Knockdown of Osteopontin Chemosensitizes MDA-MB-231 Cells to Cyclophosphamide by Enhancing Apoptosis Through Activating p38 MAPK Pathway

Abstract

Cyclophosphamide (CTX) is a commonly used chemotherapeutic agent for breast cancer. However, chemoresistance remains a common clinical problem. Osteopontin (OPN) has been shown to induce chemoresistance by inhibiting apoptosis; p38 MAPK pathway has been reported to be involved in chemotherapy-induced apoptosis. Thus, this study investigated whether OPN knockdown would chemosensitize MDA-MB-231 cells to CTX by enhancing apoptosis through activating p38 MAPK pathway. MDA-MB-231 cells were transfected with OPN stable siRNA plasmid, and it was found that OPN knockdown chemosensitized MDA-MB-231 cells to CTX, which is dependent on p38 MAPK pathway activation. Moreover, results showed that each of OPN knockdown and CTX could induce apoptosis through activating p38 MAPK pathway and that OPN knockdown and CTX could induce enhanced apoptosis through activating p38 MAPK pathway synergistically. Therefore, this study concludes that OPN knockdown chemosensitizes MDA-MB-231 cells to CTX by enhancing apoptosis through activating p38 MAPK pathway.

Introduction

Breast cancer, the most common malignant tumor worldwide, is one of the leading causes of cancer-related deaths in women.¹ The last two decades has witnessed a decline in breast cancer mortality rate, which is partly attributed to adjuvant therapy.² Among various agents, cyclophosphamide (CTX) exerts its cytotoxicity by damaging DNA. However, chemoresistance, primarily existed or acquired, remains a common clinical problem in the treatment of breast cancer.

Osteopontin (OPN), highly expressed in several types of cancers,^3
–5 has been recently shown to induce chemoresistance to DNA-damaging chemotherapeutic drugs by inhibiting apoptosis.^6,7 Moreover, knockdown of OPN has been reported to chemosensitize hepatocellular carcinoma cells to chemotherapeutic agents through apoptosis. However, whether knockdown of OPN would chemosensitize MDA-MB-231 cells to CTX by enhancing apoptosis has not been investigated. In addition, a growing body of evidence revealed that p38 MAPK pathway has proapoptotic activity in cells exposed to various agents^8,9 and that several chemotherapeutic agents induce apoptosis via activating p38 MAPK pathway,^10,11 justifying a critical role of p38 MAPK pathway in apoptosis-mediated chemosensitivity. Thus, the present study hypothesizes that knockdown of OPN induces chemosensitivity to CTX by enhancing apoptosis through activating p38 MAPK pathway.

In the present study, in vitro experiments were conducted to determine whether knockdown of OPN by RNA interference would chemosensitize MDA-MB-231 cells to CTX by enhancing apoptosis through activating p38 MAPK pathway.

Materials and Methods

Cell culture

MDA-MB-231 cells, obtained from Heilongjiang Cancer Institute, Harbin, China, were cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS; Invitrogen), 100 U/mL penicillin, and 100 μg/mL streptomycin at 37°C in a humidified atmosphere of 5% CO₂ and 95% air.

