Sheep Isolated Secondary Follicles Are Able to Produce Metaphase II Oocytes After Vitrification and Long-Term In Vitro Growth

Abstract

The vitrification of preantral follicles followed by in vitro growth (IVG) could be valuable to produce fertilizable oocytes. However, the meiotic resumption rates of oocytes cultured from vitrified secondary follicles (SF) have been reported as suboptimal. This study aimed to verify two base media (alpha modification of minimum essential medium, α-MEM, and tissue culture medium 199, TCM199) on vitrified SF regarding different requirements during IVG. Sheep ovarian fragments were divided in six groups: (1) Fresh groups (Control α-MEM and TCM199): SF without vitrification; (2) Follicle-Vitrified (Follicle-Vit α-MEM and TCM199): SF vitrified after isolation; and (3) Tissue-Vitrified (Tissue-Vit α-MEM and TCM199): SF vitrified enclosed in ovarian fragments and, subsequently, isolated. The isolated SF were submitted to IVG for 18 days. Thereafter, the recovered cumulus–oocyte complexes (COCs) underwent in vitro maturation (IVM) and evaluation of chromatin configuration. Follicular granulosa cells were analyzed for their gene expression of Bax, Bcl2, and Connexins (CX) 37 and 43. COCs from in vivo antral follicles were used as in vivo control. Data were analyzed by analysis of variance, Tukey, and chi-square tests. Differences were considered significant if p-value is <0.05. Follicle-Vit groups had higher (p < 0.05) percentage of antrum formation compared with Tissue-Vit groups. Vitrification did not affect (p > 0.05) oocyte diameter postmaturation. Oocytes from Follicle-Vit in α-MEM reached metaphase II stage after IVM. Gene expression for CX37, CX43, and Bax was lower in Tissue-Vit groups. For Bcl2, the gene expression was the opposite. In conclusion, during IVG for 18 days, maximal oocyte meiotic resumption was not negatively impacted by vitrification and was greatest for isolated SF using α-MEM as a medium.

Introduction

Cryopreservation of preantral follicles enclosed in the ovarian cortex is practiced for preserving the reproductive potential of young women facing cancer treatment.¹ After cancer remission, treated women can get their cryopreserved ovarian tissue grafted back and restore their reproductive and endocrine competences.² However, in some types of cancer such as leukemia, neuroblastoma, or metastasis, the transplantation of ovarian tissue could reintroduce cancerous cells to the patient.³ Optionally, the in vitro growth (IVG) of isolated preantral follicles followed by oocyte maturation represents a good and safe alternative to avoid the reintroduction of cancer cells. The normally matured oocytes could be fertilized and the embryos could be transferred to realize the motherhood dream of cancer survivors.

A previous study reported the in vitro production of murine embryos⁴ from preantral follicles (primordial) cultured in vitro. Later, the embryo production from developing preantral follicles was also developed in goat⁵ and sheep models.⁶ Nonetheless, these results were obtained with fresh preantral follicles.

Rodent embryos were produced in vitro from vitrified and cultured secondary follicles (SF).⁷ To our knowledge there are no reports of embryo production from cryopreserved follicles in domestic species. Recently, studies demonstrated that sheep ovarian follicles isolated from ovarian cortex, vitrified, and cultured are able to resume meiosis after in vitro maturation (IVM). However, only 9.09% of these oocytes achieved the metaphase I stage, which is a very low efficiency.⁸

The most relevant studies concerning sheep IVG of noncryopreserved follicles have used two basic culture media in general: alpha modification of minimum essential medium (α-MEM)^9,10 and tissue culture medium 199 (TCM199).⁶ Both media have differences in composition regarding the quality and quantity of inorganic salts, amino acids, vitamins, and energetic sources.¹¹ Therefore, based on previous studies,¹² we hypothesized that vitrified follicles could have different requirements for IVG and development than fresh follicles. Moreover, vitrified follicles are more susceptible to the atresia process during IVG.¹³ To the best of our knowledge, no study has evaluated the effect of base medium on fresh or vitrified ovine follicles during IVG.

Therefore, the objective of this study was to compare the efficiency of different culture media (α-MEM and TCM199) on the IVG of SF that had been previously vitrified, either enclosed in ovarian tissue or after their isolation as SF. Thus, several parameters were evaluated such as follicular growth, survival, and antrum formation after 18 days of IVC. The oocyte viability and maturation rates were evaluated as well. Furthermore, the integrity of the connections between cumulus cells and oocyte was evaluated by gene expression of CX 37 and 43. In addition, the expression of genes associated with apoptosis or atresia (Bax and Bcl2) was evaluated in granulosa cells after completion of IVG.

Materials and Methods

Source of ovaries

Ovaries (n = 90) were collected at abattoirs from 45 adult mixed-breed ewes (Ovis ares). Immediately post-mortem and, under aseptic conditions, the ovaries were washed in 70% alcohol for 10 seconds, followed by two washes in 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid, N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES) buffered MEM supplemented with 100 μg/mL penicillin and 100 μg/mL streptomycin. Each pair of ovaries was transported to the laboratory in tubes containing 15 mL of MEM at 4°C within 4 hours. The chemicals used in the present study were purchased from Sigma Chemical Co. (St. Louis, MO) unless otherwise mentioned.

Experimental design

In the laboratory ovaries were stripped from surrounding fat and fibrous tissue; the cortex portions were recovered and fragmented into small pieces (1 to 2 mm thick) and equally divided over three different conditions: (1) Nonvitrified fragments: fresh SF were isolated (Control); (2) Follicle-Vitrification (Follicle-Vit): SF were isolated and then vitrified; and (3) Tissue-Vitrification (Tissue-Vit): SF were vitrified enclosed on ovarian fragments (in situ form) and isolated subsequently after warming.⁸ From all three conditions the isolated SF were submitted to IVG for 18 days in two different culture base media: α-MEM or TCM199 corresponding to six treatments: Control α-MEM, Control TCM199, Follicle-Vit α-MEM, Follicle-Vit TCM199, Tissue-Vit α-MEM, and Tissue-Vit TCM199 (Fig. 1).

FIG. 1.

Experimental design for vitrification and in vitro culture of sheep secondary follicles. IVC, in vitro culture; IVM, in vitro maturation; SF, secondary follicles; α-MEM, alpha modification of minimum essential medium; TCM199, tissue culture medium 199.

