Down-Regulation of Survivin and Hypoxia-Inducible Factor-1α by β-elemene Enhances the Radiosensitivity of Lung Adenocarcinoma Xenograft

Abstract

Elemene (1-methyl-1-vinyl-2,4-diisopropenyl-cyclohexane) is a naturally occurring compound that can be isolated from the traditional Chinese medicinal herb Curcuma wenyujin. β-elemene, its active component, has recently been demonstrated to enhance the radiosensitivity of human cancer cell lines in vitro and of one animal tumor in vivo. The underlying mechanism, however, is still unclear. In this study, we demonstrated for the first time that β-elemene significantly improves the radiosensitivity of A549 lung adenocarcinoma xenograft in vivo as measured by tumor regrowth delay experiments. Our results showed that β-elemene, at 45 mg/kg, significantly inhibited radiation-induced expression of survivin and hypoxia-inducible factor (HIF)-1α proteins. Because HIF-1α is known to regulate survivin transcription and acts as upstream regulator of survivin, it is possible that β-elemene regulates the transcription of survivin through HIF-1α. Our study suggests that β-elemene is a promising drug to enhance tumor radioresponse, and survivin and HIF-1α are novel targets of β-elemene.

Introduction

Lung cancer is the most prevalent cancer in men and women and the leading cause of cancer-related death worldwide.¹ Despite significant advances in lung cancer treatments during the past several decades, the overall 5-year survival rate is poor.¹ One of the factors for treatment failures is radiation resistance. Therefore, finding novel drugs to overcome radioresistance may be a feasible way to improve effectiveness of radiotherapy and, thereby, overall survival.

Elemene (1-methyl-1-vinyl-2,4-diisopropenyl-cyclohexane), a naturally occurring compound that can be isolated from the traditional Chinese medicinal herb Curcuma wenyujin, is a mixture of β-, γ- and δ-elemene with β-elemene being the active component. The antitumor activity of elemene was first found by Chinese researchers in the 1980s; since 1994, this agent has been used in the clinic as one of the national class II novel antitumor drugs in China.

Many preclinical studies and clinical trials have demonstrated that elemene possesses several potential advantages over conventional chemotherapy agents, including broad-spectrum antitumor activity, favorable toxicity profile, and the ability to penetrate the blood-brain barrier.^2,3 Therefore, elemene has been used in the management of a variety of solid tumors, malignant pleural effusion, peritoneal effusion, and brain metastases.^4,5 β-elemene subsequently has been extracted from the elemene compound since 1996.

Recently, β-elemene was approved as a national first-class new agent, and phase II clinical trials are currently ongoing. Many laboratory studies have focused on the mechanisms underlying the anticancer effects of β-elemene. Several studies showed that this novel agent enhanced the radiosensitivity of human cancer cell lines in vitro.^6
–8 One study demonstrated improved radiation sensitivity of rabbit VX2 carcinoma by β-elemene in vivo.⁹ No in vivo studies with human cancers, however, have been performed so far. While the in vitro studies have attributed the enhanced radiation response to increased apoptosis and cell G2/M arrest,^6,7,10,11 the underlying mechanisms are far from being clarified.

Survivin, a member of the family of inhibitors of apoptosis proteins (IAPs), has been found to be barely detectable in most normal adult tissues while being expressed at high levels in most human cancers, including non–small-cell lung cancer.¹² Survivin is regarded as a key regulator of cell division^13,14 and is expressed in a cell cycle-dependent manner. It is thought that survivin levels peak in the G2/M phase and that it can regulate microtubule dynamics by interacting with microtubules of the mitotic spindles.^13
–15 Moreover, current evidence suggests that survivin is compartmentalized in mitochondria and plays an antiapoptosis role.¹⁶

Hypoxia-inducible factor-1α (HIF-1α), an oxygen-sensitive HIF-1 subunit, can transcriptionally activate many genes that are critical for cellular function under hypoxic conditions.^17,18 HIF-1α has been found to directly bind to the survivin promoter and to positively regulate the transcriptional activity of surviving.¹⁹ In fact, survivin expression has been found to be significantly decreased by down-regulation of HIF-1α.^20,21

Human cancers with high expression levels of survivin or HIF-1α exhibit increased resistance to radiotherapy and are associated with higher risk of local recurrence and poor overall survival.^22

–26 Therefore, inhibition of survivin or HIF-1α may be a promising way to enhance tumor radiosensitivity. In this study, we investigated the antitumor activity of β-elemene at different dose levels on xenografts derived from A549 lung adenocarcinoma cell line in BALB/c nu/nu nude mice. Underlying mechanisms have been explored as well.

