The Correlation of Visfatin and Its Gene Polymorphism with Non-Small Cell Lung Cancer

Abstract

Objective:

To investigate the protein expression of visfatin and its gene polymorphism in non-small cell lung cancer (NSCLC) patients.

Methods:

The plasma level of visfatin was detected by enzyme-linked immunosorbent assay, and the genotypes rs59744560, rs9770242, and rs61330082 in the visfatin gene were detected by gene sequencing.

Result:

This study revealed that plasma levels of visfatin in NSCLC patients were significantly higher than the levels in healthy people (p < 0.01). The high level of plasma visfatin was found to be significantly correlated with TNM stage (p < 0.05). No mutations were detected in rs59744560 and rs9770242 loci. Three genotypes (CC, CT, and TT) were detected in rs61330082 locus, and the differences in the frequency distribution of these genotypes were significant in the two groups (p < 0.05). Central obesity and the CC genotype were independent risk factors in the pathogenesis of NSCLC (p < 0.05).

Conclusion:

The plasma visfatin level in NSCLC patients significantly increased, and high plasma visfatin levels were correlated with tumor stage. Gene polymorphism was found in the visfatin gene rs61330082 locus. The CC genotype might increase the risk for patients suffering from NSCLC, while the CT genotype, TT genotype, and T allele may reduce the risk of NSCLC. The rs61330082 locus can be used as genetic markers of high-risk populations.

Introduction

Lung cancer is a malignant tumor with high morbidity and mortality worldwide. Approximately 1,600 thousand new lung cancer patients are diagnosed each year, and its mortality ranks at the top among malignant tumors.^1,2 In clinical practice, the 5-year survival rate of stage I lung cancer patients is >50%, while the 5-year survival rate of stage IV lung cancer patients is only 13%.³ Non-small cell lung cancer (NSCLC) is the most frequent pathological type in lung cancer. Since its early clinical manifestations are not typical, most of these patients are in the middle and late stages when they are diagnosed. Therefore, these patients have short survival time and poor quality of life. Hence, early detection and diagnosis are particularly important for high-risk populations and patients with NSCLC. Some studies have confirmed that the incidence of lung cancer is closely correlated to genetic factors. In particular, single nucleotide polymorphisms (SNPs) play an important role in the occurrence and development of lung cancer.^4,5 Visfatin is an adipocytokine highly expressed in visceral adipose tissue, and is closely correlated to the proliferation, invasion, and metastasis of tumor cells. Studies have revealed that visfatin protein or mRNA expression is elevated in many malignant tumors, such as colon cancer, postmenopausal breast cancer, endometrial cancer, renal cell carcinoma, colorectal cancer, pancreatic cancer, gastric cancer, liver cancer, prostate cancer, and esophageal cancer.^6

–11 Recently, Okumura et al. reported that the mRNA expression of visfatin is elevated in NSCLC, and that visfatin may become a new target for the treatment and prediction of lung cancer.¹² However, few studies on the correlation between visfatin gene polymorphism and lung cancer have been carried out at home and abroad. Hence, further researches in this field are urgently needed. Therefore, the correlation of visfatin and its gene polymorphism with NSCLC in a Han population in Xuanwei, Yunnan was investigated in this study. Furthermore, the mechanism of NSCLC occurrence and development was further explored to provide target and laboratory data for screening and gene therapy of NSCLC.

Materials and Methods

Clinical data

A total of 102 NSCLC patients in the Xuanwei area, who were admitted in Yunnan Province Cancer Hospital (the Third Affiliated Hospital of Kunming Medical University) from September 2014 to September 2016, were included into the study. These patients were assigned as the case group. All patients were diagnosed by pathological biopsy under endoscope or through the sections obtained during the operation. Furthermore, these patients had complete clinical data, had no other tumors or history of autoimmune disease, and were not treated by chemotherapy or radiotherapy. The age of these patients ranged within 25–78 years, with a median age of 46 years. Among these patients, 57 patients were male and 45 patients were female. For the types of cancer, 26 patients had squamous cell carcinoma and 76 patients had adenocarcinoma. For the stage of cancer, six patients were at stage I, six patients were at stage II, 20 patients were at stage III, and 70 patients were at stage IV. Furthermore, 58 patients were complicated with central obesity, while nine patients were complicated with metabolic syndrome (MS). Tumor staging was based on the criteria in the American Joint Committee on Cancer (AJCC) Cancer Staging Manual seventh Edition. The diagnostic criteria of MS were based on the diagnostic criteria developed by the Diabetes Association of Chinese Medical Association in 2004 (CDS protocol). In addition, 96 healthy subjects were enrolled from the Physical Examination Center, and assigned as the control group. Subjects in the control group had no diabetes, hypertension, hyperuricemia, hyperlipidemia, or central obesity. This study was approved by the Ethics Committee of our hospital. All study subjects provided a signed informed consent.