Transfection of stable siRNA plasmids

For stable RNA interference, hairpin siRNA sequences that contain both sense and antisense siRNA inserts were employed. Three pairs of hairpin siRNA inserts targeting human OPN (NM_000582) were employed: one (OPN#1) that was previously described¹² was sense 5′-ACGAGUCAGCUGGAUGACC-3′, antisense 5′-GGUCAUCCAGCUGACUCGU-3′; one (OPN#2) that was designed was sense 5′-GUUUCGCAGACCUGACAUC-3′, antisense 5′-GAUGUCAGGUCUGCGAAAC-3′; and another (OPN#3) that was also designed was sense 5′-AGCGAGGAGUUGAAUGGUG-3′, antisense 5′-CACCAUUCAACUCCUCGCU-3′. In addition, a pair of hairpin siRNA inserts (sense, 5′–3′ AUUGCGUUCGCAGUAAUCU; antisense, 5′–3′ AGAUUACUGCGAACGCAAU) that had no significant homology to any human mRNA was used as a control. The structure of a hairpin siRNA consists of two inverted sense and antisense inserts separated by a short spacer sequence (UUCAAGAGA) as the loop and ends with a string of U's. These sequences were chemically synthesized by Shanghai Gene Chem Co., Ltd. Plasmids were constructed by inserting these hairpin siRNA sequences into pSilencer 2.1-U6 neo vectors (Ambion). Hence, pSilencer vectors contained either OPN siRNA sequences or negative control siRNA sequences. Plasmids were thereafter amplified and purified using QIAfilter Plasmid Maxi Kit (Qiagen) and verified by sequence analysis.

MDA-MB-231 cells were divided into three groups: OPN RNAi (pS-OPN), control RNAi (pS-CO), and wild type (WT). Afterward, pS-OPN, pS-CO, and WT were incubated with OPN siRNA plasmid-Lipofectamine 2000 complex, control siRNA plasmid-Lipofectamine 2000 complex, or Lipofectamine 2000 alone in the absence of plasmid, respectively. MDA-MB-231 cell transfection was performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Forty-eight (48) hours after transfection, the cells were incubated in DMEM supplemented with G418 (400 μg/mL). After 2 weeks of growth in G418-containing DMEM, G418-resistant cells that stably expressed OPN siRNA (pS-OPN) or control siRNA (pS-CO) were selected and used to perform later experiments.

Protein preparation and western blot analysis

Total cell cytoplasmic extracts were prepared as previously described.¹³ Then, total protein concentration was determined by BCA Protein Assay kit (Pierce). Twenty (20) micrograms of each soluble protein sample was separated by 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to presoaked nitrocellulose membranes that were blocked with 3% bovine serum albumin for 2 hours. Afterward, the membranes were incubated overnight with primary mouse antibodies against human OPN (Santa Cruz), β-actin (Abcam), p38 (Santa Cruz), or anti-phospho-p38 (Sigma-Aldrich) at 4°C. Membranes incubated with primary antibodies were then exposed to horseradish peroxidase-conjugated anti-mouse IgG for 2 hours at room temperature. Proteins were detected by enhanced chemiluminescence. Bands were then scanned into Adobe Photoshop 7.0 and relative absorbance was calculated in Tina 2.0 in reference to β-actin. All experiments were run in triplicate.

Quantitative real-time polymerase chain reaction

Cells were harvested and total RNA was extracted using RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. First-strand cDNA was synthesized for each RNA sample using Superscript II RT Kit (Gibco-BRL). Real-time polymerase chain reaction (PCR) using SYBR Green I (Invitrogen) was performed on an ABI Prism 7000 Sequence Detection System (Applied Biosystem). Primers for OPN are as follows: forward, 5′–3′ CTGACATCCAGTACCCTGATGC; reverse, 5′–3′ GGCCTTGTATGCACCATTCA. The primer sequences for GAPDH are as follows: forward, 5′–3′ AAGATCATCAGCAATGCCTCC; reverse, 5′–3′ TGGACTGTGGTCATGCCTT. Real-time PCR was performed as follows: 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. All samples were run in triplicate. The quantitative real-time PCR results for OPN that were normalized to the amount of GAPDH mRNA from the same sample were expressed as fold increase or decrease.

MTT assay

After G418-resistant cell selection, cells were harvested and inoculated at a density of 5000 cells/well onto 96-well plates in 100 μL of DMEM supplemented with 10% FBS and were then cultured for 24, 48, 72, and 96 hours. Older medium was replaced by 100 μL of fresh serum-free DMEM every 24 hours. Then, 10 μL of MTT reagent (5 mg/mL; Sigma) was added into each well and the cells were incubated for additional 4 hours in a CO₂ incubator (NAPCO). Afterward, the medium was removed and 100 μL of dimethyl sulfoxide was added to dissolve formazan. Results were assessed on a microplate reader by measuring the absorbance at a wavelength of 540 nm and a reference wavelength of 630 nm. Relative cell numbers were calculated as the ratio of optical density (OD) between test samples and control samples (WT). All experiments were performed in triplicate.