Materials and Methods

Chemicals and cell culture

β-elemene was purchased from Jingang Pharmaceutical Co. (Dalian, China). The human lung adenocarcinoma cell line A549 was purchased from the Cell Center of the Chinese Academy of Medical Sciences. Cells were grown in RPMI 1640 medium (Gibco-BRL/Invitrogen, Carlsbad, CA), supplemented with 10% fetal bovine serum (TBD Bio, Tianjin, China) at 37°C in a humidified atmosphere with 5% CO₂. Polyclonal antisurvivin, HIF-1α antibodies and HRP-conjugated secondary immunoglobulin G (IgG) antibodies were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA)

Animals and tumor models

Female athymic BALB/c nu/nu mice aged 6 to 8 weeks were purchased from the Animal Experiment Center of Dalian Medical University and maintained in specific pathogen-free condition. The facilities and the protocol for these experiments were consistent with the regulations of animal use for biomedical experiments issued by the Ministry of Science and Technology of China and approved by the Animal Care Committee of Dalian Medical University. A549 cells were subcutaneously injected into the right hind leg (1×10⁷ cells per animal). The tumor sizes were measured every 2 days using Vernier calipers. At 4 to 5 weeks, tumor volumes reached the required size (0.8–1.0 cm³). Tumor volumes were calculated using the following formula: 0.5×largest diameter×smallest diameter² as previously reported.²⁷

Xenograft treatment with β-elemene and/or radiation

Nude mice with tumors of 0.8 to 1.0 cm³ were randomized to eight groups (five mice per group), including a control group and seven treatment groups: β-elemene alone, radiation alone, and β-elemene combined with radiation. β-elemene doses were 25 mg/kg, 45 mg/kg, and 100 mg/kg. Radiation treatments were performed 1 hour after β-elemene was injected intraperitoneally. For radiation treatments, mice were placed in a specially designed polyvinylchloride box, and the right hind legs bearing xenograft tumors were pulled out of the box. The mice were immobilized, and tumors were placed in the center of a 4 cm×3 cm radiation field, with the rest of the body remaining outside of the radiation field. Radiation was delivered by 6 MeV electron beams from a linear accelerator (Varian) at a single dose of 5 Gy.

Assessment of xenograft response to treatment

The average tumor inhibition rate (ATIR) after monotherapy was calculated every day until tumors in the control group doubled in size. The formula for ATIR is (1 – volume of treatment group/volume of control group)×100%. The degree of tumor growth delay was expressed either as: (a) the absolute growth delay (defined as the time for tumors in the radiation group to grow from baseline to twice the size, minus the time for the tumors in the untreated control group to reach the same size); or (b) normalized growth delay (defined as the time for tumors in the cotreatment group to grow from baseline to twice the size, minus the time for the tumors in the group receiving a single treatment to reach the same size). The activity of β-elemene to enhance tumor radioresponse was evaluated by EF, the Enhancement Factor, which was calculated using the following formula: EF=normalized growth delay/absolute growth delay. When EF was greater than 1, the drug at this dose level was considered to enhance tumor response to radiation.²⁸ The optimal radiosensitizing dose was selected for later experiments based on EF calculations.

Western blot analysis

Mice were sacrificed, and the tumors (five from each group) were excised and cut into small pieces. The tumor pieces were mixed in radioimmunoprecipitation assay buffer, homogenized by Polytron. Protein concentrations from tumor lysates were determined by Bio-Rad assays. Equal amounts of proteins were separated on sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membrane, and probed with the indicated primary antibodies followed by secondary HRP-conjugated secondary IgG antibodies. The protein bands were detected by an image analyzer (Labworks Software, UVP, Upland, CA).