The percentage of morphologically normal follicles, antral cavity formation, follicle diameter, and daily growth rate was measured during the IVG. After the culture period of 18 days the cumulus–oocyte complexes (COCs) were recovered from cultured follicles and submitted to IVM. The viability and chromatin configuration of the matured oocytes were also evaluated. Furthermore, granulosa cells were randomly assigned to real-time polymerase chain reaction (qPCR) analysis to evaluate the relative expression of CX 37, 43, Bax, and Bcl2 after 18 days of IVG from Fresh, Follicle-Vit, and Tissue-Vit groups in both base media (α-MEM or TCM199).

Ovarian cortex fragmentation and follicle isolation

The ovarian cortex was sectioned into small pieces of 1 to 2 mm thickness under sterile conditions in a Petri-dish containing α-MEM supplemented with HEPES and antibiotics (100 μg/mL penicillin and 100 μg/mL streptomycin). The ovarian fragments were transferred to a Petri-dish containing fresh medium and then visualized under a stereomicroscope (100x; Nikon SMZ 645, Tokyo, Japan). Once located, SF with average diameter of 340 μm (range 160–430 μm) were mechanically isolated by microdissection with the aid of a 26G needle attached to 1 mL syringe. Only follicles with a visible oocyte–follicle complex, surrounded by several layers of granulosa cells with intact basement membrane and no antral cavities, were selected for this study.

Vitrification procedure

The vitrification solution previously defined¹⁴ was used with some amendments as: MEM supplemented with 10% fetal bovine serum (FBS), 2.60 M acetamide, 2.62 M dimethylsulfoxide, 1.31 M 1,2-propanediol, and 0.0075 M polyethylene glycol. Initially, ovarian fragments (1 to 2 mm thick) and isolated SF were exposed to different concentrations (12.5%, 25%, 50%, and 100%) of vitrification solution. Samples were exposed to the first two concentrations for 5 minutes at room temperature. Then, the fragments were exposed to the higher concentrations 15 minutes (fragments) or 5 minutes (isolated follicles) at 4°C. Following this step, samples (either ovarian fragments or isolated follicles) were placed on the surface of a metal cube partially submerged in liquid nitrogen and transferred to cryovials (10 follicles or 10 fragments each). Samples were kept in liquid nitrogen (−196°C) for 6 days.

Warming protocol

Cryovials containing samples of ovarian tissue and isolated SF were removed from liquid nitrogen and exposed to room temperature for 1 minute and immersed in a water bath (37°C) for 30 seconds. Soon after, the removal of cryoprotectants was performed by immersion of ovarian fragments or SF in washing solutions composed of three baths of 5 minutes each with the solution of MEM plus 10% FBS and decreasing concentrations of sucrose (0.5, 0.25, and 0.0 M) in accordance with the protocol adapted.¹⁵

IVG of sheep SF

The SF were transferred into drops of 100 μL of culture medium under mineral oil in Petri-dishes (60 × 15 mm) and cultured for 18 days (1 follicle/drop) at 39°C and 5% carbon dioxide (CO₂) in air. Culture medium contained α-MEM or TCM199, both supplemented with 10 μg/mL insulin, 5.5 μg/mL transferrin, 5 ng/mL selenium, 2 mM glutamine, 2 mM hypoxanthine, 3 mg/mL bovine serum albumin (BSA), 50 μg/mL ascorbic acid, 50 ng/mL leukemia inhibitory factor (LIF), 50 ng/mL Kit Ligand, and 100 ng/mL follicle-stimulating hormone (FSH).

Morphological analysis and assessment of in vitro follicular growth

Before (day 0) and after 6, 12, and 18 days of IVG, the percentage of morphologically normal follicles and follicular diameters from Control, Follicle-Vit, and Tissue-Vit was determined. Follicles were classified as morphologically normal if they presented an intact basement membrane with no extrusion of the COCs from the follicle and containing bright and homogeneous granulosa and theca cells. Follicles were considered degenerated when the basement membrane ruptured, when oocytes and surrounding cells darkened, or presence of misshapen oocytes or decreased follicle diameter was observed. Follicular diameter was measured at the basement membrane (from the major and minor axes) of each follicle with the aid of an ocular micrometer inserted into a stereomicroscope (100x; Nikon SMZ 645). The average of these two measurements was used to determine the follicle diameter only in morphologically normal follicles. The daily mean increases in the follicular diameter (follicular growth rate) were calculated as the diameter of morphologically normal follicles at day 18 minus the diameter of the same follicle at day 0, divided by the total number of days in culture. Antral cavity formation was defined as a visible translucent cavity within the granulosa cell layers.

IVM of COCs obtained from the cultured and in vivo grown Graafian follicles

At the end of the culture period, the COCs obtained from IVG were carefully harvested from intact follicles using 26G needles under a stereomicroscope. For a better comparison with the IVG groups, an in vivo-grown group was done for standard comparison. Therefore, in vivo-grown COCs were collected from antral ovarian follicles (oocyte diameter 99.19 μm ± 46.00) and only oocytes surrounded by at least one compact layer of cumulus cells were selected for IVM. The recovery rate of in vitro grown COCs was calculated by dividing the number of COCs by the number of viable follicles at day 18 of culture multiplied by 100. The selected COCs were washed in medium composed by TCM199 + HEPES (TCM199H) supplemented with pyruvate (0.911 mM/L) and 10% FBS followed by IVM medium. The maturation medium was composed by TCM199 + sodium bicarbonate (TCM199B) supplemented with 0.5 μg/mL recombinant bovine FSH (NANOCORE, São Paulo, Brazil), 5 μg/mL luteinizing hormone, 1 μg/mL 17β-estradiol, 10 ng/mL recombinant epidermal growth factor, 0.911 mM/L pyruvate, 100 μM/L cysteamine, 50 ng/mL recombinant insulin-like growth factor I, and 1% BSA. After washing, COCs were transferred to 50 μL drops of maturation medium under mineral oil and then incubated for 36–40 hours at 39°C with 5% CO₂.¹⁰