Cell cycle distribution analysis

Cells were plated in 60-mm dishes and allowed to grow for 48 hours. The cells were collected by trypsinization. Then, the cells were washed in PBS and fixed in 70% ethanol. After treatment with RNAase (200 μg/mL) for 30 minutes at 37°C, 50 μg/mL propidium iodide was added. Afterward, DNA content was measured through a FACScan flow cytometry (Becton Dickinson). The experiments were carried out in triplicate.

TUNEL assay

Cells were harvested and inoculated at a density of 5000 cells/well onto 96-well plates and incubated in 100 μL DMEM supplemented with 10% FBS for 48 hours. Afterward, the cells were mounted on eight-well chamber slides of 1000 cells per 100 μL and fixed by 4% paraformaldehyde in PBS for 1 hour. Then, apoptosis was analyzed by TUNEL assay (Roche) according to the manufacturer's protocols. Apoptotic cells were identified as those that were stained yellow-brown with pyknotic nuclei under a microscope. Apoptotic cells were counted and results were calculated as a mean percentage of apoptotic cells counted in five fields per chamber.

Chemosensitivity assay

After cell selection, cells were harvested and inoculated at a density of 5000 cells/well onto 96-well plates and incubated in 100 μL fresh serum-free DMEM containing various concentrations of CTX (0.01, 0.1, 1, 10, and 50 mM) for 48 hours. MTT assay was performed as mentioned earlier to evaluate chemosensitivity to CTX.

Statistical analysis

Data were expressed as means ± SD of triplicate samples in single experiments. Student's t-test was used to compare between two groups. All the statistical analyses were performed on SPSS 16.0 and a value of p < 0.05 was considered statistically significant.

Results

RNAi decreased OPN protein and mRNA expressions

Detection of OPN protein in cytoplasmic extracts by western blot analysis showed that OPN#1 was successful in suppressing OPN protein expression, whereas OPN#2 and OPN#3 were unsuccessful (Fig. 1A). Statistically, with reference to WT, the expression of OPN protein was significantly lower in pS-OPN (OPN#1) than in WT (p = 1.1 × 10⁻⁵ < 0.05), but pS-OPN (OPN#2), pS-OPN (OPN#3), and pS-CO were similar to WT (Fig. 1B). Moreover, similar results were found for OPN mRNA expression (Fig. 1C). These findings indicate that OPN knockdown by OPN#1 was successful and effective. Thus, in later experiments, only pS-OPN (OPN#1) was used.

FIG. 1.

RNAi decreased OPN protein and mRNA expressions. (A) Detection of OPN protein by western blot was performed at 48 hours after G418-resistant cell selection. With reference to β-actin, OPN protein expression was lower in pS-OPN (OPN#1) than in WT, whereas it did not differ among pS-OPN (OPN#2), pS-OPN (OPN#3), pS-CO, and WT. (B) Bands were scanned into Adobe Photoshop and relative absorbance was calculated in Tina 2.0 with reference to β-actin. Relative expression of OPN protein was significantly lower in pS-OPN (OPN#1) than in WT (p = 1.1 × 10⁻⁵ < 0.05), as * indicates. In contrast, pS-OPN (OPN#2), pS-OPN (OPN#3), pS-CO, and WT were similar regarding OPN protein expression levels. (C) Detection of OPN mRNA expression was performed using real-time polymerase chain reaction at 48 hours after cell selection. The relative expression of OPN mRNA was significantly lower in pS-OPN (OPN#1) than in WT (p = 2.29 × 10⁻⁷ < 0.05), as * indicates, whereas it was similar among pS-OPN (OPN#2), pS-OPN (OPN#3), pS-CO, and WT. OPN, osteopontin.