Reverse transcription-polymerase chain reaction (PCR) analysis

Total RNA from tumor tissues (five from each group) was isolated using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The reverse transcription-PCR analysis was performed using a RT-PCR kit (Takara, Otsu, Japan). The specific primer sequences were as follows: for survivin (5’ AGCCAGACTTGGCCCAGTGTTTC3’ and 5’ GCACTTTCTCCGCAGTTTCCTCA 3’) and β-actin (5’ CTGGGACGACATGGAGAAAA3’ and 5’ AAGGAAGGCTGGAAGAGTGC 3’); for HIF-1α (5′ ATGAAGTGTACCCTAACTAGCCG 3′ and 5′ GCTTGAGTTTCAACCCAGACATA 3′) and β-actin (5′ ATCATGTTTGAGACCTTCAACA3′ and 5′ CATCTCTTGCTCGAAGTCCA3′). The PCR protocol was as follows: Initial denaturation at 94°C for 2 minutes, followed by 35 cycles at 94°C for 30 seconds, annealing at 59°C (survivin) or 54°C (HIF-1α) for 30 seconds, and extension at 72°C for 1 minute. The final extension was performed by an incubation step at 72°C for 7 minutes. The PCR products were subjected to electrophoresis in agarose gel and visualized with ethidium bromide. The bands were analyzed with Quantity One software (Bio-Rad).

Hematoxylin and eosin staining and immunohistochemistry

The fresh tumor tissues were fixed in 10% formalin, embedded in paraffin, and cut into 4-μm thick sections. The sections were then stained with hematoxylin and eosin. Survivin and HIF-1α immunohistochemistry were performed as follows: Sections were stained with primary rabbit antihuman survivin and antihuman HIF-1α antibodies. After incubation with the respective HRP-conjugated goat antirabbit IgG, sections were visualized with the peroxidase substrate kit, followed by counterstaining with hematoxylin. We analyzed the results by IPP (Image-Pro Plus 6.0) software, using the method introduced by Wang and associates.²⁹

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay

The presence of apoptotic cells within the tumor sections was evaluated by TUNEL staining (Roche) according to the protocol. Percent apoptosis was determined by counting the number of apoptotic cells and dividing that by the total number of cells by using a light microscope.

Statistical analysis

The results of statistical analysis were presented as mean±standard deviation. The differences between the groups were tested by performing analysis of variance, and the levels of probability were noted.

Results

Antitumor activity of β-elemene alone

After treatment, tumor regression and regrowth were monitored until tumor volumes approximately doubled in size. Tumor volumes in each group were not statistically different on day 0. During the observation period, there was no significant β-elemene toxicity in any of the treatment groups. β-elemene, when used alone, showed antitumor activity in a dose dependent manner, as measured by ATIR (Fig. 1A, B). At 100 mg/kg, β-elemene had the highest ATIR in comparison with the other dose levels, while β-elemene (25 mg/kg) had the lowest ATIR. At the 100 mg/kg level, β-elemene also showed a higher ATIR than radiation alone.

FIG. 1.

Effect of treatment on the growth of xenografts in athymic BALB/c nu/nu mice aged 6 to 8 weeks. (A) Effect of three dose levels of β-elemene on tumor growth. (B) The average tumor inhibition rates (ATIR) of monotherapy were calculated by the formula: (1-volume of treatment group/volume of control group)×100%. The end point is 96 hours after tumors in control group reach double volumes. (C) Tumor regrowth delay effect of radiation alone or combined with three dose levels of β-elemene on tumor growth. The growth delay in the cotreatment group was more remarkable than radiation alone. (D) The tumor volume doubling time in each group are shown. β-elemene (100 mg/kg) plus radiation exhibited the longest volume doubling time. The results represented the mean±standard deviation of five mice in every group. RT, radiation therapy.

β-elemene enhanced radioresponse in xenografts

To determine whether β-elemene could improve radioresponse and to obtain an optimal dose to combine β-elemene with radiation, mice bearing 0.8 to 1.0-cm³ tumors were treated with 25 mg/kg, 45 mg/kg, or 100 mg/kg dose of β-elemene followed by radiation (5 Gy). There was significantly longer tumor regrowth delay when xenografts were treated with both β-elemene and radiation when β-elemene was given at or higher than the 45 mg/kg level (Fig. 1C). Moreover, the tumor volume doubling times in each group were obtained (Fig. 1D) to calculate the EFs of respective drug doses as described in Materials and Methods. The EFs of 25 mg/kg, 45 mg/kg, and 100 mg/kg dose were 0.84, 1.24, and 2.04, respectively. Because the drug is considered to exhibit synergistic effect with radiation only at a dose level where EF is greater than 1,²⁸ this suggested that there was a synergistic effect when at least 45 mg/kg β-elemene was used with radiation therapy. This dose level was subsequently selected for later experiments. The 100 mg/kg dose level was not chosen, to minimize the direct cytotoxic effect of β-elemene.

