DNASE1L2,as a Carcinogenic Marker,Affects the Phenotype of Breast Cancer Cells Via Regulating Epithelial

Abstract

Purpose:

The authors explore the role of DNASE1L2 in breast cancer (BC) and its affect on the cell phenotype.

Methods:

Breast invasive ductal carcinoma RNA-Seq data set was downloaded from The Cancer Genome Atlas database for analyzing DNASE1L2 levels. Overall survival curve was plotted by Kaplan–Meier methods. The correlations between DNASE1L2 expression and clinical characteristics were analyzed by chi-square tests. Cox regression models were implemented for analyzing the potential prognosticators of BC. Small interference RNA-DNASE1L2 and pcDNA3.1-DNASE1L2 were transfected into BC cells to silence and overexpress DNASE1L2, respectively. Relative mRNA and protein levels were determined by quantitative real-time PCR (qRT-PCR) and Western blot, respectively. Cell counting Kit-8, clone formation, and Transwell assays were employed to measure the proliferative, invasive, and migratory abilities.

Results:

Bioinformatics analysis showed that the levels of DNASE1L2 were found to be elevated in BC tissues, which was further proved by qRT-PCR tests. Besides, high expression of DNASE1L2 was dramatically led to a poor overall survival. Furthermore, DNASE1L2 expression was remarkably associated with age and pathologic-stage. Silencing DNASE1L2 showed an inhibitory effect on the proliferation, invasion, and migration of MCF7 cells, whereas overexpression of DNASE1L2 in BT549 cells presented the opposite results. Mechanistically, downregulation of DNASE1L2 could significantly enhance the levels of E-cadherin, as well as suppress the levels of Vimentin, N-cadherin and Snail, whereas upregulation of DNASE1L2 showed the reverse outcomes.

Conclusion:

This study for the first time demonstrated that DNASE1L2 was upregulated in BC cells, and acted as an oncogene to affect the phenotype of BC cells by modulating the epithelial–mesenchymal transition process, which suggested that DNASE1L2 might be considered as a useful biomarker for BC therapeutics.

Introduction

Breast cancer (BC), a malignant tumor arising from the ductal epithelium of the breast,¹ is the most common cancer influencing women worldwide, and its mortality rates are expected to increase notably in the following years.² Despite great advances in treatment, BC remains a huge health burden, and the 5 year survival rate is only 26%.³ This is largely due to its easy metastasis and poor prognosis.⁴ Recently, lots of investigations have reported that detection of tumor-related biomarkers plays a key role in the preoperative diagnosis and therapy of BC. Such as human epidermal growth factor receptor-2 (HER-2) could be regarded as a prognostic marker, and its overexpression led to a stronger ability of infiltrating of breast tumor.^5,6 NM23, as a suppressor, could predict the overall survival and was associated with cancer cells growth and metastasis in BC.^7,8 Hence, the investigation of useful biomarkers is of great significance for predicting prognosis, controlling metastasis, understanding the deterioration, and finally achieving satisfactory control of BC through reasonable treatment.

Deoxyribonuclease 1-like 2 (DNASE1L2), a member of the DNase 1-like endonuclease family,⁹ is considered to be a keratin cell-specific endonuclease that plays an important role in DNA degradation.¹⁰ It has reported that DNASE1L2 was expressed specifically in cornifying keratinocytes,¹¹ preferentially expressed in the epidermis¹². With the existing knowledge, studies on the expression of DNASE1L2 in tumor cells are rare, especially in BC cells. It was however reported that alkaline DNase could be used as a marker to assess the response of BC patients to anticancer therapy.¹³ D'Antonio et al. identified 10 DNase 1 hypersensitive sites and found that these sites are significantly mutated and related to the abnormal expression of neighboring genes in BC.¹⁴ These findings raise a question that what role of DNASE1L2 plays in BC, which is worthy for further investigation.

In view of this, with the purpose of investigating the function of DNASE1L2 expression in BC, the authors first downloaded RNA-Seq data set from The Cancer Genome Atlas (TCGA) database for analyzing DNASE1L2 levels, and assessed its prognostic values for BC patients. Beyond this, the effects of DNASE1L2 on the phenotype of BC were detected in MCF7 and BT549 cells. Furthermore, the correlation between DNASE1L2 expression and epithelial–mesenchymal transition (EMT)-related proteins was investigated. The results illustrated that DNASE1L2 might be a carcinogenic biomarker to enhance tumor cells viability and metastasis ability by regulating the levels of EMT-related markers in the progression of BC.