Assessment of oocyte viability and chromatin configuration

After IVM, the COCs were denuded from surrounding expanded cumulus cells by manual pipetting in TCM199 HEPES containing 0.1% hyaluronidase and subjected to viability analysis. To this end, the oocytes were incubated in 100 μL drops of 2 μM ethidium homodimer-1 supplemented with 4 μM calcein-AM, 0.5% glutaraldehyde, and 10 μM Hoechst 33342 at room temperature for 30 minutes. Then the oocytes were washed in phosphate-buffered saline and were visualized under fluorescence microscopy (40x; Nikon Eclipse 80i, Tokyo, Japan). Oocytes were considered viable if the cytoplasm was positively stained with calcein-AM (green) and not stained with ethidium homodimer-1 (red). The emitted fluorescent signals of calcein-AM and ethidium homodimer-1 were collected at 488 and 568 nm, respectively. In addition, oocytes were stained with Hoechst 33342 (Molecular Probes, Invitrogen, Karlsruhe, Germany) and then analyzed for chromatin configuration being emitted from fluorescent signals at 483 nm. This dye was used to analyze the oocyte's chromatin configuration through observation of the intact germinal vesicle, meiotic resumption (including germinal vesicle breakdown, GVBD; metaphase I, MI; anaphase I, AI; or telophase I, TI), or nuclear maturation (metaphase II, MII). GVBD is defined by visible condensation of chromosomes and a dissolved nuclear membrane, whereas MI is defined as formation of the initial spindle fiber, with the sister chromatids lined up at the middle of the cell, as previously described.^16,17

Relative expression of CX 37, 43, Bax, and Bcl2 after IVG of preantral follicles

For this procedure, mural cells (granulosa and theca cells) were used, which were recovered after oocyte release (remaining structure) from intact follicles using 26G needles under a stereomicroscope, according to a previous report.¹⁸ Mural cells were collected from a total of 180 isolated SF (3 pools of 10 normal follicles from each treatment) from the following six treatments: (1) Control α-MEM, (2) Control TCM199, (3) Follicle-Vit α-MEM, (4) Follicle-Vit TCM199, (5) Tissue-Vit α-MEM, and (6) Tissue-Vit TCM199. For RNA isolation, mural cells¹⁹ were collected from each experimental treatment at 18 days of culture and stored in microcentrifuge tubes (1.5 mL) with TRIzol, at −80°C until RNA extraction. Total RNA was isolated with the TRIzol Plus Purification Kit (Invitrogen, São Paulo, Brazil). The RNA preparations were treated with DNAse I and subjected to the RNeasy Micro Kit (Invitrogen, Life Technologies, United States). All RNA samples were subjected to DNase I treatment with a PureLink DNase (Invitrogen, United States). RNA quality and concentration were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, United States). One unit of absorbance at 260 nm corresponded to 40 μg/mL RNA.

Reverse transcription PCR

For reverse transcription, complementary DNA (cDNA) was synthesized using 1 mg of RNA with SuperScript III Reverse Transcriptase (Invitrogen, Life Technologies). Polymerase chain reactions were conducted in two steps. First, 1 mg of RNA, 50 ng/mL of random hexamer primers, 10-mM dNTP mix, and diethyl pyrocarbonate-treated water (for a total volume of 13 mL) were heated to 65°C for 5 minutes and then immediately placed on ice for at least 1 minute. Second, 200 UI of SuperScript III RT, 10X RT buffer, 0.1-M DL-Dithiothreitol, and 40-UI RNaseOUT were added to the reaction mixture. Reverse transcription was performed under the following conditions: 25°C for 5 minutes, followed by 50°C for 40 minutes, and finally, 70°C for 15 minutes. The first strand cDNA was stored at 20°C. Real-time PCR (qPCR) was carried out using an iCycler iQ5 (Bio-Rad, United States). The reaction volume was 20 mL and consisted of 5 ng of cDNA, 1x Power SYBR Green PCR Master Mix, 10 μM of both forward and reverse primers, and ultrapure water.

The qPCR protocol included an initial denaturation step at 95°C for 10 minutes, followed by 50 PCR cycles (15 seconds at 95°C, 1 minute at 60°C, and 1 minute at 72°C), and a final extension step for 10 minutes at 72°C. The specificity of each primer set was determined using melt curve analysis, carried out between 60°C and 95°C for each primer pair. Fluorescence was initially monitored at 60°C followed by subsequent measurements at 10 second intervals until the temperature reached 95°C. PPIA was used as a reference gene to normalize expression levels of the assayed genes. All samples were run in triplicate, and qPCRs were repeated at least twice. As negative controls, samples with reverse transcriptase but without RNA were used. The delta–delta cycle threshold (CT) method²⁰ was used to transform CT values into normalized relative expression levels.

Primer design

Gene sequences were obtained from the National Center for Biotechnology Information. Primers were designed according to the published Ovis aries Connexin 37, Connexin 43, and Bax and Bcl2 messenger RNA (mRNA) sequences in GenBank, using the online free-access program, Primer3 (Table 1). The primers were tested for their specificity and efficiency using serial dilutions combining three different primer concentrations (10 mM, 5 mM, and 0.5 mM) with three cDNA concentrations (5 ng, 0.5 ng, and 1 ng). The combination with the best results for specificity and efficiency (10 mM with 5 ng) was used for the qPCRs.

Table 1.

Oligonucleotide Primers Used for the Real-Time Polymerase Chain Reaction Analysis of Ovine Follicles

Target gene	Primer sequence (5′→3′)	Sense	GenBank reference
PPIA	TCATTTGCACTGCCAAGACTG	Forward	XM_010804358.1
	TCATCGCCTCTTTCACTTTGC	Reverse
CX37a	CGACGAGCAGTCGGATTT	Forward	AY745977.1
	AGATGACATGGCCCAGGTAG	Reverse
CX43a	ATGAGCAGTCTGCCTTTCGT	Forward	AY074716.1
	TCTGCTTCAAGTGCATGTCC	Reverse
Bax	AACATGGAGCTGCAGAGGAT	Forward	XM_010823819.1
	TCGAAGGAAGTCCAATGTCC	Reverse
Bcl2	ATG TGT GTC GAG AGC GTC AA	Forward	XM_012103831
	GCC AGG AGA AAT CAA ACA GG	Reverse

Statistical analysis

Data for discrete variables (morphologically normal follicles, antrum formation, recovery rate, and chromatin configuration of oocytes) were analyzed as dispersion of frequency using a chi-square test. Otherwise, when the observed frequency was ≤5 U, Fisher's exact test was applied. In both cases, results were expressed as percentages. The Kruskall–Wallis test was applied to nonparametric mRNA expression data.

