Association of XRCC1 Variants with Acute Skin Reaction After Radiotherapy in Breast Cancer Patients

Abstract

After irradiation results in cytotoxic effects by DNA damage, base excision repair (BER) pathway is involved in the repair of single-strand breaks and nonhomologous end joining and homologous repair of double-strand breaks caused by radiotherapy. Alterations in the function of BER DNA repair genes may affect DNA repair proficiency and influence the response of patients with cancer to radiotherapy. The association of single nucleotide polymorphisms of BER DNA repair X-ray repair cross-complementing group 1 protein (XRCC1) and risk of radiotherapy-induced ≥grade 2 acute skin reaction in patients with breast cancer was examined. It was found that the risk of ≥grade 2 acute skin toxicity after radiotherapy could be increased by 2.86-fold in patients carrying the XRCC1 −77TC and CC genotypes (p = 0.016). However, the other three coding XRCC1 variants did not influence the risk of ≥grade 2 acute skin toxicity for patients with breast cancer after radiotherapy. Our results suggested that the XRCC1 polymorphism is associated with increased risk of radiation-induced acute skin reaction in a Chinese population.

Introduction

Acute skin toxicity in patients with breast cancer is one of the severe side-effects of radiotherapy. Several clinical factors related to radiation exposure have been established to be related with skin actions.^1

–4 However, they are not sufficient to fully explain the interindividual variability among patients observed with side-effects, suggesting that patient genetic makeup may play a part in an individual's response to radiotherapy and acute skin toxicity development.^5
–7

Given that irradiation can result in cytotoxic effects by DNA damage, the interindividual DNA repair capacity difference may modify the response of the normal tissue. Base excision repair pathway is one of the key mechanisms for the repair of single-strand breaks and nonhomologous end joining and homologous repair of double-strand breaks. Therefore, it is considered to play the most important role in repair of radiation-induced DNA damage.^5,7
–9 As a scaffold protein in base excision repair, X-ray repair cross-complementing 1 (XRCC1) binds DNA ligase III, DNA polymerase β, and poly (ADP-ribose) polymerase to a DNA-protein complex at the damage site.^10,11 Increased sensitivity to ionizing radiation, UV, hydrogen peroxide, and mitomycin was observed in cells defective in XRCC1.¹² It has been shown that the XRCC1 gene is polymorphic.^13
–15 One functional promoter single nucleotide polymorphism (SNP) (−77T>C) and several nonsynonymous SNPs, including codon 194Arg>Trp, 280Arg>His, and 399Arg>Gln, have been identified.^6,13,15 XRCC1 −77T>C polymorphism was associated with a decreased transcriptional activity of the gene and higher affinity to Sp1 binding. Among the three missense polymorphisms, little functional data were reported to support their potential roles in repair capacity.^16,17 Although the relationship between the 194Arg>Trp, 280Arg>His, and 399Arg>Gln variants and risk of acute normal skin reactions after radiotherapy of patients with breast cancer has been investigated in the Caucasian population,^6,7 the impact of these SNPs and the −77T>C polymorphism on acute skin side-effects in the Chinese population is still unknown.

It was, therefore, hypothesized that the genetic variations in the XRCC1 gene may also influence the risk of acute normal skin reactions among patients with breast cancer treated with radiotherapy in the case of Chinese women. To test this hypothesis, the XRCC1 −77T>C, 194Arg>Trp, 280Arg>His, and 399Arg>Gln variants in 119 patients with breast cancer after radiotherapy were genotyped and their roles in acute skin toxicity were evaluated.

Patients and Methods

Patients

A total of 119 patients with breast cancer were included in this prospective study. Patients were recruited between May 2007 and August 2009 at the Department of Radiation Oncology in the Huaian NO. 2 Hospital (Jiangsu). The eligible patients were those with histologically or cytologically confirmed breast cancer. This study was approved by the Hospital Review Board of Huaian NO. 2 Hospital. The informed consent was obtained from all patients enrolled. The blood samples were collected from patients on recruitment and before radiotherapy.

Treatment

Six-MV X-rays from a linear accelerator (Varian 600CD, Palo Alto, CA) were used in the radiotherapy of all patients. Radiation was delivered to the chest wall and supraclavicular and axilla nodal areas. The chest wall was irradiated with two tangent fields.^18

–21 The supraclavicular and axillary nodes were irradiated with an anterior field alone.^21,22 A total dose of 46–54 Gy was given with 2 Gy per fraction, 5 days a week. The most common radiation schedule was 50 Gy in 25 fractions over a 5-week period.