β-elemene decreases radiation-induced survivin mRNA/protein expression

Survivin expression levels were investigated by measuring mRNA and protein levels in tumor samples in the control, β-elemene alone (45 mg/kg), radiation (5 Gy) alone, and cotreatment groups (Fig. 2A and 2C). β-elemene alone at the dose of 45 mg/kg slightly inhibited survivin protein expression (1.12-fold lower). Survivin protein level was 1.16-fold higher in the radiation group when compared with the control group (Fig. 2B). Interestingly, survivin protein level was significantly decreased (2.23-fold lower) in the β-elemene/radiation cotreatment group (Fig. 2B) compared with the basal expression in the control group (p<0.05). Similar results were shown in survivin mRNA expression (Fig. 2D). In comparison with the control group, survivin mRNA levels were 1.7-fold higher in the radiation alone group and 1.46-fold lower in the cotreatment group (p<0.05). Interestingly, survivin mRNA was up 1.18-fold in the β-elemene group compared with the control group; this might be because of post-transcriptional regulation of survivin protein expression.

FIG. 2.

Survivin protein/mRNA expression in xenografts analyzed by Western blot (A) and reverse transcription-polymerase chain reaction (RT-PCR) (C). Control, β-elemene at 45 mg/kg, radiation at 5 Gy, or combination of β-elemene and radiation were used in the experiment. (B) Survivin protein levels from the Western blots after various treatments were quantified by relative optical density (OD)%. The results represented the mean±standard deviation (SD) of five mice in each treatment group. (D) Survivin mRNA was amplified by RT-PCR and quantified by relative OD. The results represented the mean±SD of five mice in every group.

β-elemene decreases radiation-induced HIF-1α mRNA/protein expression

HIF-1α mRNA/protein expression in xenografts was also investigated for the four treatment groups (Fig. 3A and 3C). At the dose of 45 mg/kg, the β-elemene alone group had higher mRNA levels (1.49-fold higher) than the control group but had lower HIF-1α protein levels compared with the control group (1.11-fold lower) (Fig. 3B and 3D). This might be because of the post-transcriptional regulatory mechanisms for HIF-1α. Radiation, however, increased HIF-1α expression at both the mRNA level (1.57-fold higher) and the protein level (1.14-fold higher) (Fig. 3B and 3D). In contrast, when radiation was combined with β-elemene, HIF-1α expression was significantly decreased at both the protein level (1.65-fold lower) and the mRNA level (1.49-fold lower) (p<0.05).

FIG. 3.

HIF-1α protein/mRNA expression in xenografts analyzed by Western blot (A) and reverse transcription-polymerase chain reaction (RT-PCR) (C). Control, β-elemene at 45 mg/kg, radiation at 5 Gy, or combination of β-elemene and radiation were used in the experiment. (B) HIF-1α protein levels from the Western blots after various treatments were quantified by relative optical density (OD)%. The results represented the mean±standard deviation (SD) of five mice in each treatment group. (D) HIF-1α mRNA was amplified by RT-PCR and quantified by relative OD. The results represented the mean±SD of five mice in every group.

Survivin/HIF-1α staining by immunohistochemistry

We further investigated survivin and HIF-1α expression in xenografts by immunohistochemistry. The staining results are shown in Figures 4A and 4C. The expression levels were detected by IPP 60 software and were plotted as integrated optical density (IOD) and mean IOD. As shown in Figures 4B and 4D , survivin and HIF-1α expression levels determined by immunohistochemistry were similar to those obtained by Western blot. β-elemene (45 mg/kg) alone had little effect on survivin and HIF-1α expression compared with the control group. Radiation alone significantly increased both survivin (p<0.01) and HIF-1α (p<0.05) compared with the control group. By contrast, when β-elemene was used together with radiation, expression levels of survivin and HIF-1α were significantly lower than in the control group (p<0.01).