For continuous variables (follicular diameter and growth rate after culture), data were initially evaluated for homoscedasticity and normal distribution of the residues, by Bartlett's and Shapiro–Wilk tests, respectively. Once confirmed by both requirements, data were compared using an analysis of variance; the effects of treatment, time of culture, and treatment by time interaction were analyzed using PROC MIXED of SAS (2002), including repeated statements to account for autocorrelation between sequential measurements. The model was Y_ijk = μ+R_i+F_j+T_k+(RT)_ik+e_ijk, where Y_ijk is the observation of the jth follicle in the ith treatment at the kth time of culture, μ is the overall mean, R_i is the ith treatment, F_j is the random effect of the jth follicle within the ith treatment, T_k is the kth time of culture, (RT)_ik is the treatment by time interaction term, and e_ijk is the random residual effect.

Comparisons among treatments or times were further analyzed by the Tukey test. A probability of p < 0.05 indicated a significant difference and results were expressed as mean ± standard deviation (oocyte diameter) or expressed as mean ± standard error of the mean (follicle diameter and growth rate).

Results

Morphologically normal follicles, extrusion, and antral cavity formation rates during culture

A total of 412 SF were distributed randomly to treatments such as Control α-MEM (n = 54), Control TCM199 (n = 62), Follicle-Vit α-MEM (n = 68), Follicle-Vit TCM199 (n = 66), Tissue-Vit α-MEM (n = 83), and Tissue-Vit TCM199 (n = 79) to IVG for 18 days, resulting in six replicates.

The Control α-MEM and TCM199 treatments showed similar percentages of morphologically normal follicles; however, they were lower compared with all vitrified follicles at the end of IVG (Table 2). The vitrified groups demonstrated higher (p < 0.05) percentage of morphologically normal follicles compared with both in vitro Control groups from day 12 until the end of culture. Moreover, only the vitrified groups preserved the morphology throughout the entire culture period.

Table 2.

Percentages of Morphologically Normal Sheep Ovarian Follicles on Control α-MEM, Control TCM199, Follicle-Vit α-MEM, Follicle-Vit TCM199, Tissue-Vit α-MEM, and Tissue-Vit TCM199 at Days 0, 6, 12, and 18 of In Vitro Growth

	Control α-MEM	Control TCM199	Follicle-Vit α-MEM	Follicle-Vit TCM199	Tissue-Vit α-MEM	Tissue-Vit TCM199
Day 0	100.00% (54/54)^{A a}	100.00% (62/62)^{A a}	100.00% (68/68)^{A a}	100.00% (66/66)^{A a}	100.00% (83/83)^{A a}	100.00% (79/79)^{A a}
Day 6	98.15% (53/54)^{A a}	100.00% (62/62)^{A a}	100.00% (68/68)^{A a}	98.48% (65/66)^{A a}	98.80% (82/83)^{A a}	100.00% (79/79)^{A a}
Day 12	81.48% (44/54)^{B b}	90.32% (56/62)^{B a}	100.00% (68/68)^{A a}	98.48% (65/66)^{A a}	98.80% (82/83)^{A a}	98.73% (78/79)^{A a}
Day 18	55.56% (30/54)^{B c}	72.58% (45/62)^{B b}	100.00% (68/68)^{A a}	96.97% (64/66)^{A a}	98.80% (82/83)^{A a}	98.73% (78/79)^{A a}

A,B

Different letters indicate differences (p < 0.05) among groups (columns) within the same day.

a,b,c

Different letters indicate differences (p < 0.05) among days of culture (rows) within the same group.

α-MEM, alpha modification of minimum essential medium; TCM199, tissue culture medium 199.

The percentage of antrum formation was similar between control MEM and Follicle-Vit for both media types and were greater than Control TCM at the end of IVG (p < 0.05). In addition there were no differences among Tissue-Vit (both media types) and Control (both media types), although values were lower than both Follicle-Vit groups at the end of IVG (p < 0.05) (Table 3).

Table 3.

Percentages of Antrum Formation (Number Found/Number Initiated) in Sheep Ovarian Follicles on Control α-MEM, Control TCM199, Follicle-Vit α-MEM, Follicle-Vit TCM199, Tissue-Vit α-MEM, and Tissue-Vit TCM199 at Days 0, 6, 12, and 18 of In Vitro Growth

	Control α-MEM	Control TCM199	Follicle-Vit α-MEM	Follicle-Vit TCM199	Tissue-Vit α-MEM	Tissue-Vit TCM199
Day 0	0.00% (0/47)	0.00% (0/62)	0.00% (0/68)	0.00% (0/64)	0.00% (0/82)	0.00% (0/78)
Day 6	29.79% (14/47)^{BC b}	22.58% (14/62)^{C b}	44.12% (30/68)^{AB c}	53.13% (34/64)^{A b}	43.90% (36/82)^{AB c}	42.31% (33/78)^{AB b}
Day 12	76.60% (36/47)^{A a}	66.13% (41/62)^{AB a}	73.53% (50/68)^{A b}	68.75% (44/64)^{AB b}	64.63% (53/82)^{AB b}	56.41% (44/78)^{B ab}
Day 18	85.11% (40/47)^{AB a}	67.74% (42/62)^{C a}	92.65% (63/68)^{A a}	92.19% (59/64)^{A a}	80.49% (66/82)^{BC a}	70.51% (55/78)^{BC a}

A,B,C

Different letters indicate differences (p < 0.05) among groups (columns) within the same day.

a,b,c

Different letters indicate differences (p < 0.05) among days of culture (rows) within the same group.

Follicular diameter and daily growth rate after IVG

At the end of culture, Control (α-MEM and TCM199) and Follicle-Vit TCM199 treatments had higher follicular diameters, with no difference among them. Follicular diameter at day 18 compared to day 0 of IVG was significantly higher for all treatments, except to Tissue-Vit α-MEM (p < 0.05) (Table 4).

Table 4.

Follicular Diameter (μm) (Mean ± Standard Error of the Mean) of Sheep Preantral Follicles on Control α-MEM, Control TCM199, Follicle-Vit α-MEM, Follicle-Vit TCM199, Tissue-Vit α-MEM, and Tissue-Vit TCM199 at Days 0, 6, 12, and 18 of In Vitro Growth

	Control α-MEM	Control TCM199	Follicle-Vit α-MEM	Follicle-Vit TCM199	Tissue-Vit α-MEM	Tissue-Vit TCM199
Day 0	394.61 ± 19.73^{A c}	381.48 ± 18.54^{A b}	385.43 ± 11.97^{A b}	398.59 ± 10.97^{A b}	391.10 ± 12.61^{A a}	402.15 ± 13.29^{A b}
Day 6	422.67 ± 19.47^{A bc}	421.87 ± 18.30^{A bc}	432.60 ± 13.18^{A ab}	450.95 ± 11.85^{A a}	419.25 ± 14.19^{A a}	429.39 ± 13.36^{A ab}
Day 12	485.33 ± 25.49^{A ab}	488.20 ± 24.89^{A ab}	430.63 ± 12.19^{AB ab}	453.10 ± 12.47^{AB a}	416.87 ± 13.37^{B a}	441.05 ± 13.87^{AB ab}
Day 18	536.19 ± 29.77^{A a}	528.70 ± 28.49^{AB a}	444.32 ± 12.30^{C a}	476.99 ± 12.97^{ABC a}	428.39 ± 13.42^{C a}	456.63 ± 14.43^{BC a}

A,B,C

Different letters indicate differences (p < 0.05) among groups (columns) within the same day.

a,b,c

Different letters indicate differences (p < 0.05) among days of culture (rows) within the same group.