Sample collection

From the elbow of each subject, 5 mL of fasting venous blood was collected using a round tube (green cap) containing heparin. Within 30 min, the blood sample was centrifuged at 2,000 rpm for 15 min at 4°C. The separated plasma was stored at −80°C for detection of visfatin levels. In addition, 4 mL of fasting blood was collected at the elbow vein using an EDTA anticoagulant tube (purple cap), and stored at −80°C as a reserve.

Experimental methods

Detection of visfatin content in plasma

The content of visfatin in plasma was detected according to the procedure on the Visfatin (human) Elisa Assay Kit (BioVision, San Francisco, CA).

Detection of visfatin gene polymorphism

DNA was extracted using a DNA extraction kit (Qiagen, Dusseldorf, Germany), and the purity of the DNA was detected by gel electrophoresis. According to the principle of primer design, the nucleotide sequences of rs9770242, rs59744560, and rs61330082 loci were obtained from the National Center for Biotechnology Information (NCBI). Then, the primers were designed and synthesized. The specific primer sequences are presented in Table 1.

Table 1.

Primer Sequences

Loci	Primer	Sequence	Length (bp)
rs9770242	Vis-242-F2	TTCATCTGATGCAGCGACTC	406
rs9770242	Vis-242-R2	TTAAACATGCGGACAAAGGG	406
rs59744560	Vis-560-F	ACCACGCATGAGAACTGC	412
rs59744560	Vis-560-R	TGTCTTTAAGATCCCAGGAGC	412
rs61330082	Vis-082-F	AGGAGGATGGCGTGAACC	395
rs61330082	Vis-082-R	AACTGGAGGCATGGCTGA	395

Polymerase chain reaction (PCR) amplification was performed according to the PCR reaction kit manual. Amplification conditions: 94°C for 5 min, 94°C for 30 s, 58°C for 30 s, and 72°C for 20 s. After 30 cycles were performed, the samples underwent PCR at 72°C for 10 min. Then, the PCR product was observed after treatment with 2% agarose gel electrophoresis, the amplification of the target fragment was determined according to the gel map, and the verified PCR products were sequenced and analyzed.

Statistical analysis

Data were analyzed using statistical software SPSS 17.0. Measurement data were expressed as mean ± standard deviation (x ± SD), and evaluated using t-test or analysis of variance. Count data were evaluated using chi-square test. Chi-square test between the observed value and expected values of the genotype was used to determine whether the selected population was in accordance with the Hardy–Weinberg equilibrium. The genotype and allele frequencies were calculated based on the genotypes. The differences in the distribution of GT alleles and genotype frequency were analyzed using the χ² -test. Logistic regression was used to calculate the odds ratio (OR) and 95% confidence interval (CI) of relative risk, and assess for the genotype risk. p < 0.05 was considered statistically significant.

Results

The protein expression of visfatin

Plasma visfatin level was higher in the case group than in the control group, and the difference was statistically significant (p < 0.05, Table 2).

Table 2.

Plasma Visfatin Level Comparison Between Two Groups

Item	Case group n = 102	Control group n = 96	t	p
Visfatin	13.5692 ± 7.21118	7.9564 ± 5.46163	6.145	<0.001

In the case group, the difference in plasma visfatin level among patients with different tumor types, with or without central obesity, and with or without MS was not statistically significant (p > 0.05). However, for patients at different tumor stages, plasma visfatin level was higher in patients at stage III-IV (14.092414 ± 7.3898744 ng/mL) than in patients at stages I-II (9.645030 ± 4.0718112 ng/mL), and the difference was statistically significant (p < 0.05, Table 3).