Effects of CTX on MDA-MB-231 cells

The effects of CTX on MDA-MB-231 cells were studied. To exclude the effects of OPN knockdown, the WT group was specifically studied. First, MDA-MB-231 cells were exposed to various concentrations of CTX (0.01, 0.1, 1, 10, and 50 mM) and it was found that MDA-MB-231 cells were sensitive to CTX (Fig. 2A). Then, whether this effect was due to cell apoptosis was investigated. TUNEL assay was performed and it was found that CTX was able to induce cell apoptosis (Fig. 2B). In search of a target responsible for apoptosis induced by CTX, western blot analysis of p38 MAPK (p38) and the phosphorylation state of p38 MAPK (p-p38) was performed, and it was found that CTX was able to activate p38 MAPK pathway (Fig. 2C). Then, it was curious to know whether the activation of p38 MAPK pathway is essential for CTX-induced apoptosis. So, the activity of p38 MAPK pathway was inhibited using SB202190, a p38-specific inhibitor, and it was found that SB202190 was able to inhibit p38 MAPK activity (Fig. 2C) and that the inhibition of p38 MAPK activity was able to attenuate the CTX-induced apoptosis (Fig. 2B), indicating that CTX induces apoptosis through activating p38 MAPK. Moreover, results showed that attenuation of CTX-induced apoptosis by SB202190 resulted in attenuation of CTX-induced toxicity (Fig. 2A). Therefore, these findings suggested that CTX exerts its toxic effects on MDA-MB-231 cells by inducing cell apoptosis through activating p38 MAPK pathway.

FIG. 2.

Effects of CTX on MDA-MB-231 cells. (A) After cell selection, cells were exposed to 0.01, 0.1, 1, 10, and 50 mM CTX for 48 hours. Viable cell percentage was calculated with reference to WT that was not exposed to CTX [WT (control)]. With reference to WT (control), viable cell percentage in WT (CTX) was increasingly lower with the increase in CTX concentration, indicating that MDA-MB-231 cells were sensitive to CTX. Viable cell percentage was significantly higher in WT (CTX) pretreated with SB202190 than in WT (CTX) (*p = 0.03, 0.04, 5.87 × 10⁻⁴, 1.44 × 10⁻⁴, and 7.85 × 10⁻⁶ for 0.01, 0.1, 1, 10, and 50 mM CTX, respectively). (B) After cell selection, WT cells were incubated in DMEM supplemented with 10 mM CTX [WT (CTX)] or in DMEM without CTX [WT (control)] for 48 hours. Moreover, a portion of WT cells were pretreated with SB202190 for 2 hours and then incubated in DMEM with 10 mM CTX for 48 hours [WT (CTX) with SB202190]. WT (CTX) had significantly more apoptotic cells than WT (control) (**p = 3.49 × 10⁻⁶). WT (CTX) pretreated with SB202190 had significantly fewer apoptotic cells than WT (CTX) (*p = 5.19 × 10⁻⁵). (C) Forty-eight (48) hours after cell selection, p38 and p-p38 expressions were analyzed through western blot. Both p38 and p-p38 expressions were higher in WT (CTX) than in WT (control). In addition, p-p38 expression levels were lower in WT (CTX) with SB202190 than in WT (CTX). CTX, cyclophosphamide; DMEM, Dulbecco's modified Eagle's medium.

Chemosensitivity assay

To study whether OPN knockdown would chemosensitize MDA-MB-231 cells to CTX, pS-OPN, pS-CO, and WT were exposed to various concentrations of CTX for 48 hours (0.01, 0.1, 1, 10, and 50 mM). As shown in Figure 3A, pS-OPN was significantly more sensitive to CTX than pS-CO and WT, indicating that OPN knockdown was able to chemosensitize MDA-MB-231 cells to CTX.

FIG. 3.