FIG. 4.

The immunohistochemistry staining of survivin and HIF-1α in xenografts among four treatment groups. The expression of survivin and HIF-1α was analyzed by Image-Pro Plus 6.0 software. (A) and (C). The immunohistochemistry staining of survivin and HIF-1α are shown. (B) and (D). log₁₀ integrated optical density (IOD) and mean IOD of survivin and HIF-1α in treatment groups were compared with the control group. (*, p>0.05; **, p<0.05; ***, p<0.01). The results represented the mean±standard deviation of five mice in every group.

Increased apoptosis may be responsible for enhanced radiation response with β-elemene

Apoptosis in xenografts was determined by TUNEL assay. Apoptotic and live cells were counted under a light microscope, and percent apoptosis was recorded as the percent of apoptotic cells (Fig. 5A). As shown in Figure 5B , there were higher levels of apoptosis in the radiation group than in the control group (p<0.05). There were still higher levels of apoptosis, however, in tumor samples that were treated with both β-elemene and radiation compared with either of the monotherapies (p<0.05). β-elemene (45 mg/kg) alone also induced apoptosis, and significantly more apoptotic cells were detected in β-elemene treated tumors than in the control group (p<0.05).

FIG. 5.

Apoptosis was determined with a TUNEL assay kit. Apoptotic cells were counted under a light microscope and reported as a percentage of the total cells presented for evaluation. (A) The TUNEL staining of xenografts among four groups. (B) The apoptosis cell percentage is shown. β-elemene or radiation-induced apoptosis cells were higher compared with control group; however, cotreatment significantly increased the apoptotic cells compared with β-elemene or radiation (** p<0.05). The results represented the mean±standard deviation of five mice in every group.

Discussion

It has been reported that β-elemene has antitumor activities against many types of cancer cells in vitro and in vivo.^30

–34 Our laboratory has shown that β-elemene enhanced the sensitivity of the A549 lung adenocarcinoma cell line to radiation in vitro.^35,36 In this study, we explored the radiosensitizing effect of β-elemene on A549 xenograft tumors in vivo for the first time. We showed that β-elemene had antitumor activity in a dose-dependent manner, and it augmented tumor response to radiation when dose levels were higher than 45 mg/kg. β-elemene at the 100 mg/kg dose level had significant antitumor activity when used alone and was synergistic when administered before radiation. Because the main purpose of this study was to investigate the radiosensitizing mechanisms of β-elemene, however, this dose was ultimately not selected in order to reduce the influence of direct antitumor activity.

It is interesting to find that the EF of β-elemene at 25 mg/kg was less than 1, which may suggest an antagonism effect with radiation. Theoretically, at the 25 mg/kg level, at which dose an antitumor action has been demonstrated for β-elemene alone, at least an additive effect with radiation might be expected. β-elemene is a novel cytotoxic agent, and its interaction with radiation is far from clear. While it is possible that a low dose of β-elemene may antagonize the effect of radiation, it is also conceivable that the EF has limitations as a measure under certain conditions. This warrants further investigations in the near future. β-elemene is currently being tested in clinical trials in China, and the best dosage for patients has not been determined. Although the doses used in this study were derived from animal tumor model systems, the results may still provide a valuable reference to the clinic.

It has been demonstrated that β-elemene enhances the radiosensitivity of cancer cells to radiation partly by inducing apoptosis. Previous data have shown that β-elemene could influence the expression of apoptosis-related molecules such as caspase-3, Bcl-2, and Bax.^10,11 β-elemene has also been shown to enhance tumor radioresponse through induction of cell cycle arrest at the G2/M phase, but the exact mechanism is still unclear. Therefore, having demonstrated that β-elemene enhances tumor sensitivity to radiation in vivo and having determined the optimal experimental dose, we sought further to identify potential novel targets of β-elemene.

