAACAC
GAPDH	Forward	CGCATCTTCTTTTGCGTCG
	Reverse	TTGAGGTCAATGAAGGGGTCA
Protocol
Temperature	95°C	95°C	60°C	Melting curve
Time	10 min	10 s	30 s
Number of cycles	1	40

Leukocyte-endothelium interaction assays

HUVECs were obtained from fresh umbilical cords by treating the veins with collagenase (1 mg/ml in phosphate-buffered saline; Thermo Fisher Scientific, MA) for 17 min. HUVEC primary cultures were grown over fibronectin-coated plastic coverslips (Sigma Aldrich, MO) and incubated with complete EMB-2 culture medium (Lonza, Basel, Switzerland). Once a confluent monolayer had been obtained, the cultures were placed in a flow chamber (Glycotech, MD) so that an area of 5 × 25 mm was exposed. The flow chamber was mounted on an inverted microscope (Nikon Eclipse TE 2000-S), and leukocyte suspensions (10⁶ cells/ml) were drawn across the HUVEC monolayer (0.36 ml/min) whereas real-time microscope recordings were performed during 5-min periods. The videos were then analyzed and leukocyte rolling velocity, rolling flux, and adhesion were calculated as previously described (4). We used Tumor Necrosis Factor-α (TNFα 10 ng/ml, 4 h; Sigma Aldrich, MO) as a positive control for HUVEC and platelet-activating factor (1 μM, 1 h; Sigma Aldrich, MO) as a positive control for leukocytes.

Data analysis

The statistics software SPSS 17.0 was employed for data analysis. Values shown in the table are mean ± standard deviation for parametric data, and median (25th–75th percentiles) for non-parametric data; whereas the bars in the figures are mean ± standard error of the mean. Comparisons between the three study groups for parametric data were made with one-way analysis of variance (ANOVA) followed by a Newman-Keuls multiple-comparison post hoc test, and with Kruskal-Wallis test followed by Dunn's test for nonparametric data. Proportions between groups were compared by the chi-square test. The potential influence of BMI on the parameters shown in the table was minimized by an analysis of covariance. Changes in blood pressure, serum lipid, and biochemical parameters were analyzed with an univariate general linear model using BMI as a covariate. Significant differences were considered when p < 0.05.

Footnotes

Acknowledgments

The authors thank Brian Normanly (University of Valencia-CIBERehd) for his editorial assistance; and Rosa Falcon and Carmen Ramirez (FISABIO) for their technical assistance. This study was financed by grants PI15/1424, PI16/1083, PI16/0301, and CIBERehd CB06/04/0071 by Carlos III Health Institute and by the European Regional Development Fund (ERDF “A way to build Europe”); UGP15-193 and UGP15-220 by FISABIO; and GV/2016/169 and PROMETEO 2014/035 by the Department of Education of the Valencian Regional Government. N.D.-M. and S.L.-D. are recipients of PFIS contracts from Carlos III Health Institute (FI14/00125 and FI14/00350, respectively). S.R.-L. is recipient of a Juan de la Cierva-Formación contract from the Spanish Ministry of Economy and Competitiveness (FJCI-2015-25040). C.B. is recipient of a Sara Borrell contract from Carlos III Health Institute (CD14/00043). I.E.-L. is recipient of a predoctoral contract from FISABIO (UGP-15-144). V.M.V. and M.R. are recipients of contracts from the Ministry of Health of the Valencian Regional Government and Carlos III Health Institute (CES10/030 and CPII16/00037, respectively).

Author Disclosure Statement

No competing financial interests exist.

Abbreviation Used

References

Diaz-Morales

, Rovira-Llopis

, Banuls

, Escribano-Lopez

, de Maranon

, Lopez-Domenech

, et al. Are mitochondrial fusion and fission impaired in leukocytes of type 2 diabetic patients?. Antioxid Redox Signal, 25: 108–115, 2016.

Goldberg

, Temprosa

, Otvos

, Brunzell

, Marcovina

, Mather

, et al. Lifestyle and metformin treatment favorably influence lipoprotein subfraction distribution in the Diabetes Prevention Program. J Clin Endocrinol Metab, 98: 3989–3998, 2013.

Hattori

, Suzuki

, Hattori

, and Kasai

. Metformin inhibits cytokine-induced nuclear factor kappaB activation via AMP-activated protein kinase activation in vascular endothelial cells. Hypertension, 47: 1183–1188, 2006.

Hernandez-Mijares

, Rocha

, Rovira-Llopis

, Banuls

, Bellod

, de Pablo

, et al. Human leukocyte/endothelial cell interactions and mitochondrial dysfunction in type 2 diabetic patients and their association with silent myocardial ischemia. Diabetes Care, 36: 1695–1702, 2013.

Mather

, Verma

, and Anderson

. Improved endothelial function with metformin in type 2 diabetes mellitus. J Am Coll Cardiol, 37: 1344–1350, 2001.

Ouslimani

, Peynet

, Bonnefont-Rousselot

, Therond

, Legrand

, and Beaudeux

. Metformin decreases intracellular production of reactive oxygen species in aortic endothelial cells. Metabolism, 54: 829–834, 2005.

Pavlovic

, Kocic

, Jevtovic

, Radenkovic

, Mikic

, et al. Effect of four-week metformin treatment on plasma and erythrocyte antioxidative defense enzymes in newly diagnosed obese patients with type 2 diabetes. Diabetes Obes Metab, 2: 251–256, 2000.

Rovira-Llopis

, Rocha

, Falcon

, de Pablo

, Alvarez

, Jover

, et al. Is myeloperoxidase a key component in the ROS-induced vascular damage related to nephropathy in type 2 diabetes?. Antioxid Redox Signal, 19: 1452–1458, 2013.

Shang

, Zhang

, Li

, Zhang

, Yin

, Wang

, et al. Cardiovascular protective effect of metformin and telmisartan: reduction of PARP1 activity via the AMPK-PARP1 cascade. PLoS One, 11: e0151845, 2016.