Evaluation of acute skin reaction after radiotherapy

The Common Terminology Criteria for Adverse Events v3.0 (Ref.²³) was used to grade acute skin reaction: Grade 0, no change; Grade 1, minimal symptoms, intervention not indicated; Grade 2, medical intervention, minimal debridement indicated; Grade 3, moderate to major debridement or reconstruction indicated; Grade 4, life-threatening consequences; and Grade 5, death. The occurrence and severity of acute skin reaction were determined at the end of radiotherapy.

Genotyping

Genomic DNA was extracted from peripheral blood lymphocytes, and genotyping was performed to detect clinically significant genetic polymorphisms. Since the DNA quality of 17 patients was poor, only 102 patients were genotyped in the current study. Genotypes of XRCC1 −77T>C (rs3213245), 194Arg>Trp (rs1799782), 280Arg>His (rs25489), and 399Arg>Gln (rs25487) were analyzed by polymerase chain reaction (PCR)-based restriction fragment length polymorphism (Table 1). In brief, PCR was performed at a 25 μL reaction mixture containing 80 ng of DNA, 0.1 μmol/L of each primer, 0.2 mmol/L of deoxynucleoside triphosphate, 1.0U of Taq DNA polymerase (TaKaRa, Dalian, China), 1× reaction buffer, and 1.5 mmol/L MgCl₂. The PCR profile consisted of an initial melting step of 2 minutes at 95°C, followed by 35 cycles of 30 seconds at 94°C, 30 seconds at 55°C (for both the 194Arg>Trp and the 399Arg>Gln), 58°C (for the 280Arg>His), or 61°C (for the −77T>C), 45 seconds at 72°C, and a final elongation step of 7 minutes at 72°C. The restriction enzyme BsrBI (for −77T>C), PvuII (for 194Arg>Trp), RsaI (for 280Arg>His), or NciI (for 399Arg>Gln) (New England BioLabs, Beverly, MA) was used to distinguish different genotypes of XRCC1 SNPs. Genotyping was performed without knowledge of patient status. A 20% blind, random sample of study subjects was genotyped twice by direct DNA sequencing and the reproducibility was 100%.

Table 1.

Polymerase Chain Reaction-Based Restriction Fragment Length Polymorphism Methods for Genotyping X-Ray Repair Cross-Complementing Group 1 Single Nucleotide Polymorphisms

		PCR primers
SNPs	db SNP number	Forward (5'→3')	Reverse (5'→3')	Restriction enzymes
−77T>C	rs3213245	GAGGAAACGCTCGTTGCTAAG	TCCTCATTAATTCCCTCACGTC	BsrBI
194Arg>Trp	rs1799782	GCCAGGGCCCCTCCTTCAA	TACCCTCAGACCCACGAGT	PvuII
280Arg>His	rs25489	CCCCAGTGGTGCTAACCTAA	CTACATGAGGTGCGTGCTGT	RsaI
399Arg>Gln	rs25487	TCCTCCACCTTGTGCTTTCT	AGTAGTCTGCTGGCTCTGGG	NciI

PCR, polymerase chain reaction; SNP, single nucleotide polymorphism.

Statistical analysis

Chi-squared test was used to examine the differences in genotype distributions. The associations between XRCC1 polymorphisms and ≥grade 2 acute skin reaction were estimated by odds ratios (OR) and their 95% confidence intervals (CI), which were calculated by unconditional logistic regression. The ORs were adjusted for age, smoking status, estrogen receptor (ER) status, and progesterone receptor (PR) status. All analyses were performed using the SPSS software package (version 12.0, SPSS Inc., Chicago, IL).

Results

Patient characteristics and toxicity outcomes

A total of 119 patients with breast cancer were enrolled in this study. As shown in Table 2, the median age of these 119 patients was 47 years with a range from 26 to 73. The median total radiation dose of these cases was 50.2 Gy (range, 46 to 54). There were 9 (7.5%) stage I and II disease, 91 (76.5%) stage III, and 19 (16.0%) stage IV disease. Only 9 of 119 patients were smokers (7.6%). Among all the patients with breast cancer and with known ER and PR status, 75 (63.0%) were positive with ER and 82 (68.9%) were positive with PR. After radiotherapy, 69 patients (58.0%) had ≥grade 2 acute skin reaction (grades 2 and 3 were observed in 68 and 1 patients, respectively).