Survivin has been reported to be overexpressed in non–small-cell lung cancer,¹² and patients with higher survivin levels have been shown to have significantly shorter survival in comparison with patients with low survivin levels.³⁷ Cancer patients with high levels of survivin exhibit increased resistance to radiotherapy.^22
–24 Survivin has been regarded as a radioresistance factor in colorectal and pancreatic cancers.^38
–40 Thus, survivin is a suitable molecular target for radiosensitization. The possible underlying mechanisms by which survivin contributes to tumor radioresistance remain to be understood and may involve suppression of apoptosis as well as cell cycle arrest and impaired DNA double-strand break repair.³⁸

Previous studies have shown that radiation significantly increased survivin mRNA/protein expression,^41,42 and the underlying mechanisms have not been clarified. Radiation can also increase HIF-1α activity, which has been suggested to be a main contributing factor for tumor radioresistance through multiple mechanisms.^43,44 The main mechanism is related to reactive oxygen generated by radiotherapy that leads to nuclear accumulation of HIF-1α and enhanced translation of HIF-1α-regulated proteins. The resulting increase in HIF-1-regulated cytokines has been shown to enhance endothelial cell radioresistance. HIF-1α is the oxygen-sensitive HIF-1 subunit, so some related studies were focused mainly on the association between HIF-1α and tumor vasculature.^45
–47 Because HIF-1α could directly bind to the survivin promoter and positively regulate the transcription of survivin,¹⁹ it was considered possible that HIF-1α may exert a radioprotective effect by activating survivin.

In this study, our results demonstrated that radiation indeed increased survivin mRNA/protein expression in transplanted tumors, and for the first time, we showed that β-elemene decreased radiation-induced expression of survivin mRNA/protein in vivo. Because of the moderate antitumor effect of β-elemene at a dose of 45 mg/kg, it had a slight effect on the basal expression of survivin protein. β-elemene alone also induced apoptosis as indicated by the presence of more apoptotic cells in β-elemene treated tumors compared with the control group. Moreover, combination treatment of β-elemene plus radiation resulted in enhanced apoptosis compared with either of the monotherapies.

In addition, we found that although radiation enhanced HIF-1α mRNA/protein expression in the xenograft tumors, β-elemene plus radiation treatment could antagonize this induction and further decrease HIF-1α mRNA/protein expression. One model that could explain this result is that HIF-1α may be a target of β-elemene, which radiosensitizes tumor cells by inhibiting HIF-1α and survivin. Therefore, the HIF-1α/survivin pathway and its relationship to cell division and apoptosis merit further investigation.

Conclusions

Our results show that β-elemene significantly enhanced radiosensitivity of lung adenocarcinoma xenograft in vivo. β-elemene decreased radiation-induced expression of survivin and HIF-1α mRNA/protein, which may contribute to its ability to enhance radiation response. β-elemene may also promote apoptosis, which contributes to its radiosensitizing effect. Our study confirms that β-elemene is a promising drug to enhance tumor radioresponse, and survivin and HIF-1α are novel targets of β-elemene.

Footnotes

Acknowledgments

This research was supported by grants from the National Natural Science Foundation of China (NO.30770646) and the Innovative Team Project of the Liaoning Provincial Education Department (NO.2008T031).

Disclosure Statement

No competing financial interests exist.

References

Parkin

, Bray

, Ferlay

, Pisani

. Global cancer statistics, 2002. CA Cancer J Clin, 2005; 55:74.

Yang

, Wang

, Yu

et al. The antitumor activity of elemene is associated with apoptosis. Chin J Cancer Res, 1997; 9:83.

Wang

, Zhang

, Sun

. Phase IlI clinical trial of elemene emulsion in the management of malignant pleural and peritoneal effusion. Chin J Oncol, 1996; 18:464.

Dong

, Chen

, Wu

et al. Elemene for the treatment of lung cancer. Cochrane Database Syst Rev, 2007; 17CD006054.

Tan

, Wang

et al.

Immunotherapeutic effects of beta-elemene combined with interleukin-23 gene-modified dendritic cell on murine pancreatic carcinoma [in Chinese]

Ai Zheng, 2006; 25:1082.

Jiang

, Ma

, Feng

. In vitro study of radiosensitization by β-elemene in A549 cell line from adenocarcinoma of lung. Chinese-German J Clin Oncol, 2009; 8:12.

Cheng

, Qiao

, Shi

et al. In vitro study on increase in radio sensitivity of renal cell carcinoma induced by β-elemene. Xi'an Jiao Tong Da Xue Xue Bao, 2004; 25:182.