Table 3.

Comparison of Different Clinical Features' Visfatin Level in Case Group

Item	Cases n = 102	Visfatin	t	p
Pathologic types
Squamous cell carcinomas	26	13.592160 ± 6.2597447
Adenocarcinoma	76	13.561335 ± 7.5476145	−0.021	0.984
Tumor stage
I–II stage	12	9.645030 ± 4.0718112
III–IV stage	90	14.092414 ± 7.3898744	−2.038	0.044
Central obesity (+)	58	13.877720 ± 7.5917149
Central obesity (−)	44	13.162497 ± 6.7413519	0.502	0.617
Metabolic syndrome (+)	9	13.623527 ± 7.4371354
Metabolic syndrome (−)	93	13.563934 ± 7.2303691	0.023	0.98

The correlation between visfatin gene polymorphism and NSCLC

The Hardy–Weinberg equilibrium test for the selected research population

The distribution of the genotypes of rs9770242, rs59744560, and rs61330082 loci in the population was in accordance with the Hardy–Weinberg equilibrium. Therefore, the selected samples had group representation.

The rs59744560 locus of the visfatin gene was the GG genotype in all subjects, in which no mutation was detected in both two groups, and the rs9770242 locus was AA genotype in all subjects, in which no mutation was detected in both two groups. However, mutations were detected in the rs61330082 locus in both two groups, in which a total of three genotypes (CC wild-type, CT heterozygous mutant, and TT homozygous mutant) were detected. This revealed that the rs61330082 locus in both groups of subjects was polymorphic, and the differences in the distribution of genotype and allele frequencies were statistically significant (p < 0.05, Table 4).

Table 4.

Distribution of Genotype and Allele Frequencies rs61330082 Locus

Item	Case group n = 102	Control group n = 96	χ2	p
Genotype
CC	36 (35.3%)	13 (13.5%)
CT	50 (49.0%)	54 (56.3%)
TT	16 (15.7%)	29 (30.2%)	14.537	0.001
Allele
C	122 (59.8%)	80 (41.7%)
T	82 (40.2%)	112 (58.3%)	13.020	<0.001

The results of the univariate analysis revealed that gender, age, and the CT genotype were not the single risk factors for NSCLC, and the differences were not statistically significant (p > 0.05). Central obesity, MS, CC genotype, TT genotype, C allele, and T allele were single risk factors for NSCLC (p < 0.05). After controlling for age, gender, and other confounding factors, the binary logistic regression analysis revealed that central obesity and CC genotype were independent risk factors for NSCLC (p < 0.05), and that the wild-type CC genotype and central obesity may increase the risk of NSCLC in this population (OR = 3.152, 95% CI: 0.156–0.894; Tables 5 and 6). It can be concluded that CT genotype, TT genotype, and T allele may reduce the risk of NSCLC in this population.

Table 5.

Single Risk Factors for Non-Small Cell Lung Cancer

Related factors	Number of cases	Number of cases of lung cancer	Lung cancer ratio%	χ²	p
Gender
Male	128	61	59.8
Female	70	41	40.2	2.159	0.142
Age
≥60	83	41	40.2
<60	115	61	59.8	0.257	0.612
Central obesity (+)	58	58	56.9
Central obesity (−)	140	44	43.1	77.203	<0.001
Metabolic syndrome (+)	9	9	8.8
Metabolic syndrome (−)	189	93	91.2	8.874	0.003
CC genotype
Yes	49	36	35.3
No	149	66	64.7	12.565	<0.001
CT genotype
Yes	104	50	49.0
No	94	52	51.0	1.037	0.309
TT genotype
Yes	45	16	15.7
No	153	86	84.3	5.939	0.015
C allele
Yes	152	85	83.3
No	46	17	16.7	5.058	0.024
T allele
Yes	147	64	62.7
No	51	38	37.3	14.542	<0.001

Table 6.