Table 2.

Clinical and Dosimetric Characteristics of Patients (N = 119)

Characteristic	No. of patients	%
Age
Median (year)	47
Range (year)	26–73
Stages
I and II	9	7.5
III	91	76.5
IV	19	16.0
Total radiation dose
Median (Gy)	50.2
Range (Gy)	46–54
Smoking status
Yes	9	7.6
No	110	92.4
Estrogen receptor status
Positive	75	63.0
Negative	22	18.5
Unknown	22	18.5
Progesterone receptor status
Positive	82	68.9
Negative	15	12.6
Unknown	22	18.5
Acute skin reaction
<grade 2	50	42.0
≥grade 2	69	58.0

Genotype distribution

Genotyping results are given in Table 3. The allele frequencies for the XRCC1 −77C, 194Trp, 280His, and 399Gln were 29.0%, 40.3%, 25.2%, and 37.0%, respectively, in all cases. The respective allele frequencies for the XRCC1 −77C, 194Trp, 280His, and 399Gln were 54.6%, 62.6%, 48.7%, and 57.1%, respectively, in the patients with breast cancer with ≥grade 2 acute skin reactions. The observed genotype frequencies of 194Arg>Trp and 399Arg>Gln in all patients were consistent with Hardye–Weinberg equilibrium (p > 0.05). However, −77T>C and 280Arg>His were not (p < 0.05). The possible explanation is that this is a hospital-based case-only study that is different from the population-based epidemiology study. Therefore, some patient selection bias may exist.

Table 3.

Association of X-Ray Repair Cross-Complementing Group 1 Polymorphisms with Risk of Acute Skin Reaction After Radiotherapy in Patients with Breast Cancer

	Patients with breast cancer
Genotype	Number of all patients	Number of patients with acute skin reaction ^a	(%) ^b	OR (95% CI) ^c	OR (95% CI) ^d	p
−77T>C
TT	74	45	(60.8)	1.00 (Reference)	1.00 (Reference)
TC	21	18	(85.7)	3.87 (0.95–18.20)	3.66 (1.04–17.95)	0.033
CC	7	6	(85.7)	NC	NC	NC
TC + CC	28	24	(85.7)	3.87 (1.11–14.73)	3.88 (1.14–14.77)	0.016
194Arg>Trp
Arg/Arg	50	32	(64.0)	1.00 (Reference)	1.00 (Reference)
Arg/Trp	42	25	(59.5)	0.83 (0.33–2.10)	0.89 (0.35–2.04)	0.701
Trp/Trp	10	6	(60.0)	NC	NC	NC
Arg/Trp + Trp/Trp	52	31	(59.6)	0.83 (0.34–1.99)	0.79 (0.31–0.72)	0.446
280Arg>His
Arg/Arg	80	55	(68.8)	1.00 (Reference)	1.00 (Reference)
Arg/His	18	12	(66.7)	0.91 (0.27–3.10)	0.90 (0.26–3.01)	0.841
His/His	4	2	(50.0)	NC	NC	NC
Arg/His + His/His	22	14	(63.6)	0.80 (0.27–2.40)	0.83 (0.31–2.30)	0.627
399Arg>Gln
Arg/Arg	58	39	(67.2)	1.00 (Reference)	1.00 (Reference)
Arg/Gln	34	24	(70.6)	1.17 (0.43–3.25)	1.16 (0.47–3.59)	0.729
Gln/Gln	10	6	(60.0)	NC	NC	NC
Arg/Gln + Gln/Gln	44	30	(68.2)	1.04 (0.42–2.63)	1.06 (0.45–2.53)	0.920

Number of patients with ≥grade 2 acute skin reaction/number of patients carrying the genotype category.

Percentage of acute skin reaction patients within the genotype category.

The ORs were calculated using the univariate model.

The ORs were adjusted for dose of radiotherapy, age, smoking status, estrogen receptor (ER) status, and progesterone receptor (PR) status.

CI, confidence interval; OR, odds ratio; NC, not calculated.