, Li

, Zhao

et al. A study of radiosensitivity of β-elemene to squamous cell carcinoma of tongue Tca-8113 cell line in vitro. Zhong Liu Ji Chu He Lin Chuang, 2006; 19:116.

She

, Wang

, Che

et al. Radiosensitization of beta-elemene on VX2 carcinoma transplanted on kidney in rabbits in vivo. Zhong Xi Yi Jie He Xue Bao, 2006; 4:392.

10.

, Jiang

, Zhao

et al. Effects of β-elemene on radiosensitivity, cell cycle, apoptosis, Bcl2 and Bax expression of Tca8113 cells in vitro. Zheng Zou Da Xue Xue Bao, 2009; 44:414.

11.

She

, Wang

, Chong

et al. Wang, Expressions of Caspase-3 and Bcl-2 in radio sensitization of β-elemene on rabbit VX2 renal carcinoma. Di Si Jun Yi Da Xue Xue Bao, 2006; 27:2285.

12.

Monzó

, Rosell

, Felip

et al. A novel anti-apoptosis gene: Re-expression of survivin messenger RNA as a prognosis marker in non-small-cell lung cancers. J Clin Oncol, 1999; 17:2100.

13.

Altieri

. The case for survivin as a regulator of microtubule dynamics and cell-death decisions. Curr Opin Cell Biol, 2006; 18:609.

14.

Lens

, Vader

, Medema

. The case for Survivin as mitotic regulator. Curr Opin Cell Biol, 2006; 18:616.

15.

Rosa

, Canovas

, Islam

et al. Survivin modulates microtubule dynamics and nucleation throughout the cell cycle. Mol Biol Cell, 2006; 17:1483.

16.

Dohi

, Xia

, Altieri

. Compartmentalized phosphorylation of IAP by protein kinase A regulates cytoprotection. Mol Cell, 2007; 27:17.

17.

Semenza

. Targeting HIF-1 for cancer therapy. Nat Rev Cancer, 2003; 3:7212.

18.

Manalo

, Rowan

, Lavoie

et al. Transcriptional regulation of vascular endothelial cell responses to hypoxia by HIF-1. Blood, 2005; 105:659.

19.

Chen

, Zhao

, Li

et al. Effect of hypoxia-inducible factor-1alpha on transcription of survivin in non-small cell lung cancer. J Exp Clin Cancer Res, 2009; 28:29.

20.

Chang

, Qin

, Huang

et al. Effect of antisense hypoxia-inducible factor 1alpha on progression, metastasis, and chemosensitivity of pancreatic cancer. Pancreas, 2006; 32:297.

21.

Peng

, Karna

, Cao

et al. Cross-talk between epidermal growth factor receptor and hypoxia-inducible factor-1alpha signal pathways increases resistance to apoptosis by up-regulating survivin gene expression. J Biol Chem, 2006; 281:25903.

22.

Rödel

, Hoffmann

, Grabenbauer

et al. High survivin expression is associated with reduced apoptosis in rectal cancer and may predict disease-free survival after preoperative radiochemotherapy and surgical resection. Strahlenther Onkol, 2002; 178:426.

23.

Bache

, Holzapfel

, Kappler

et al. Survivin protein expression and hypoxia in advanced cervical carcinoma of patients treated by radiotherapy. Gynecol Oncol, 2007; 104:139.

24.

Asanuma

, Kobayashi

, Furuya

et al. A role for survivin in radioresistance of pancreatic cancer cells. Jpn J Cancer Res, 2002; 93:1057.

25.

Vergis

, Corbishley

, Norman

et al. Intrinsic markers of tumour hypoxia and angiogenesis in localised prostate cancer and outcome of radical treatment: A retrospective analysis of two randomised radiotherapy trials and one surgical cohort study. Lancet Oncol, 2008; 9:342.

26.

Koukourakis

, Giatromanolaki

, Sivridis

et al. Hypoxia-inducible factor (HIF1A and HIF2A), angiogenesis, and chemoradiotherapy outcome of squamous cell head-and-neck cancer. Int J Radiat Oncol Biol Phys, 2002; 53:1192.

27.

Liu

, Xia

, Li

et al. The effect of p21 antisense oligodeoxynucleotides on the radiosensitivity of nasopharyngeal carcinoma cells with normal p53 function. Cell Biol Int, 2006; 30:283.