Figure 2 illustrates the follicular daily growth rate in the treatments throughout the period of IVG. The control groups were similar between them (α-MEM: 7.86 ± 5.91 μm and TCM199: 8.18 ± 6.27 μm), but higher than vitrified groups. Among vitrified groups, the Follicle-Vit TCM199 (4.36 ± 2.29) was higher than Tissue-Vit α-MEM (2.07 ± 1.54). In Figure 3, we can observe the higher percentage of follicles with decreased diameter in Control TCM199 (22.58%), Control α-MEM (31.91%), Tissue-Vit α-MEM (29.27%), and Tissue TCM199 (28.21%). However, there was a lower percentage of follicles with decreased diameter in Follicle-Vit α-MEM (16.18%) and Follicle-Vit TCM199 (10.94%).

FIG. 2.

Daily growth rate (μm/day) (mean ± SEM) of sheep follicles on Control α-MEM, Control TCM199, Follicle-Vit α-MEM, Follicle-Vit TCM199, Tissue-Vit α-MEM, and Tissue-Vit TCM199 groups after 18 days of in vitro growth. ^A–CDifferent letters indicate differences (p < 0.05) among groups. SEM, standard error of the mean.

FIG. 3.

Percentage of sheep preantral follicles with decreased diameter on Control α-MEM, Control TCM199, Follicle-Vit α-MEM, Follicle-Vit TCM199, Tissue-Vit α-MEM, and Tissue-Vit TCM199 groups after 18 days of culture. ^A–CDifferent letters indicate differences (p < 0.05) among groups.

Relative expression of CX 37, 43, Bax, and Bcl2 of granulosa cells after IVG of sheep follicles

Although there was no significant difference, the relative expression of mRNA for CX 37 was observed only on Control in both media (α-MEM and TCM199) (Fig. 4a). The data showed that mRNA levels for CX 43 did not vary (p > 0.05) between Controls (α-MEM and TCM199). Similar results were observed among three vitrified treatments; however, they were significantly lower than Control for both media. For CX 43, the mRNA levels were not detected in sufficient quantities on Follicle-Vit α-MEM treatment in the present study (Fig. 4b).

FIG. 4.

Relative mRNA expression of Connexins (CX) (a) 37, (b) 43, and apoptotic genes (c) Bax and (d) Bcl2 in sheep follicles after 18 days of IVG. The mRNA expression was normalized to PPIA and presented as mean ± SEM. Differences among groups were considered significant when p < 0.05. mRNA, messenger RNA.

The relative gene expression of mRNA was observed for Bax only on Control treatments (α-MEM and TCM199), however, without a significant difference (Fig. 4c). When considering the Bcl2 gene, the relative expression was observed in all treatments, having higher expression in Tissue-Vit treatment in both media (α-MEM and TCM199) compared to other treatments, except for Follicle-Vit α-MEM (Fig. 4d).

Recovery rate, diameter, viability, and meiotic resumption of fresh or vitrified oocytes in vitro and in vivo grown

The recovery rate of oocytes from normal and intact cultured follicles was similar among all treatments (Control α-MEM, Control TCM199, Follicle-Vit α-MEM, Follicle-Vit TCM199, Tissue-Vit α-MEM, and Tissue-Vit TCM199) (Table 5). There was no difference among vitrified groups (p > 0.05). However, among vitrified groups only α-MEM groups reached the MI stage. In addition, the MII stage was achieved only with the Fol-Vit α-MEM group. The Control α-MEM group did not differ from in vivo grown samples. The IVG on both media (α-MEM or TCM199), and the vitrification procedure of SF (isolated or enclosed on ovarian cortex), did not affect oocyte size after IVM (Table 6).

Table 5.

Oocyte Recovery Rate (%), Viability (%), and Meiotic Stages (%) of Sheep Preantral Follicles on In Vivo Grown, Control α-MEM, Control TCM199, Follicle-Vit α-MEM, Follicle-Vit TCM199, Tissue-Vit α-MEM, and Tissue-Vit TCM199

Groups	No. of oocytes recovered/No. of cultured follicles (%)	No. of calcein-AM viable oocytes/No. of oocytes (%)	Cromatin degradation/No. of oocytes (%)	No. of oocytes with meiosis resumption/No. of viable oocytes	GVBD/No. of oocytes with meiosis resumption	MI/No. of oocytes with meiosis resumption	MII/No. of oocytes with meiosis resumption (%)
In vivo grown	—	89.29% (50/56)^ab	12.00% (6/56)^a	80.00% (40/50)^a	32.50% (13/40)^b	12.50% (5/40)^a	55.00% (22/40)^a
Control α-MEM	31.48% (17/54)^a	100.00% (17/17)^a	0.00% (0/17)	76.47% (13/17)^a	46.15% (6/13)^ab	23.08% (3/13)^a	30.77% (4/13)^ab
Control TCM199	22.58% (14/62)^a	92.86% (13/14)^ab	7.14% (1/14)^a	53.85% (7/13)^ab	57.14% (4/7)^ab	28.57% (2/7)^a	14.29% (1/7)^b
Follicle-Vit α-MEM	29.41% (20/68)^a	75.00% (15/20)^bc	20.00% (4/20)^a	66.67% (10/15)^a	70.00% (7/10)^a	10.00% (1/10)^a	20.00% (2/10)^b
Follicle-Vit TCM199	31.82% (21/66)^a	85.71% (18/21)^ab	14.29% (3/21)^a	22.22% (4/18)^bc	100.00% (4/4)^a	0.00% (0/4)	0.00% (0/4)
Tissue-Vit α-MEM	26.51% (22/83)^a	45.45% (10/22)^c	13.64% (3/22)^a	60.00% (6/10)^a	83.33% (5/6)^a	16.67% (1/6)^a	0.00% (0/6)
Tissue-Vit TCM199	34.18% (27/79)^a	70.37% (19/27)^bc	11.11% (3/27)^a	15.79% (3/19)^c	100.00% (3/3)^a	0.00% (0/3)	0.00% (0/3)

a,b,c

Different letters indicate differences (p < 0.05) among groups (rows).