XRCC1 polymorphisms and acute skin toxicity

As shown in Table 3, the XRCC1 −77TC carriers had a significantly increased risk of ≥grade 2 acute skin toxicity (OR, 3.66; 95% CI, 1.04–17.95; p = 0.033) compared with the −77TT carriers. Also, patients with XRCC1 −77TC and CC genotypes had a significantly increased risk of ≥grade 2 acute skin toxicity (OR, 3.88; 95% CI, 1.14–14.77; p = 0.016) compared with the −77TT carriers. However, there was no statistically significant association between the XRCC1 194Arg>Trp polymorphism and the risk of ≥grade 2 acute skin toxicity (OR, 0.79; 95% CI, 0.31–0.72; p = 0.446). Similarly, analysis of ≥grade 2 acute skin toxicity revealed no statistically significant association with either the 280Arg>His (OR, 0.83; 95% CI, 0.31–2.30; p = 0.627) or 399Arg>Gln (OR, 1.06; 95% CI, 0.45–2.53; p = 0.920) polymorphisms (Table 3).

Discussion

In the current study, the impact of XRCC1 −77T>C (rs3213245), 194Arg>Trp (rs1799782), 280Arg>His (rs25489), and 399Arg>Gln (rs25487) polymorphisms on the risk of acute skin toxicity after radiotherapy in 119 female patients with breast cancer without chemotherapy was evaluated. Our data demonstrated that the risk of ≥grade 2 acute skin toxicity after radiotherapy could be increased by 2.86-fold in patients carrying the XRCC1 −77TC and CC genotypes. However, the other 3 coding XRCC1 variants did not influence the risk of ≥grade 2 acute skin toxicity for patients with breast cancer after radiotherapy.

Although XRCC1 −77T>C has been associated with increased cancer risk in the Chinese population,^15,24 its role in acute side-effects of breast cancer after radiotherapy is still largely unknown. To our knowledge, the present study is the first to report an association between XRCC1 −77T>C and increased radiation-induced-skin toxicity in patients with breast cancer among the Chinese population. This observation is biologically possible. It has been shown that the functional SNP −77T>C in XRCC1 5'UTR can decrease transcriptional activity of C-allele containing promoter.¹⁵ In this sense, decreased XRCC1 expression in breast skin tissues, which is associated with −77C allele, can lead to reduced XRCC1-related DNA repair ability in these tissues. This may result in an increased radiation-induced-skin toxicity in patients with −77C allele.

Chang-Claude et al.⁶ reported that the XRCC1 399Gln allele may be protective against the development of acute side-effects after radiotherapy in patients with breast cancer with normal weight after XRCC1 194Arg>Trp, 280Arg>His, and 399Arg>Gln variants were genotyped in a cohort of 446 female Caucasian patients with breast cancer who received radiotherapy after breast-conserving surgery. For other cancers, several studies have examined the relationship between the XRCC1 399Arg>Gln SNP and normal tissue radiosensitivity.^{6,7,25

–35} In the 4 studies that reported a positive association between the SNP and skin side-effects, Giotopoulos et al. found a significant association between the Gln allele and increased risk of late skin toxicity.⁷ However, Andreassen et al. showed that the Arg allele was significantly associated with an increased risk of late skin toxicity.²⁵ For the acute skin reactions, Moullan et al. reported that the Gln allele in combination with another SNP was associated with an increased risk of various acute reactions.³² Chang-Claude et al. found that the Gln allele in combination with an additional SNP was associated with a reduced risk of acute skin reactions but only in a subgroup.⁶ However, several other studies did not find any significant associations between the 399Arg>Gln SNP and skin side-effects after radiotherapy,^{26

–29,31,35} including three relatively large studies with 409, 405, and 399 patients, respectively.^30,33,35 In accordance with these negative findings, no positive association with regard to the 399Arg>Gln SNP in our cohort was found. The possible explanations for these different results include the difference of ethnics (Chinese and Caucasians), different sample sizes, and different treatments that patients in different cohorts might receive. Any positive association between the other 2 coding polymorphisms of XRCC1, 194Arg>Trp, and 280Arg>His and radiation-induced-skin toxicity in patients with breast cancer of the Chinese population was not observed, which was consistent with the results in the Caucasian population.⁶

It is an important issue to control treatment-related toxicity in the case of patients with breast cancer. Individualized radiation dosage to reduce unnecessary side-effects and improve therapeutic efficacy is important in the treatment of cancer because of the narrow therapeutic index. The radiation-related toxicities have been predicted according to the traditional dosimetric and clinical determinants.^33,36,37 Unfortunately, all these factors are far less than sufficient to explain patient-to-patient variability.⁶ It is believed that with the advancement of pharmacogenetic analyses, the shifting paradigm of individualized radiotherapy will be further facilitated.