Materials and Methods

Bioinformatics analysis

First, the authors downloaded breast invasive ductal carcinoma RNA-Seq data set, which includes 1109 breast tumor samples and 113 normal samples from TCGA (https://cancergenome.nih.gov) database to determine the level of DNASE1L2. The DNASE1L2 expression was divided into high and low levels using the median level as the criterion for survival analysis.

Cell culture and transfection

Human BC cell lines MDA-MB-231, MCF7 and BT549, and breast epithelial cell MCF-10A were obtained from Cell Resource Center, Shanghai Institute of Life Sciences, Chinese Academy of Sciences (Shanghai, China) and maintained in Roswell Park Memorial Institute-1640 (RPMI-1640) (Procell, Wuhan, China) medium with 0.1 mg/mL streptomycin and 100 U/mL penicillin under the humidified 5% CO₂ atmosphere at 37°C.

Two small interfering RNAs targeting DNASE1L2 (si-DNASE1L2#1: 5′-CACGTGATGTGCTGCTCTGTA-3′; si-DNASE1L2#2: 5′- GAGATGTACCTGTTCGTGTAC-3′) and its control (si-con: 5′- CGAACTCACTGGTCTGACC-3′), as well as plasmids pcDNA3.1-DNASE1L2 and pcDNA3.1 were designed and synthesized by the GenePharma Co., Ltd (Shanghai, China). Transfecting process was performed using Lipofectamine 2000 kit (Invitrogen, CA) according to the manufactures' instructions.

Quantitative real-time PCR

Total RNA was extracted from cells using TRIzol reagent (Invitrogen) following the manufactures' instructions. The cDNA was reverse transcribed by PrimeScript RT Reagent Kit (TaKaRa, Dalian, China). mRNA level was detected by a SYBR Premix Ex Taq system (TaKaRa). The primers are listed as follows:

DNASE1L2 forward, 5′- GTGTACCTGGACGTGATCGACA -3′;

DNASE1L2 reverse, 5′- GAGCCACTTGAAGACCTCACTG -3′;

GAPDH forward, 5′- TGTGTCCGTCGTGGATCTGA -3′;

GAPDH reverse, 5′- CCTGCTTCACCACCTTCTTGA -3′.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was served as an internal reference. Relative levels of individual gene mRNA transcripts were calculated with the comparative quantification cycle (Cq) method (2^−ΔΔCq).

Western blot

After transfection for 48 h, cells were lysed in the Radio Immunoprecipitation Assay (RIPA) lysis buffer (Beyotime, Nantong, China) on ice. Equal amounts of protein (20 μg protein each hole) was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membrane. The membrane was blocked for an hour with 5% skimmed milk powder, then incubated with primary antibodies anti-DNASE1L2 (ab231232; Abcam, Cambridge, United Kingdom, www.abcam.com/), anti-E cadherin (AF1552; Beyotime, Jiangsu, China, www.beyotime.com/), anti-N cadherin (AF0243; Beyotime), anti-Snail (ab229701; Abcam), and anti-Vimentin (AF1975; Beyotime) overnight at 4°C. GAPDH Rabbit Monoclonal Antibody (AF1186; Beyotime) was served as an internal reference.

Subsequently, samples were washed with Tween-20 (TBST) thrice for 5 min, and incubated with horseradish peroxidase conjugated secondary antibodies for 1 h at room temperature. Positive bands were visualized by an enhanced Electro-Chemi-Luminescence kit (ECL; Beyotime, Nantong, China) on a ChemiDoc MP imaging system (Bio-Rad, Hercules, CA). The ImageJ software (National Institutes of Health, Bethesda, MD) was used to quantify the bands.