GVBD, germinal vesicle breakdown; MI, metaphase I.

Table 6.

Oocyte Diameter (μm ± Standard Deviation) of Sheep Preantral Follicles on In Vivo Growth, Control α-MEM, Control TCM199, Follicle-Vit α-MEM, Follicle-Vit TCM199, Tissue-Vit α-MEM, and Tissue-Vit TCM199 After 18 Days of In Vitro Growth and In Vitro Maturation

Treatments	Oocyte diameter (μm ± SD)
In vivo grown	99.19 ± 46.00^a
Control α-MEM	100.43 ± 13.60^a
Control TCM199	97.37 ± 12.31^a
Follicle-Vit α-MEM	100.53 ± 9.43^a
Follicle-Vit TCM199	102.59 ± 10.97^a
Tissue-Vit α-MEM	101.60 ± 14.92^a
Tissue-Vit TCM199	95.49 ± 12.22^a

No differences (p > 0.05) were observed among groups (rows).

SD, standard deviation.

After IVM, all oocytes were incubated with fluorescent labels calcein-AM, ethidium homodimer-1, and Hoechst 33342 to evaluate viability and chromatin configuration, respectively. The treatments in vivo Grown, Control (α-MEM and TCM199), and Follicle-Vit TCM199 showed the best percentage of oocyte viability (p < 0.05). The treatments in vivo Grown, Control (α-MEM and TCM199), Follicle-Vit α-MEM, and Tissue-Vit α-MEM showed the best percentage of meiotic resumption (p < 0.05). The IVG oocytes from Control α-MEM were surprisingly similar to the oocytes in vivo grown regarding MII rate. It is also noteworthy that the oocytes from Follicle-Vit α-MEM and Control TCM199 presented similar percentages of MII oocytes (Table 5).

Discussion

In this study, the follicular development, as well as the oocyte IVM, was evaluated after two different vitrification procedures of sheep SF: isolated form (without surrounded stroma) or enclosed in stroma (within ovarian cortex). Furthermore, we also evaluated two different base media (α-MEM and TCM199) in a long-term IVG of fresh or vitrified SF and the meiosis resumption of their oocytes. The present study demonstrated for the first time the potential for vitrified SF to develop into meiotically competent oocytes in a nonrodent species. The results of this study are relevant to oncofertility area, as vitrification of SF may provide an additional option for fertility preservation to female cancer patients, which are not suitable for ovary transplantation.

Vitrified follicles maintain intact/normal morphology better than follicles without previous vitrification (Control α-MEM and TCM199). This could be due to the hardening of the follicular membrane after the vitrification procedure, limiting oocyte release. The vitrification process may damage the structures of the lipid bilayer, which alters the movement of molecules and directly influences on its properties.²¹

The Follicle-Vit treatments (α-MEM and TCM199) presented an antrum formation rate similar to Control α-MEM and was higher than Tissue-Vit treatments (α-MEM and TCM199). This can be due to the fact that preservation of granulosa cells was better in vitrification of isolated follicles compared to those vitrified enclosed in ovarian tissue. Thereafter, these cells had a better response to the FSH and growth factors (LIF and Kit Ligand) that were present on the culture media. Moreover, healthy granulosa cells showed greater permeability,²² which contributes to follicular fluid production and antrum formation.

The follicles from Control groups (α-MEM and TCM199) showed different rates of antrum formation. It is known that α-MEM and TCM199 media are highly variable in inorganic salts, amino acids, vitamins, and other substances. However, the α-MEM contains Asparagine and L-Alanyl-L-Glutamine and in general has higher concentrations of amino acids and vitamins. In addition, the α-MEM has pyruvate, the preferred source of nutrition of the oocyte,²³ whereas glucose is favorable for both follicle²⁴ and COC.²⁵ These characteristics among the two media could explain the observed variation on antrum cavity formation.

The daily growth rate in all vitrified follicles was lower than Control α-MEM and TCM199. The follicular growth occurs due to the increase on the number and size of granulosa cells, as well as on the oocyte size. The hardening of follicular membrane combined with a possible reduction on granulosa cell proliferation due to vitrification process led to the observed reduction on follicular growth, once the oocyte diameter was similar among treatments.

This study evaluated the gap junctions that are responsible for exchange of substances (inorganic salts, sugar, amino acids, nucleotides, vitamins, hormones, and secondary messengers as cyclic adenosine monophosphate and inositol triphosphate) essential for follicular and oocyte development. These junctions are composed of protein denominated connexins (CX), which mean intermembrane channels that are intermediates in the cell–oocyte communication.^26–28 A reduction in mRNA expression of CX 37 and 43 was observed in all vitrified groups.

Previous studies in mice^29,30 and feline queens^31,32 also demonstrated similar results on the CX 37 and 43 expressions after the cryopreservation of preantral follicles. Similarly, a recent study also showed that SF (oocyte and granulosa cells) vitrified on ovarian tissue with the ovarian tissue cryosystem followed by isolation and IVG during 6 days; only the CX43 expression was reduced, while the CX37 expression remained unaffected.³³ The present study differed from the prior one in different aspects such as vitrification technique, media composition, and IVG period of SF. Moreover, the cells studied for gene expression profiling were different since only mural cells were evaluated in this study.

The mRNA expression for CX 37 was undetected in vitrified groups (Fig. 4a). Problems during oocyte meiotic progression may occur due to the absence of CX 37, a tight junction which binds the granulosa cells to oocyte.²⁶ The vitrification process possibly jeopardizes the gap junctions, affecting CX 37 protein. As a consequence, the majority of vitrified groups did not achieve MII stage, except the Follicle-Vit MEM group. The vitrification approach in which the follicles are previously isolated and subsequently destined to IVG on MEM medium permits a minimum preservation of CX 37, or even a restoration of its expression during IVG, allowing meiotic resumption for some oocytes.