There were several strengths and limitations for the current study. First, it was illustrated that the XRCC1 SNPs were correlated with acute skin toxicity after radiotherapy in Chinese patients with breast cancer. However, due to the relatively small sample size (∼100 patients) of this study, further studies with larger sample sizes are warranted to validate our results in the future. Although genetic polymorphisms of XRCC1 and their relationships with the phenotypic activity have not yet been thoroughly identified, more precise studies of the radiotherapy side-effects might improve toxicity control in patients with breast cancer. A better understanding of the roles of DNA repair will provide further information on treatment-related toxicity.

Footnotes

Disclosure Statement

The authors declare no any conflicts of interest.

References

Barber

, Burrill

, Spreadborough

et al. Relationship between in vitro chromosomal radiosensitivity of peripheral blood lymphocytes and the expression of normal tissue damage following radiotherapy for breast cancer. Radiother Oncol, 2000; 55:179.

Fernando

, Ford

, Powles

et al. Factors affecting acute skin toxicity in patients having breast irradiation after conservative surgery: A prospective study of treatment practice at the Royal Marsden Hospital. Clin Oncol (R Coll Radiol), 1996; 8:226.

Turesson

, Nyman

, Holmberg

et al. Prognostic factors for acute and late skin reactions in radiotherapy patients. Int J Radiat Oncol Biol Phys, 1996; 36:1065.

Twardella

, Popanda

, Helmbold

et al. Personal characteristics, therapy modalities and individual DNA repair capacity as predictive factors of acute skin toxicity in an unselected cohort of breast cancer patients receiving radiotherapy. Radiother Oncol, 2003; 69:145.

Tucker

, Turesson

, Thames

. Evidence for individual differences in the radiosensitivity of human skin. Eur J Cancer, 1992; 28A:1783.

Chang-Claude

, Popanda

, Tan

et al. Association between polymorphisms in the DNA repair genes, XRCC1, APE1, and XPD and acute side effects of radiotherapy in breast cancer patients. Clin Cancer Res, 2005; 11:4802.

Giotopoulos

, Symonds

, Foweraker

et al. The late radiotherapy normal tissue injury phenotypes of telangiectasia, fibrosis and atrophy in breast cancer patients have distinct genotype-dependent causes. Br J Cancer, 2007; 96:1001.

Hoeijmakers

. Genome maintenance mechanisms for preventing cancer. Nature, 2001; 411:366.

de Boer

, Hoeijmakers

. Nucleotide excision repair and human syndromes. Carcinogenesis, 2000; 21:453.

10.

Whitehouse

, Taylor

, Thistlethwaite

et al. XRCC1 stimulates human polynucleotide kinase activity at damaged DNA termini and accelerates DNA single-strand break repair. Cell, 2001; 104:107.

11.

Caldecott

. XRCC1 and DNA strand break repair. DNA Repair (Amst), 2003; 2:955.

12.

Thompson

, West

. XRCC1 keeps DNA from getting stranded. Mutat Res, 2000; 459:1.

13.

Zhang

, Miao

, Liang

et al. Polymorphisms in DNA base excision repair genes ADPRT and XRCC1 and risk of lung cancer. Cancer Res, 2005; 65:722.

14.

Mohrenweiser

, Xi

, Vazquez-Matias

et al. Identification of 127 amino acid substitution variants in screening 37 DNA repair genes in humans. Cancer Epidemiol Biomarkers Prev, 2002; 11:1054.

15.

Hao

, Miao

, Li

et al. A novel T-77C polymorphism in DNA repair gene XRCC1 contributes to diminished promoter activity and increased risk of non-small cell lung cancer. Oncogene, 2006; 25:3613.

16.

Patel

, Calle

, Pavluck

et al. A prospective study of XRCC1 (X-ray cross-complementing group 1) polymorphisms and breast cancer risk. Breast Cancer Res, 2005; 7:R1168.

17.

Miao

, Zhang

et al. Adenosine diphosphate ribosyl transferase and x-ray repair cross-complementing 1 polymorphisms in gastric cardia cancer. Gastroenterology, 2006; 131:420.

18.

Ragaz

, Jackson

, Le

et al. Adjuvant radiotherapy and chemotherapy in node-positive premenopausal women with breast cancer. N Engl J Med, 1997; 337:956.

19.

Muss

, Cooper

, Brockschmidt

et al. Arandomized trial of chemotherapy (L-PAM vs CMF) and irradiation for node positive breast cancer: Eleven year follow-up of a Piedmont Oncology Association trial. Breast Cancer Res Treat, 1991; 19:77.