Cell proliferation assay

After transfection for 48 h, breast cells were seeded in 96-well culture plates at a density of 1000 cells per well, and then incubated for 24, 48, and 72 h. Cell counting Kit-8 (CCK-8) reagent (10 μL) was supplied to each well at the designated time point. Subsequently, the cells were maintained at 37°C for another 1.5 h. The optical density (OD) value was recorded at 450 nm under a microplate reader.

Plate clone formation assay

Equal number of cells (400 cells per plate) were plated onto 60 mm plate and cultured at 37°C in cell incubator for 1–2 weeks. When colonies were appeared, the culture process was terminated. Then the colonies were carefully washed with phosphate buffered saline (PBS) twice, and immobilized with 5 mL 4% paraformaldehyde for 30 min, and stained with 0.1% crystal violet for 30 min. Finally, total number of colonies in each culture dish was evaluated.

Transwell migration and invasion assays

After transfection for 48 h, cells were suspended in serum-free medium. The suspension (invasion assay 1 × 10⁴ cells per well, migration assay 5 × 10³ cells per well) was added into the upper chambers that were coated (invasion assay) or uncoated (migration assay) with matrigel (1:6 dilution of serum-free medium, 100 μL). The lower chambers were supplied with 500 μL complete medium. After incubating for 24 h, cells on the upper chambers were carefully wiped out with cotton swabs, whereas cells that had migrated or invaded to the lower chambers were washed with PBS, immobilized with 4% paraformaldehyde for 30 min, and stained with 0.1% crystal violet for 20 min. Finally, migrated or invaded cells were counted and photographed under an optical microscope (Olympus Corporation, Tokyo, Japan) at a magnification of 100 in five random fields.

Statistical analysis

Student's t-test was used to compare the difference of two groups. Kaplan–Meier, together with log-rank test, was used to perform survival analysis in SPSS version 22.0 (Armonk). Chi-square tests were applied to analyze the relationship between clinical features and DNASE1L2 expression. Cox regression models were utilized to assess whether DNASE1L2 can be used as an independent predictor for BC patients. Statistical significance was performed in GraphPad Prism version 5.0 (San Diegl) in this study. Data were expressed as mean ± standard deviation and p < 0.05 was considered to be statistically significant. All tests were repeated three times independently.

Results

The expression of DNASE1L2 in BC cells

First, the authors assessed DNASE1L2 expression in 1109 tumor tissues and 113 normal tissues based on TCGA database by bioinformatics analysis. Results in Figure 1A showed that DNASE1L2 expression was significantly upregulated in BC tissues in comparison with normal tissues (p < 0.05). To verify levels of DNASE1L2, three human BC cell lines MDA-MB-231, MCF7, and BT549, as well as normal cell line MCF-10A were selected to detect mRNA levels using quantitative real-time PCR (qRT-PCR). As shown in Figure 1B, DNASE1L2 mRNA levels were notably higher in all BC cell lines by contrasts with MCF-10A (p < 0.05), suggesting that DNASE1L2 might participate in the development of BC. Besides, among tumor cell lines, DNASE1L2 mRNA levels were the highest in MCF7 and the lowest in BT549. To make the results more persuasive, MCF7 cells were used to do the knockdown tests and BT549 cells were served to perform the overexpression experiments in the following tests.

FIG. 1.

Levels of DNASE1L2 and survival curves. (A) Bioinformatics analysis based on TCGA database showed that high levels of DNASE1L2 were presented in breast tumor tissues (N = 1109) versus normal tissues (N = 113) (p < 0.05). (B) mRNA levels of DNASE1L2 were determined by qRT-PCR in three BC cell lines (MCF7, MDA-MB-231, and BT549) and human mammary epithelial cell line (MCF-10A). **p < 0.01 versus MCF-10A. (C) Overall survival curve was plotted by Kaplan–Meier methods based on the TCGA database. BC, breast cancer; TCGA, The Cancer Genome Atlas; qRT-PCR, quantitative real-time PCR.