Risk Factors of Onset (Binary Logistic Regression Analysis)

Related factors	p	OR	95% CI
Central obesity	0.997	3.152	1.00
CC genotype	0.027	1.373	0.456–0.594

Discussion

Visfatin protein is widely expressed in various organs and tissues of humans, such as the liver, muscles, bone marrow, and visceral fat, and this is mostly expressed in the liver, followed by the muscles, immune cells, desmocytes, nerve cells, and cardiomyocytes. This suggests that this protein is involved in a variety of important physiological and pathological processes of the body.¹³ A study revealed that visfatin had the effects like insulin, such as decreasing blood glucose, regulating insulin signal transduction, promoting fat synthesis and participating in inflammatory reactions, and is involved in the rate-limiting step of the salvage pathway in catalyzing the biosynthesis of nicotinamide adenine dinucleotide, and can promote the cloning and production of pre-B cells in synergy, participating in body immunological regulation.¹⁴ Furthermore, recent studies have revealed that visfatin plays an important role in tumor occurrence and development, and tumor cell proliferation, invasion, and metastasis. Moreover, it was found that in patients with various tumors, the protein expression level of visfatin in cells significantly increased, when compared with healthy subjects. In addition, higher the protein expression level of visfatin in gastric cancer and malignant glioma, higher the malignancy grade of the tumor.^15,16 Wang et al. revealed that plasma visfatin level was significantly higher in NSCLC patients than in subjects in the control group, and the increase in visfatin level was correlated to TNM stage, the number of lymph node metastasis and the presence of distant metastasis.¹⁷ The results of this study revealed that plasma visfatin level was higher in the case group than in the control group. This suggests that visfatin may be correlated to the pathogenesis of NSCLC. Further analysis revealed that the difference in plasma visfatin level among patients with different tumor pathological types, between patients with or without central obesity, and between patients with or without MS was not statistically significant. However, for different tumor stages, the results of this study revealed that plasma visfatin level was higher in patients at stages III-IV than in patients at stages I-II. This suggests that plasma visfatin levels in NSCLC patients may be correlated to tumor stages. This result is similar to the result reported by Wang.

Although visfatin is closely correlated to the occurrence and development of tumors, and that its expression significantly increases in a variety of tumors, few studies have focused on the association of visfatin gene polymorphism with tumor occurrence and development. At present, studies on the correlation between visfatin gene polymorphism and lung diseases mainly focused on acute lung injury (ALI) and acute respiratory distress syndrome (ARDS). Ye et al. revealed that carriers of the haplotype GC from SNPs T-1001G and C-1543T had a 7.7-fold higher risk of ALI, and the T variant from the SNP C-1543T resulted in a significant decrease in the transcription rate.¹⁸ Bajwa et al. reported that the PBEFT-1001G variant allele and related haplotype were associated with increased odds of developing ARDS and increased hazard of intensive care unit mortality among at-risk patients, whereas the C-1543T variant allele and related haplotype were associated with decreased odds of ARDS among patients with septic shock and better outcomes among patients with ARDS.¹⁹ Sun et al. revealed that ARDS-associated NAMPT promoter SNPs rs59744560 (−948G/T) and rs7789066 (−2,422A/G) each significantly elevated NAMPT promoter activity in response to 18% CS in a STAT5-dependent manner, and NAMPT is a key novel ARDS therapeutic target and candidate gene with genetic/epigenetic transcriptional regulation in response to excessive mechanical stress.²⁰ There are few studies on whether there are visfatin gene polymorphisms in NSCLC patients, and further research is needed. The gene encoding visfatin is located between chromosomes 7q22.1 and 7q31.33, which contains 11 exons and 10 introns, and has a molecular weight of 52 kDa. This gene can encode 491 amino acid residues. All the exon/intron splice sites of the visfatin gene are consistent with the AG/GT rule. The visfatin gene sequence is relatively conservative. From this, it can be speculated that merely a minor mutation in this gene may affect the protein expression and subsequent events. A study conducted by Bottcher et al. revealed that the presence of the T allele may reduce visfatin mRNA level.²¹ In addition, Zhang et al. reported their study on bladder cancer in this field. The study revealed that the allele C and CC genotype in rs61330082 could increase the risk of bladder cancer and the allele A and AT genotype in rs2505568 significantly decreased the susceptibility to bladder cancer. However, the association between rs9034 gene polymorphism and bladder cancer was not statistically significant.²² Furthermore, Zhang et al. reported that among Chinese people, visfatin gene rs61330082, rs2505568, and rs9034 loci were all polymorphic, and the allele C and CC genotype in rs61330082 may be risk factors for susceptibility to esophageal cancer, while polymorphisms in rs2505568 and rs9034 were not significantly associated with the incidence of esophageal squamous cell carcinoma.²³