Effects of OPN knockdown on MDA-MB-231 cells. (A) Chemosensitivity assay. After cell selection, cells were exposed to 0.01, 0.1, 1, 10, and 50 mM CTX for 48 hours. Viable cell percentage was calculated with reference to WT that was not exposed to CTX [WT (control)]. Viable cell percentage was significantly lower in pS-OPN than in pS-CO and WT (*p = 0.012, 0.005, 0.001, 0.001, and 0.014 for 0.01, 0.1, 1, 10, and 50 mM CTX, respectively, for pS-OPN vs. pS-CO; and p = 0.0018, 0.004, 0.005, 0.005, and 0.034 for 0.01, 0.1, 1, 10, and 50 mM CTX, respectively, for pS-OPN vs. WT). In a later experiment, pS-OPN was pretreated with SB202190 for 2 hours and exposed to various concentrations of CTX for 48 hours. Compared with pS-OPN, viable cell percentage was significantly higher in pS-OPN pretreated with SB202190 (**p = 0.002, 0.001, 0.001, 3.8 × 10⁻⁴, and 0.003 for 0.01, 0.1, 1, 10, and 50 mM CTX, respectively). (B) After cell selection, cells were harvested and inoculated at a density of 5000 cells/well onto 96-well plates and incubated in 100 μL DMEM containing 10% fetal bovine serum. MTT assay was employed to assess cell viability after 24, 48, 72, and 96 hours, as measured by optical absorbance (OD) at 540/630 nm. Cell proliferation rates were significantly lower for pS-OPN than pS-CO and WT (*^,†,‡ p = 0.02, 2.08 × 10⁻⁴, and 3.44 × 10⁻⁵ for 48, 72, and 96 hours, respectively, for pS-OPN vs. pS-CO; and p = 0.003, 4.26 × 10⁻⁵, and 1.33 × 10⁻⁴ for 48, 72, and 96 hours, respectively, for pS-OPN vs. WT). (C) Cell cycle distributions were analyzed through FACScan flow cytometry in pS-OPN, pS-CO, and WT. Statistical analysis of cell cycle distributions among pS-OPN, pS-CO, and WT showed that they were similar regarding cell cycle distributions. (D) Cell apoptosis was analyzed by TUNEL assay at 48 hours after cell selection. Apoptotic cells (pyknosis) were scant in pS-CO and WT, whereas they were relatively profuse in pS-OPN. In a later experiment, pS-OPN pretreated with 20 μM SB202190 (p38-specific inhibitor) for 2 hours harbored fewer apoptotic cells than pS-OPN. (E) Apoptotic cells that were pyknotic, as shown in part D, were counted under a microscope. Results were calculated as a mean percentage of apoptotic cells counted in five fields per chamber. pS-OPN had significantly more apoptotic cells than pS-CO and WT (**p = 1.18 × 10⁻⁴ and 1.10 × 10⁻⁴ for pS-OPN vs. pS-CO and pS-OPN vs. WT, respectively). Moreover, pS-OPN pretreated with SB202190 had significantly fewer apoptotic cells than pS-OPN (*p = 7.58 × 10⁻⁴). (F) Forty-eight (48) hours after cell selection, p38 and p-p38 expressions were analyzed by western blot. With reference to β-actin, both p38 and p-p38 expressions were higher in pS-OPN than in pS-CO and WT, and p-p38 expression levels were lower in pS-OPN pretreated with SB202190 than in pS-OPN.