28.

Milas

, Fujii

, Hunter

et al. Enhancement of tumor radioresponse in vivo by gemcitabine. Cancer Res, 1999; 59:107.

29.

Wang

, Zhou

, Holmqvist

et al. Survivin expression quantified by Image Pro-Plus compared with visual assessment. Appl Immunohistochem Mol Morphol, 2009; 17:530.

30.

Qian

, Qin

. Pharmacological and clinical studies of elemene, a new anticancer drug. Chin Clin Cancer, 1999; 26:1.

31.

Yuan

, Gu

, Chou

et al. Elemene induces apoptosis and regulates expression of bcl-2 protein in human leukemia K562 cells. Zhongguo Yao Li Xue Bao, 1999; 20:1036.

32.

Zhou

, Shen

, Hou

et al. Experimental study on apoptosis induced by elemene in glioma cells. Ai Zheng, 2003; 22:959.

33.

Zou

, Liu

, Yu

. ß-Elemene induces apoptosis of K562 leukemia cells. Zhonghua Zhong Liu Za Zhi, 2001; 23:196.

34.

Wang

, Li

, Huang

et al. Antitumor effect of ß-elemene in non-small cell lung cancer cells is mediated via induction of cell cycle arrest and apoptotic cell death. Cell Mol Life Sci, 2005; 62:881.

35.

Zhang

, Zou

, Tian

. The influence of β-elemene combined with radiotherapy on the expression of DNA-PKcs mRNA and apoptosis. Shi Yong Ai Zheng Za Zhi, 2009; 24:555.

36.

Zhang

, Zou

, Tian

. Effect of β-elemene combined with radiotherapy on the expression of KU70 mRNA and apoptosis of lung adenocarcinoma cell line A549. Zhongguo Zhong Liu Lin Chuang, 2010; 7:184.

37.

Chen

, Li

, Ge

et al. Prognostic value of survivin, X-linked inhibitor of apoptosis protein and second mitochondria-derived activator of caspases expression in advanced non-small-cell lung cancer patients. Respirology, 2010; 15:501.

38.

Rödel

, Hoffmann

, Distel

et al. Survivin as a radioresistance factor, and prognostic and therapeutic target for radiotherapy in rectal cancer. Cancer Res, 2005; 65:4881.

39.

Asanuma

, Moriai

, Yajima

et al. Survivin as a radioresistance factor in pancreatic cancer. Jpn J Cancer Res, 2000; 91:1204.

40.

Sreevalsan

, Jutooru

, Chadalapaka

et al. 1,1-Bis(3′-indolyl)-1-(p-bromophenyl) methane and related compounds repress survivin and decrease gamma- radiation-induced survivin in colon and pancreatic cancer cells. Int J Oncol, 2009; 35:1191.

41.

Kami

, Doi

, Koizumi

et al. Downregulation of survivin by siRNA diminishes radioresistance of pancreatic cancer cells. Surgery, 2005; 138:299.

42.

Konduri

, Colon

, Baker

et al. Tolfenamic acid enhances pancreatic cancer cell and tumor response to radiation therapy by inhibiting survivin protein expression. Mol Cancer Ther, 2009; 8:533.

43.

Moeller

, Cao

, Li

et al. Radiation activates HIF-1 to regulate vascular radiosensitivity in tumors: Role of reoxygenation, free radicals, and stress granules. Cancer Cell, 2004; 5:429.

44.

Kim

, Oh

, Woo

et al. Targeting heat shock protein 90 overrides the resistance of lung cancer cells by blocking radiation-induced stabilization of hypoxia- inducible factor-1alpha. Cancer Res, 2009; 69:1624.

45.

Gorski

, Beckett

, Jaskowiak

et al. Blockage of the vascular endothelial growth factor stress response increases the antitumor effects of ionizing radiation. Cancer Res, 1999; 59:3374.

46.

Garcia-Barros

, Paris

, Cordon-Cardo

et al. Tumor response to radiotherapy regulated by endothelial cell apoptosis. Science, 2003; 300:1155.

47.

Camphausen

, Moses

, Beecken

et al. Radiation therapy to a primary tumor accelerates metastatic growth in mice. Cancer Res, 2001; 61:2207.