The results of this study revealed that the rs9770242 locus was AA genotype in all subjects, in which no mutation was detected in both two groups. However, mutations were detected in the rs61330082 locus in both two groups, in which a total of three genotypes (CC wild-type, CT heterozygous mutant, and TT homozygous mutant) were detected, and the differences in genotype and allele distribution between these two groups were statistically significant (p < 0.05). This suggests that visfatin gene rs61330082 polymorphism may be associated with the pathogenesis of NSCLC. The univariate analysis revealed that gender, age, and CT genotype were not single risk factors for NSCLC, and the differences were not statistically significant (p > 0.05). However, central obesity, MS, CC genotype, TT genotype, C allele and T allele were single risk factors for NSCLC (p < 0.05). After controlling for age, gender, and other confounding factors, the binary logistic regression analysis revealed that central obesity and CC genotype were independent risk factors for NSCLC (p < 0.05), and CC genotype and central obesity may increase the risk of NSCLC in population, while CT genotype, TT genotype, and T allele may reduce the risk of NSCLC in this population. These results were similar to the results in the study conducted by Zhang et al. on bladder cancer and the results of the study conducted by Zhang et al. on esophageal cancer. The possible reason for this phenomenon is that rs61330082 is located in the promoter of the vasfatin gene and closely correlated to mRNA transcription. Their CT genotypes and TT genotypes are protective genotypes because they are all mutagenesis, which may lead to obstacles to the synthesis pathway of the lactin protein, which leads to a decrease in the level of lipoprotein, which reduces the risk of NSCLC in the population.

In summary, this study revealed that the plasma visfatin levels in NSCLC patients significantly increased, and the extent of the increase was correlated to the tumor stage, suggesting that the high expression of visfatin in NSCLC may be an important contributing factor for the occurrence and development of NSCLC, and that the detection of plasma visfatin levels can provide some reference for the diagnosis and prognosis evaluation of NSCLC. This study also revealed that the rs61330082 locus of the visfatin gene was polymorphic, in which the CC genotype may increase the risk of NSCLC in this population, while CT genotype, TT genotype, and T allele may reduce the risk of NSCLC in this population. The rs61330082 locus of the visfatin gene can be used as an important genetic marker for screening high-risk groups with NSCLC, further providing new ideas on genetic intervention or treatment.

Footnotes

Acknowledgments

Internal health research institute project of Yunnan province (2014NS025) and the National Natural Science Foundation of China (81460358).

Disclosure Statement

All authors have contributed significantly to the article and declare that the work is original and has not been submitted or published elsewhere. None of the authors have any financial disclosure or conflict of interest.

References

Jemal

, Ward

, Johnson

, et al. Annual Report to the Nation on the Status of Cancer, 1975–2014, Featuring Survival. J Natl Cancer Inst, 2017; 109. doi: 10.1093/jnci/djx030

Sundar

, Soong

, Cho

, et al. Immunotherapy in the treatment of non-small cell lung cancer. Lung Cancer, 2014; 85:101–109.

Tognela

, Spring

, Becker

, et al. Predictive and prognostic value of circulating tumor cell detection in lung cancer: A clinician's perspective. Crit Rev Oncol Hematol, 2015; 93:90–102.

Hosgood

, Song

, Hsiung

, et al. Interactions between household air pollution and GWAS-identified lung cancer susceptibility markers in the Female Lung Cancer Consortium in Asia (FLCCA). Hum Genet, 2015; 134:333–341.

Govindan

, Ding

, Griffith

, et al. Genomic landscape of non-small cell lung cancer in smokers and never-smokers. Cell, 2012; 150:1121–1134.