To explore the mechanisms wherein OPN knockdown chemosensitizes MDA-MB-231 cells to CTX, the effects of OPN knockdown on MDA-MB-231 cells were investigated. Results showed that the cell proliferation rate of pS-OPN was significantly lower than those of pS-CO and WT (Fig. 3B), indicating that knockdown of OPN inhibits cell proliferation. In addition, cell cycle distribution analysis and TUNEL assay were performed to investigate whether the inhibition of cell proliferation was due to cell cycle arrest or apoptosis. It was found that OPN knockdown did not influence cell cycle distribution (Fig. 3C) but was able to induce cell apoptosis (Fig. 3D. E), indicating that OPN knockdown inhibited cell proliferation through apoptosis rather than through cell cycle arrest. Results showed that both p38 and p-p38 expressions were higher in pS-OPN than in pS-CO and WT (Fig. 3F), indicating that OPN knockdown was able to activate p38 MAPK pathway. Moreover, it was found that SB202190 was able to inhibit p38 MAPK activity (Fig. 3F) and that inhibition of p38 MAPK activation by SB202190 was able to attenuate OPN knockdown-induced apoptosis (Fig. 3D. E), indicating that p38 MAPK activation was essential for OPN knockdown-induced apoptosis. These results suggest that OPN knockdown was able to induce cell apoptosis through activating p38 MAPK pathway.

As mentioned earlier, both CTX and OPN knockdowns were able to induce cell apoptosis through activating p38 MAPK pathway. It was curious to know whether this chemosensitive effect was due to their synergism to induce cell apoptosis. It was found that there were significantly more apoptotic cells in pS-OPN that was exposed to CTX than in pS-CO and WT that were also exposed to CTX, or in pS-OPN that was not exposed to CTX (Fig. 4A), indicating that OPN knockdown and CTX were able to induce enhanced apoptosis synergistically. Moreover, results showed that OPN knockdown and CTX induced enhanced activation of p38 MAPK pathway synergistically (Fig. 4B). To investigate whether the activation of p38 MAPK pathway was essential for enhanced apoptosis and chemosensitivity, pS-OPN cells were pretreated with SB202190. Results showed that SB202190 can inhibit p38 MAPK activity (Fig. 4B). Moreover, it was found that the inhibition of p38 MAPK activity was able to attenuate enhanced apoptosis (Fig. 4A) and that the resulting attenuated apoptosis was able to abrogate chemosensitivity (Fig. 3A).

FIG. 4.

(A) After cell selection, pS-OPN, pS-CO, and WT were exposed to 10 mM CTX for 48 hours, and cell apoptosis was assessed by TUNEL assay. pS-OPN exposed to CTX had significantly more apoptotic cells than pS-CO and WT that were exposed to CTX (*p = 4.37 × 10⁻⁴ and 4.11 × 10⁻⁵ for pS-OPN vs. pS-CO and pS-OPN vs. WT, respectively); pS-OPN exposed to CTX had significantly more apoptotic cells than pS-OPN not exposed to CTX (**p = 1.33 × 10⁻⁵). In addition, pS-OPN that was pretreated with SB202190 and then exposed to CTX harbored significantly fewer apoptotic cells than pS-OPN that was exposed to CTX (***p = 2.37 × 10⁻⁵). (B) After exposure to 10 mM CTX for 48 hours, p38 and p-p38 expressions were analyzed by western blot. Both p38 and p-p38 expressions were higher in pS-OPN that was exposed to CTX than in pS-CO and WT that were also exposed to CTX or in pS-OPN that was not exposed to CTX. Moreover, p-p38 levels were lower in pS-OPN (CTX) pretreated with SB202190 than in pS-OPN (CTX).

Discussion

CTX, an alkylating agent, exerts its cytotoxic effects via transferring alkyl groups to DNA. The resulting damaged DNA would lead to DNA double-strand breakage (DDSB), which in turn interferes with normal cellular functions and leads to cell death. Apoptosis is the final common pathway of cell death induced by many chemotherapeutic drugs.^14,15 It has been reported that several chemotherapeutic agents induce cancer cell apoptosis through activating p38 MAPK pathway^10,11,16 and that p38 MAPK pathway activation is essential in cell apoptosis in both cancer and noncancer cells.^17,18 Similarly, in the present study, it was found that CTX exerts its toxicity through cell apoptosis by activating p38 MAPK pathway. However, the detailed mechanisms underlying how CTX activates p38 pathway are unknown. Given that DDSB was able to activate p38 MAPK pathway^19
–21 and that CTX could induce DDSB, in the present study, it was speculated that CTX activates p38 MAPK pathway via DDSB.