The oocyte development is dependent on granulosa cell preservation. A previous study demonstrated that the vitrification process is harmful to granulosa cells, demonstrating mainly cell disaggregation when the follicles are vitrified enclosed in ovarian tissue.¹⁵ The CX 43 protein is found in tight junctions to bind granulosa cells, and in the absence of CX 43, the supply influx is interrupted and may impair the early folliculogenesis.³⁵ However, the granulosa cell disaggregation occurs physiologically at the end of oocyte maturation, during cumulus cell expansion.

The mRNA for CX 43 in fresh follicles is expressed abundantly, whereas in vitrified follicles the expression is lower, except in the Follicle-Vit MEM group. Possible premature breakdown of CX 43 with an early nuclear maturation may be occurring in the Follicle-Vit MEM group, once that CX 43 was the only vitrified group with meiotic resumption until the MII stage, nevertheless without detectable mRNA expression of CX 43. Supplementary investigations testing cytoplasmic maturation and even IVF are warranted to confirm the efficiency of the suggested protocol.

Regarding the expression analysis of apoptosis genes (Bax and Bcl2), only fresh follicles (Control α-MEM and Control TCM199) showed detectable RNA expression for Bax. In contrast, other studies reported that the vitrification process increased the expression of this gene.^35–37 It was not possible to calculate the Bax/Bcl2 ratio due to the results found for Bax mRNA expression, which were undetectable in all vitrified treatments. The fresh follicles or those cultured in vitro can exhibit a high variation on Bax mRNA expression.³⁸ Since the transcription and translation are extremely dynamic,³⁹ we suggest that vitrification may have stimulated the transcription process so that all produced mRNA was translated, which made it impossible to obtain detectable levels for quantification.

The treatments Follicle-Vit α-MEM and Tissue-Vit (α-MEM and TCM199) showed a higher expression for Bcl2 compared to control groups. These results are in accordance with a previous report which demonstrated an increased expression for Bcl2 after vitrification. Furthermore, the higher oocyte viability found in groups Control MEM, Control TCM, and Follicle Vit TCM, as well as the lower oocyte viability found on groups Tissue Vit MEM and Tissue Vit TCM, is possibly correlated with a lower and a higher expression of mRNA for the antiapoptotic gene Bcl2, respectively. This could be a cellular response in an attempt to overcome the apoptosis process usually observed as a consequence of vitrification damage like the production of reactive oxygen species (ROS).⁴⁰

Bcl2 is an oncogenic protein which inhibits apoptosis. It is located in the mitochondrial membrane, endoplasmic reticulum, and nuclear envelope. Bcl2 expression is capable of inhibiting ROS production, intracellular acidification, and stabilizing the mitochondrial membrane potential, avoiding an induction of the intracellular caspase cascade.^36,41 However, the accurate elucidation of the mechanistic link between apoptotic propensities induced by ROS activity and the ability of the culture media to overcome apoptosis postvitrification represents a required topic for investigation.

Surprisingly, the fresh follicles cultured in α-MEM have shown a similar rate of MII oocyte production compared to the IVG follicles, while this parameter in isolated vitrified follicles cultured in α-MEM (Follicle-Vit α-MEM) was similar to that observed on fresh follicles cultured in TCM199. Usually, the IVM of in vivo developed oocytes is better than the in vitro developed oocytes.⁴² The variances between in vivo grown and in vitro groups can be explained due to the artificial conditions that in vitro developed follicles were exposed to maintain their growth and survival.

In contrast, oocytes from in vivo developed follicles had the ideal conditions in their natural physiological environment. Thus, it is not possible to predict which substances and their ideal combinations are fundamental to in vitro follicular development that would guarantee the best oocyte maturation rates. Although the results achieved have shown promise, complementary analysis should be performed to validate the efficiency of the established vitrification protocol, in the following steps of oocyte maturation, such as chromatin configuration, in vitro fertilization, and embryo development.

In conclusion, we observed that the number of recovered oocytes after IVG, as well as the oocyte diameter after IVM, was not affected by the vitrification process, or by the base media used for follicular culture. Although the vitrification process reduced the gene expression for CX37, CX43, and Bax, the high expression for Bcl2 on vitrified follicles may be a sign of the reactivity of the cells overcoming the apoptosis process on these follicles. Unlike the follicles that were vitrified enclosed on ovarian tissue, the majority of isolated SF vitrified could achieve antrum formation. Finally, after vitrification only oocytes from isolated follicles and cultured in α-MEM achieved the MII stage.

Footnotes

Acknowledgments

This work was supported by CNPq (Grant No. 473968/2013-4). Franciele Osmarini Lunardi is a recipient of a grant from CAPES Brazil. In addition, Ana Paula Ribeiro Rodrigues is recipient of a grant from CNPq Brazil (309877/2012-1). Johan Smitz is Especial Visitor Researcher from CAPES (Grant No. 88881.030.433/2013-01).

Author Disclosure Statement

No conflicting financial interests exist.

References

Donnez

, Dolmans

. Transplantation of ovarian tissue. Best Pract Res Clin Obstet Gynaecol, 2014; 28:1188–1197.

Donnez

, Dolmans

. Preservation of fertility in females with haematological malignancy. Br J Haematol, 2011; 154:175–184.

Donnez

, Dolmans

. Ovarian tissue freezing: Current status. Curr Opin Obstet Gynecol, 2015; 27:222–230.

O'Brien

, Pendola

, Eppig

. A revised protocol for in vitro development of mouse oocytes from primordial follicles dramatically improves their developmental competence. Biol Reprod, 2003; 68:1682–1686.

Magalhães

DMM

, Duarte

ABG

, Araujo

, et al. In vitro production of a caprine embryo from a preantral follicle cultured in media supplemented with growth hormone. Theriogenology, 2011; 75:182–188.

Arunakumari

, Shanmugasundaram

, Rao

. Development of morulae from the oocytes of cultured sheep preantral follicles. Theriogenology, 2010; 74:884–894.

Wang

, Catt

, Pangestu

, et al. Successful in vitro culture of pre-antral follicles derived from vitrified murine ovarian tissue: Oocyte maturation, fertilization, and live births. Reproduction, 2011; 141:183–191.

Lunardi

, Chaves

, Lima

, et al. Vitrified sheep isolated secondary follicles are able to grow and form antrum after a short period of in vitro culture. Cell Tissue Res, 2015; 362:241–251.

Cecconi

, Barboni

, Coccia

, et al. In vitro development of sheep preantral follicles. Biol Reprod, 1999; 60:594–601.

10.

Luz

, Araujo

, Duarte

ABG

, et al. Eight-cell parthenotes originated from in vitro grown sheep preantral follicles. Reprod Sci, 2012; 19:1219–1225.