The prognostic values of DNASE1L2

To explore DNASE1L2 prognostic values, the authors first evaluated the relevance between DNASE1L2 levels and the overall survival of BC patients. Kaplan–Meier plot indicated that patients with high DNASE1L2 levels appeared a cruel survival status in contrast with DNASE1L2 low levels group (p < 0.05, Fig. 1C). Next, using chi-square test, the authors assessed the relationship between DNASE1L2 levels and clinical symptoms of BC patients based on TCGA database. The data showed that DNASE1L2 expression was associated with age (p < 0.05) and pathologic-stage (p < 0.05, Table 1). Furthermore, to assess whether DNASE1L2 could be seen as an independent prognosticator, Cox regression analysis was employed. Univariate analysis demonstrated that DNASE1L2 expression, pathologic-stage, pathologic-tumor (T), -metastasis (M), and -node (N), and age were associated with the overall survival of BC patients (p < 0.05, Table 2). Then these candidate parameters with p-value <0.05 were further applied in multivariate analysis to identify independent prognostic values. Interestingly, no independent prognostic value of DNASE1L2 was showed (p > 0.05). In addition, pathologic-stage, -M, -N, and age were shown to be independent prognostic factors (p < 0.05). Although DNASE1L2 could not be regarded as an independent prognosticator, its abnormal expression in BC and its association with the overall survival suggested that DNASE1L2 may play a role in the development of BC.

Table 1.

Correlation Between Clinical Characteristics and DNASE1L2 Expression in Breast Cancer Patients

Characteristics	Expression of DNASE1L2		p-Value
Characteristics	Low	High	p-Value
Age			0.005^*
<60	299	254
≥60	224	269
Gender			0.245
Female	519	515
Male	4	8
Pathologic-stage			0.035^*
I+II	395	371
III+IV	113	144
Pathologic-T			0.094
T1+T2	445	424
T3+T4	77	97
Pathologic-M			0.336
M0	465	405
M1	9	12
Pathologic-N			0.117
N0	263	234
N1	254	275

p < 0.05

Table 2.

Univariate and Multivariate Analysis for Prognosticators of Overall Survival in Breast Cancer Patients Based on The Cancer Genome Atlas Database

Variables	Univariate analysis			Multivariate analysis
Variables	p-Value	HR	95%CI	p-Value	HR	95%CI
DNASE1L2 expression (low/high)	0.034^*	1.435	1.028–2.003	0.231	1.249	0.868–1.797
Pathologic-stage (I + II/III+IV)	0.000^*	2.656	1.874–3.765	0.042^*	1.821	1.022–3.247
Pathologic-T (T1+T2/T3+T4)	0.005^*	1.710	1.175–2.489	0.986	0.995	0.591–1.677
Pathologic-M (M0/M1)	0.000^*	4.785	2.849–8.034	0.004^*	2.619	1.358–5.051
Pathologic-N (N0/N1+N2+N3)	0.000^*	2.130	1.478–3.070	0.045^*	1.011	1.011–2.553
Age (<60/ ≥ 60)	0.000^*	2.015	1.442–2.816	0.000^*	2.080	1.422–3.043
Gender (female/male)	0.859	0.837	0.117–5.998

p < 0.05.

HR, hazard ratio.

Detection of DNASE1L2 silencing and overexpression transfection efficiency

The authors conducted two siRNAs and overexpression vector to down- and upregulate DNASE1L2 expression. To detect the transfection efficiency, qRT-PCR and Western blot were used to determine mRNA and protein levels of DNASE1L2, respectively. As shown in Figure 2A, B, after transfection with si-DNASE1L2#1 and si-DNASE1L2#2 in MCF7 cells, mRNA and protein levels of DNASE1L2 were notably reduced as contrasts with si-con group (p < 0.05). Considering that the silence efficiency of si-DNASE1L2#2 was better than that of si-DNASE1L2#1, si-DNASE1L2#2 was selected to perform the knockdown experiments in the following assays, and referred as si-DNASE1L2. In another aspect, mRNA and protein levels of DNASE1L2 were significantly enhanced after transfected with pcDNA3.1-DNASE1L2 by a contrast with pcDNA3.1 vector group in BT549 cells (p < 0.05, Fig. 2C, D). These data indicated that MCF7 cells with silencing DNASE1L2 and BT549 cells with overexpressed DNASE1L2 were successfully constructed.

FIG. 2.