Results showed that OPN knockdown was able to chemosensitize MDA-MB-231 cells to CTX. This is consistent with studies previously reported in which OPN induces chemoresistance to therapeutic drugs^6,7 and OPN knockdown chemosensitizes hepatocellular carcinoma cells to chemotherapeutic agents through apoptosis.²² To find out the mechanism wherein OPN knockdown chemosensitized MDA-MB-231 cells to CTX, the effects of OPN knockdown on MDA-MB-231 cells were studied.

It was found that knockdown of OPN was able to inhibit cell proliferation through inducing cell apoptosis by activating p38 MAPK pathway. This is in line with studies reported elsewhere in which suppression of OPN inhibits cell proliferation of other histological types of cancer cells, including liver cancer cells,²² brain cancer cells,²³ and prostatic cancer cells,²⁴ but disagrees with a study by Du et al.,²⁵ in which suppression of OPN does not influence cell proliferation of human endometrial cancer cells. This disagreement can be attributed to different histological origins of the experimental cell lines. However, the detailed mechanisms underlying the disagreement are poorly understood.

As mentioned earlier, both CTX and OPN knockdowns were able to induce cell apoptosis through activating p38 MAPK pathway. However, whether the mechanisms underlying chemosensitivity are governed by their synergistic effects on cell apoptosis is unknown. Therefore, the combined effects of CTX and OPN knockdown on MDA-MB-231 cells were investigated. It was found in the present study that OPN knockdown and CTX could induce enhanced apoptosis and enhanced activation of p38 MAPK pathway synergistically. In addition, inhibition of enhanced activation of p38 MAPK pathway can attenuate enhanced cell apoptosis, indicating that OPN knockdown enhances CTX-induced cell apoptosis by enhancing CTX-induced p38 MAPK activation. Moreover, the resulting attenuated enhanced apoptosis in turn abrogated chemosensitivity induced by OPN knockdown. Thus, these findings suggest that OPN knockdown chemosensitizes MDA-MB-231 cells to CTX through enhancing apoptosis by enhancing p38 MAPK activation.

Conclusions

In conclusion, the present work provides evidence for the first time that OPN knockdown is able to chemosensitize MDA-MB-231 cells to CTX. Specifically, the present study shows for the first time that each of OPN knockdown and CTX is able to induce cell apoptosis through activating p38 MAPK pathway and that OPN knockdown and CTX are able to induce enhanced apoptosis through activating p38 MAPK pathway synergistically. Inhibition of p38 MAPK pathway could attenuate enhanced apoptosis and the resulting attenuated enhanced apoptosis in turn abrogated chemosensitivity. Therefore, the present study concludes that knockdown of OPN chemosensitizes MDA-MB-231 cells to CTX by enhancing apoptosis through activating p38 MAPK pathway.

Footnotes

Disclosure Statement

No financial conflicts exist.

References

Hortobagyi

, de la Garza Salazar

, Pritchard

et al. The global breast cancer burden: Variations in epidemiology and survival. Clin Breast Cancer, 2005; 6:391.

Early Breast Cancer Trialists' Collaborative Group. Effects of chemotherapy and hormonal therapy for early breast cancer on recurrence and 15-year survival: An overview of the randomised trials. Lancet, 2005; 365:1687.

Gillespie

, Thomas

, Pu

et al. Calcitonin receptors, bone sialoprotein and osteopontin are expressed in primary breast cancers. Int J Cancer, 1997; 73:812.

, Yokozaki

, Kitadai

et al. Co-expression of osteopontin and CD44v9 in gastric cancer. Int J Cancer, 1998; 79:127.

Zhang

, Takahashi

et al. Differential osteopontin expression in lung cancer. Cancer Lett, 2001; 171:215.

, Ohashi

, Cui

et al. Osteopontin is involved in the development of acquired chemo-resistance of cisplatin in small cell lung cancer. Lung Cancer, 2009; 66:176.