Tian

, Wang

, Zhang

, et al. [The research advances in the relationship between visfatin and cancer. Zhonghua Zhong Liu Za Zhi, 2017; 39:321–324.

Sun

, Zhu

, Wu

, et al. Elevated serum visfatin levels are associated with poor prognosis of hepatocellular carcinoma. Oncotarget, 2017; 8:23427–23435.

Sociali

, Raffaghello

, Magnone

, et al. Antitumor effect of combined NAMPT and CD73 inhibition in an ovarian cancer model. Oncotarget, 2016; 7:2968–2984.

Grolla

, Torretta

, Gnemmi

, et al. Nicotinamide phosphoribosyltransferase (NAMPT/PBEF/visfatin) is a tumoural cytokine released from melanoma. Pigment Cell Melanoma Res, 2015; 28:718–729.

10.

Ilhan

, Kebapcilar

, Yilmaz

, et al. Relations of Serum Visfatin and Resistin Levels with Endometrial Cancer and Factors Associated with its Prognosis. Asian Pac J Cancer Prev, 2015; 16:4503–4508.

11.

Wang

, Hasan

, Alvarado

, et al. NAMPT overexpression in prostate cancer and its contribution to tumor cell survival and stress response. Oncogene, 2011; 30:907–921.

12.

Okumura

, Sasaki

, Minami

, et al. Nicotinamide phosphoribosyltransferase: A potent therapeutic target in non-small cell lung cancer with epidermal growth factor receptor-gene mutation. J Thorac Oncol, 2012; 7:49–56.

13.

Dahl

, Holm

, Aukrust

, et al. Visfatin/NAMPT: A multifaceted molecule with diverse roles in physiology and pathophysiology. Annu Rev Nutr, 2012; 32:229–243.

14.

Garten

, Petzold

, Körner

, et al. Nampt: Linking NAD biology, metabolism and cancer. Trends Endocrinol Metab, 2009; 20:130–138.

15.

Nakajima

, Yamada

, Hamano

, et al. Adipocytokine levels in gastric cancer patients: Resistin and visfatin as biomarkers of gastric cancer. J Gastroenterol, 2009; 44:685–690.

16.

Reddy

, Umesh

, Thota

, et al. PBEF1/NAmPRTase/Visfatin: A potential malignant astrocytoma/glioblastoma serum marker with prognostic value. Cancer Biol Ther, 2008; 7:663–668.

17.

Wang

, Tian

, Liu

, et al. Visfatin Triggers the Cell Motility of Non-Small Cell Lung Cancer via Up-Regulation of Matrix Metalloproteinases. Basic Clin Pharmacol Toxicol, 2016; 119:548–554.

18.

, Simon

, Maloney

, et al. Pre-B-cell colony-enhancing factor as a potential novel biomarker in acute lung injury. Am J Respir Crit Care Med, 2005; 171:361–370.

19.

Bajwa

, Yu

, Gong

, et al. Pre-B-cell colony-enhancing factor gene polymorphisms and risk of acute respiratory distress syndrome. Crit Care Med, 2007; 35:1290–1295.

20.

Sun

, Elangovan

, Mapes

, et al. The NAMPT promoter is regulated by mechanical stress, signal transducer and activator of transcription 5, and acute respiratory distress syndrome-associated genetic variants. Am J Respir Cell Mol Biol, 2014; 51:660–667.

21.

Böttcher

, Teupser

, Enigk

, et al. Genetic variation in the visfatin gene (PBEF1) and its relation to glucose metabolism and fat-depot-specific messenger ribonucleic acid expression in humans. J Clin Endocrinol Metab, 2006; 91:2725–2731.

22.

Zhang

, Zhou

, Zhang

, et al. Genetic variants in NAMPT predict bladder cancer risk and prognosis in individuals from southwest Chinese Han group. Tumour Biol, 2014; 35:4031–4040.

23.

Zhang

, Yan

, Wang

, et al. Genetic polymorphisms of NAMPT related with susceptibility to esophageal squamous cell carcinoma. BMC Gastroenterol, 2015; 15:49.