Detection of DNASE1L2 silencing or overexpression efficacy qRT-PCR (A) and Western blot (B) were used to detect mRNA (A) and protein (B) levels of DNASE1L2 in MCF7 cells after transfected with si-DNASE1L2#1, si-DNASE1L2#2, and si-con. **p < 0.01 versus si-con group. qRT-PCR (C) and Western blot (D) were used to detect mRNA (C) and protein (D) levels of DNASE1L2 in BT549 cells after transfected with pcDNA3.1-DNASE1L2 and pcDNA3.1. **p < 0.01 versus vector group.

Detection of proliferative capacity of BC cells with different expression of DNASE1L2

To detect the function of DNASE1L2 on BC cell viability, CCK-8 and plate clone formation assays were performed. The CCK-8 curve showed that the OD values in si-DNASE1L2 group were significantly reduced at 48 and 72 h compared with si-con group in MCF7 cells (p < 0.05, Fig. 3A). And clone formation assays indicated that silencing DNASE1L2 expression led to a poorer colony efficiency in comparison with si-con group (p < 0.05, Fig. 3C). Reversely, by enhancing DNASE1L2 expression, the OD values were increased compared with vector group (p < 0.05, Fig. 3B). And an increase in the number of colonies was notably observed after transfection with pcDNA3.1-DNASE1L2 compared with vector group in BT549 cells (p < 0.05, Fig. 3D). Above all, the authors deduced that the level of DNASE1L2 may have an important connection with BC cells proliferation.

FIG. 3.

Alteration expression of DNASE1L2 had effects on the cell viability. CCK-8 assay (A, B) and plate clone formation assay (C, D) were employed to determine MCF7 (A, C) and BT-549 (B, D) cell proliferative capacity after transfected with si-DNASE1L2 and si-con (A, C) or pcDNA3.1-DNASE1L2 and pcDNA3.1 (B, D). **p < 0.01 versus si-con group; **p < 0.01 versus vector group.

Detection of invasive and migratory abilities of BC cells with different expression of DNASE1L2

To determine the effect of DNASE1L2 on the migratory and invasive abilities in BC cells, Transwell assay was implemented. Results of invasion assays revealed that, compared with si-con group (159.33 ± 32.65), the invasive MCF7 cell numbers of si-DNASE1L2 group (53.67 ± 28.1) showed an about threefold decrease (p < 0.05, Fig. 4A, B). Homoplastically, the migratory MCF7 cell numbers of si-DNASE1L2 group (162.67 ± 21.13) were fewer than that in si-con group (297.33 ± 37.5, p < 0.05, Fig. 4A, B). Yet, raising DNASE1L2 expression in BT549 cells, the number of invaded cells in pcDNA3.1-DNASE1L2 group (193.33 ± 30.57) was more than twice of that in vector group (79.33 ± 40.87, p < 0.05, Fig. 4C, D). Similarly, enhanced DNASE1L2 expression showed the same trend in migration assays. The migrated BT549 cell number in pcDNA3.1-DNASE1L2 group was 370.33 ± 56.19, and in vector group was 183.67 ± 42.52 (p < 0.05, Fig. 4C, D). These data illustrated that DNASE1L2 might serve a considerably promoting role on the metastasis capacity of BC cells.

FIG. 4.

Transwell assays were adopted to detect influences of up- and downregulation of DNASE1L2 on the invasion and migration. (A, B) The number of invaded and migrated of MCF7 cells was shown after transfected with si-DNASE1L2 and si-con. **p < 0.01 versus si-con group. (C, D) The number of invaded and migrated of BT549 cells was shown after transfected with pcDNA3.1-DNASE1L2 and pcDNA3.1. **p < 0.01 versus vector group.

Association of DNASE1L2 levels and EMT process

For identifying the effects of DNASE1L2 levels on the EMT process in BC cells, qRT-PCR and Western blot were perform to evaluate the mRNA and protein levels of EMT-related markers. Results showed in Figure 4A and C indicated that knockdown of DNASE1L2 dramatically upregulated the levels of E-cadherin in MCF7 cells compared with si-con-transfected cells, whereas the levels of mesenchymal markers N-cadherin and Vimentin and transcription factor Snail were all significantly downregulated (p < 0.05, Fig. 5A, C). For upregulation of DNASE1L2, the authors observed that the EMT relative markers in BT549 cells showed the opposite effects, as with reduced E-cadherin levels and enhanced N-cadherin, Vimentin, and Snail levels (p < 0.05, Fig. 5B, D). To sum up, all these findings implied that DNASE1L2 expression plays roles on cells viability and movement partly by regulating EMT process in BC cells.