11.

Rosseto

, Saraiva

MVA

, Santos

, et al. Effect of medium compositium on the in vitro culture of bovine pre-antral follicles: Morphology and viability do not guarantee functionality. Zygote, 2013; 21:125–128.

12.

Castro

, Carvalho

AAD

, Silva

CMG

, et al. Frozen and fresh ovarian tissue require different culture media to promote in vitro development of bovine preantral follicles. Biopreserv Biobank, 2014; 12:317–324.

13.

Men

, Monson

, Parrish

, et al. Degeneration of cryopreserved bovine oocytes via apoptosis during subsequent culture. Cryobiology, 2003; 47:73–81.

14.

Bordes

, Lornage

, Demirci

, et al. Normal gestations and live births after orthotopic autograft of vitrified-warmed hemi-ovaries into ewes. Hum Reprod, 2005; 20:2745–2748.

15.

Lunardi

, Araujo

, Faustino

, et al. Morphologic, viability and ultrastructural analysis of vitrified sheep preantral follicles enclosed in ovarian tissue. Small Ruminant Res, 2012; 107:121–130.

16.

Duarte

ABG

, Araújo

, Chaves

, et al. Bovine dominant follicular fluid promotes the in vitro development of goat preantral follicles. Reprod Fert Develop, 2012; 24:490–500.

17.

Sánchez

, Smitz

. Molecular control of oogenesis. Biochim Biophys Acta, 2012; 1822:1896–1912.

18.

Lunardi

, Aguiar

FLN

, Duarte

ABG

, et al. Ovine secondary follicles vitrified out the ovarian tissue grow and develop in vitro better than those vitrified into the ovarian fragments. Theriogenology, 2016; 85:1203–1210.

19.

Brito

, Sales

, Rodrigues

, et al. Differential gene expression and immunolocalization of platelet-derived growth factors and their receptors in caprine ovaries. Domest Anim Endocrinol, 2015; 51:46–55.

20.

Livak

, Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 2001; 25:402–408.

21.

Ghetler

, Yavin

, Shalgi

, et al. The effect of chilling on membrane lipid phase transition in human oocytes and zygotes. Hum Reprod, 2005; 20:3385–3389.

22.

Rodgers

, Irving-Rodgers

. Formation of the ovarian follicular antrum and follicular fluid. Biol Reprod, 2010; 82:1021–1029.

23.

Johnson

, Freeman

, Gardner

, et al. Oxidative Metabolism of pyruvate is required for meiotic maturation of murine oocytes in vivo. Reproduction, 2007; 77:2–8.

24.

Boland

, Humpherson

, Leese

, Gosden

. The effect of glucose metabolism on murine follicle development and steroidogenesis in vitro. Hum Reprod, 1994; 9:617–623.

25.

Sutton-Mcdowall

, Gilchrist

, Thompson

. The pivotal role of glucose metabolism in determining oocyte developmental competence. Reproduction, 2010; 139:685–695.

26.

Simon

, Goodenough

, Li

, et al. Female infertility in mice lacking connexin 37. Nature, 1997; 385:525–529.

27.

Teilmann

. Differential expression and localisation of connexin-37 and connexin-43 in follicles of different stages in the 4-week-old mouse ovary. Mol Cell Endocrinol, 2005; 234:27–35.

28.

Oyamada

, Takebe

, Oyamada

. Regulation of connexin expression by transcription factors and epigenetic mechanisms. Biochim Biophys Acta, 2013; 1828:118–133.

29.

Boland

, Gosden

. Effects of epidermal growth-factor on the growth and differentiation of cultured mouse ovarian follicles. J Reprod Fertil, 1994; 101:369–374.

30.

, Banc

, Woodruff

, et al. Secondary follicle growth and oocyte maturation by culture in alginate hydrogel following cryopreservation of the ovary or individual follicles. Biotechnol Bioeng, 2009; 103:378–386.

31.

Luciano

, Chigioni

, Lodde

, et al. Effect of different cryopreservation protocols on cytoskeleton and gap junction mediated communication integrity in feline germinal vesicle stage oocytes. Cryobiology, 2009; 59:90–95.

32.

Tanpradit

, Comizzoli

, Srisuwatanasagul

, et al. Positive impact of sucrose supplementation during slow freezing of cat ovarian tissues on cellular viability, follicle morphology, and DNA integrity. Theriogenology, 2015; 83:1553–1561.

33.

Sampaio da Silva

, Bruno

, Lima

, et al. Connexin 37 and 43 gene and protein expression and developmental competence of isolated ovine secondary follicles cultured in vitro after vitrification of ovarian tissue. Theriogenology, 2016; 85:1457–1467.

34.

Ackert

, Gittens

, O'Brien

, et al. Intercellular communication via connexin43 gap junctions is required for ovarian folliculogenesis in the mouse. Dev Biol, 2001; 223:258–270.

35.

Taghavi

, Valojerdi

, Moghadam

, et al. Vitrification of mouse preantral follicles versus slow freezing: Morphological and apoptosis evaluation. Anim Sci J, 2015; 86:37–44.

36.

Jafarabadi

, Abdollahi

, Salehnia

. Assessment of vitrification outcome by xenotransplantation of ovarian cortex pieces in gamma-irradiated mice: Morphological and molecular analyses of apoptosis. J Assist Reprod Genet, 2015; 32:195–205.

37.

, Chi

, Zhao

, et al. Comparison of different cryoprotectants in whole sheep ovary cryopreservation. Jiepou Xuebao, 2015; 46:415–421.

38.

Chakravarthi

, Kona

, Siva Kumar

, et al. Quantitative expression of antiapoptotic and proapoptotic genes in sheep ovarian follicles grown in vivo or cultured in vitro. Theriogenology, 2015; 83:590–595.

39.

Sales

, Brito

, Lima

, et al. Expression and localization of Aquaporin 3 (AQP3) in folliculogenesis of ewes. Acta Histochem, 2014; 116:831–837.

40.

Grivicich

, Regner

, Rocha

. Morte celular por apoptose. Rev Bras Cancerol, 2007; 53:335–343.

41.

Cory

, Huang

DCS

, Adams

. Roles in cell survival and oncogenesis. Oncogene, 2003; 22:8590–8607.

42.

Hao

, Zhang

, Lv

, et al. Effects of AY9944 A-7 on gonadotropin-induced meiotic resumption of oocytes and development of parthenogenetic embryos in sheep. Theriogenology, 2015; 83:30–37.