Graessmann

, Berg

, Fuchs

et al. Chemotherapy resistance of mouse WAP-SVT/t breast cancer cells is mediated by osteopontin, inhibiting apoptosis downstream of caspase-3. Oncogene, 2007; 26:2840.

Reshkin

, Bellizzi

, Cardone

et al. Paclitaxel induces apoptosis via protein kinase A- and p38 mitogen-activated protein-dependent inhibition of the Na +/H + exchanger (NHE) NHE isoform 1 in human breast cancer cells. Clin Cancer Res, 2003; 9:2366.

Cheng

, Chang

, Tsou

. Mitogen-activated protein kinases mediate arsenic-induced down-regulation of survivin in human lung adenocarcinoma cells. Arch Toxicol, 2006; 80:310.

10.

Deacon

, Mistry

, Chernoff

et al. p38 Mitogen-activated protein kinase mediates cell death and p21-activated kinase mediates cell survival during chemotherapeutic drug-induced mitotic arrest. Mol Biol Cell, 2003; 14:2071.

11.

Xing

, Cao

, Weng

et al. Fibronectin-mediated activation of Akt2 protects human ovarian and breast cancer cells from docetaxel-induced apoptosis via inhibition of the p38 pathway. Apoptosis, 2008; 13:213.

12.

Shevde

, Samant

, Paik

et al. Osteopontin knockdown suppresses tumorigenicity of human metastatic breast carcinoma, MDA-MB-435. Clin Exp Metastasis, 2006; 23:123.

13.

Yin

, Hao

, Wang

et al. Downregulating osteopontin reduces angiotensin II-induced inflammatory activation in vascular smooth muscle cells. Inflamm Res, 2009; 58:67.

14.

Fisher

. Apoptosis in cancer therapy: Crossing the threshold. Cell, 1994; 78:539.

15.

Lowe

, Bodis

, McClatchey

et al. p53 status and the efficacy of cancer therapy in vivo. Science, 1994; 266:807.

16.

Losa

, Parada Cobo

, Viniegra

et al. Role of the p38 MAPK pathway in cisplatin-based therapy. Oncogene, 2003; 22:3998.

17.

Xia

, Dickens

, Raingeaud

et al. Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science, 1995; 270:1326.

18.

Lenassi

, Plemenitaš

. The role of p38 MAP kinase in cancer cell apoptosis. Radiol Oncol, 2006; 40:51.

19.

Pedraza-Alva

, Koulnis

, Charland

et al. Activation of p38 MAP kinase by DNA double-strand breaks in V(D)J recombination induces a G2/M cell cycle checkpoint. EMBO J, 2006; 25:763.

20.

Bulavin

, Amundson

, Fornace

. p38 and Chk1 kinases: Different conductors for the G(2)/M checkpoint symphony. Curr Opin Genet Dev, 2002; 12:92.

21.

Mikhailov

, Shinohara

, Rieder

. Topoisomerase II and histone deacetylase inhibitors delay the G2/M transition by triggering the p38 MAPK checkpoint pathway. J Cell Biol, 2004; 166:517.

22.

Zhao

, Dong

, Lu

et al. Down-regulation of osteopontin suppresses growth and metastasis of hepatocellular carcinoma via induction of apoptosis. Gastroenterology, 2008; 135:956.

23.

Lamour

, Le Mercier

, Lefranc

et al. Selective osteopontin knockdown exerts anti-tumoral activity in a human glioblastoma model. Int J Cancer, 2009; 126:1797.

24.

Liu

, Chen

, Guo

et al. A short-hairpin RNA targeting osteopontin downregulates MMP-2 and MMP-9 expressions in prostate cancer PC-3 cells. Cancer Lett, 2010; 295:27.

25.

, Jiang

, Sheng

et al. Inhibition of osteopontin suppresses in vitro and in vivo angiogenesis in endometrial cancer. Gynecol Oncol, 2009; 115:371.