20.

Griem

, Henderson

, Gelman

et al. The 5-year results of a randomized trial of adjuvant radiationtherapy after chemotherapy in breast cancer patients treated with mastectomy. J Clin Oncol, 1987; 5:1546.

21.

Olson

, Neuberg

, Pandya

et al. The role of radiotherapy in the management of operable locally advanced breast carcinoma: Results of a randomized trial by the Eastern Cooperative Oncology Group. Cancer, 1997; 79:1138.

22.

Overgaard

, Hansen

, Overgaard

et al. Postoperative radiotherapy in high-risk premenopausal women with breast cancer who receive adjuvant chemotherapy: Danish Breast Cance Coopera-tive Group 82b Trial. N Engl J Med, 1997; 37:949.

23.

The Common Terminology Criteria for Adverse Events (CTCAE) v3.0. http://ctep.cancer.gov/protocolDevelopment/electronic_applications/docs/ctcaev3.pdf. 2004 July 1.

24.

, Ma

, Lu

et al. A promoter polymorphism (−77T>C) of DNA repair gene XRCC1 is associated with risk of lung cancer in relation to tobacco smoking. Pharmacogenet Genomics, 2005; 15:457.

25.

Andreassen

, Alsner

, Overgaard

et al. Prediction of normal tissue radiosensitivity from polymorphisms in candidate genes. Radiother Oncol, 2003; 69:127.

26.

Andreassen

, Alsner

, Overgaard

et al. TGFB1 polymorphisms are associated with risk of late normal tissue complications in the breast after radiotherapy for early breast cancer. Radiother Oncol, 2005; 75:18.

27.

Andreassen

, Alsner

, Overgaard

et al. Risk of radiation-induced subcutaneous fibrosis in relation to single nucleotide polymorphisms in TGFB1, SOD2, XRCC1, XRCC3, APEX and ATM–a study based on DNA from formalin fixed paraffin embedded tissue samples. Int J Radiat Biol, 2006; 82:577.

28.

Brem

, Cox

, Chapot

et al. The XRCC1–77T->C variant: Haplotypes, breast cancer risk, response to radiotherapy and the cellular response to DNA damage. Carcinogenesis, 2006; 27:2469.

29.

Burri

, Stock

, Cesaretti

et al. Association of single nucleotide polymorphisms in SOD2, XRCC1 and XRCC3 with susceptibility for the development of adverse effects resulting from radiotherapy for prostate cancer. Radiat Res, 2008; 170:49.

30.

Chang-Claude

, Ambrosone

, Lilla

et al. Genetic polymorphisms in DNA repair and damage response genes and late normal tissue complications of radiotherapy for breast cancer. Br J Cancer, 2009; 100:1680.

31.

De Ruyck

, Van Eijkeren

, Claes

et al. Radiation-induced damage to normal tissues after radiotherapy in patients treated for gynecologic tumors: Association with single nucleotide polymorphisms in XRCC1, XRCC3, and OGG1 genes and in vitro chromosomal radiosensitivity in lymphocytes. Int J Radiat Oncol Biol Phys, 2005; 62:1140.

32.

Moullan

, Cox

, Angele

et al. Polymorphisms in the DNA repair gene XRCC1, breast cancer risk, and response to radiotherapy. Cancer Epidemiol Biomarkers Prev, 2003; 12:1168.

33.

Popanda

, Marquardt

, Chang-Claude

et al. Genetic variation in normal tissue toxicity induced by ionizing radiation. Mutat Res, 2009; 667:58.

34.

Suga

, Ishikawa

, Kohda

et al. Haplotype-based analysis of genes associated with risk of adverse skin reactions after radiotherapy in breast cancer patients. Int J Radiat Oncol Biol Phys, 2007; 69:685.

35.

Suga

, Iwakawa

, Tsuji

et al. Influence of multiple genetic polymorphisms on genitourinary morbidity after carbon ion radiotherapy for prostate cancer. Int J Radiat Oncol Biol Phys, 2008; 72:808.

36.

Andreassen

, Alsner

. Genetic variants and normal tissue toxicity after radiotherapy: A systematic review. Radiother Oncol, 2009; 92:299.

37.

Alsner

, Andreassen

, Overgaard

. Genetic markers for prediction of normal tissue toxicity after radiotherapy. Semin Radiat Oncol, 2008; 18:126.