FIG. 5.

DNASE1L2 modulated the EMT process. (A, C) Effects of DNASE1L2 silencing on EMT-related markers in MCF7 cells were detected by qRT-PCR (A) and Western blot (C). **p < 0.01 versus si-con group. (B, D) Effects of DNASE1L2 overexpression on EMT-related markers in BT549 cells were detected by qRT-PCR (B) and Western blot (D). **p < 0.01 versus vector group. EMT, epithelial–mesenchymal transition.

Discussion

Biomarkers can help clinicians make more accurate judgment on the prevention and therapy of BC, and choose more effective treatment measures.¹⁵ At present, the application of many biomarkers in preoperative diagnosis of BC is still in the research stage.¹⁶ Thus, the exploration of effective biomarkers is the current and future trend for BC therapeutics. In this report, it is found that DNASE1L2 was highly expressed in BC cells, and could be seen as a carcinogenic biomarker to affect cell proliferative, invasive, and migratory capacities by regulating EMT process in BC.

DNASE1L2 is a member of DNase family, which is involved in the degradation of chromatin in apoptotic cells.¹⁷ It was reported that DNase 1 family members are usually highly expressed in a limited number of tissues or cell types, and poorly expressed in a few others.¹⁸ As currently reported, most members of DNase 1 family are not characterized, but their elimination can lead to a variety of diseases, such as keratosis and systemic lupus erythematosus.^19,20 Owing to the enzymatic nature of the members, the lower expression level could be biologically relevant.¹⁸ Therefore, the level of DNASE1L2 expression may be crucial to the healthy organism development and survival.

By a literature review, the authors found that DNASE1L2 is mainly expressed in keratinocytes and tissues containing keratinocytes, such as skin.²¹ In addition, its expression was also detected in brain.²² It has been shown that DNASE1L2 is a necessary and specific regulator of programmed cell death in skin appendages.²¹ At present, the role of DNASE1L2 in tumors has been rarely reported. But it is worth mentioning that DNASE1L3, also a member of DNase 1 family, was reported to be downregulated in the late stage of clear cell renal cell carcinoma.^22,23 Furthermore, Malecki et al. inserted human DNASE1L3 gene into a plasmid regulated by EGFR promoter, and then introduced the plasmid into ovarian cancer cell line, resulting in destruction of cell genome and apoptosis.²⁴ All of these stimulate everyone to wonder whether DNASE1L2 expression plays a role in cancer.

Thus, in this study, the authors initially revealed that DNASE1L2 was upregulated in BC tissues based on TCGA database, and the next in vitro tests confirmed its upregulation in three BC cell lines. Furthermore, they assessed the prognostic values of DNASE1L2 in BC, and observed that high expression of DNASE1L2 led to a short overall survival. And the following univariate Cox regression analysis demonstrated that it has prognostic values for BC patients. But the multivariate analysis did not demonstrate that it is an independent prognosticator. The authors conjectured that clinical specificity and tumor heterogeneity may be appropriate explanations for these results. Nonetheless, the results suggest that DNASE1L2 might play a role on the progression of BC, which might provide a new point of view for the role of DNASE1L2 in BC.

Despite significant advances in the therapy of BC, metastatic BC remains a deadly disease.²⁵ Therefore, a thorough understanding of the systemic process of cancer cell proliferation is essential for the development of new therapies. EMT is a cell biological program that transforms epithelial cells into mesenchymal cells, confers cancer cells metastasis diffusion ability.²⁶ And it is frequently used as a popular explanation for how tumor cells gain migratory and invasive properties to leave the original tumor site and spread throughout the body, eventually forming distant metastases.^27,28

At present, studies on molecular markers related to EMT have been very mature. E-cadherin, an epithelial marker, can maintain tight connections between cells and prevent invasion, metastasis, and spread of cell activities. The conversion of cadherin between E-cadherin and N-cadherin is a classic example of cancer-related EMT.²⁹ Vimentin maintains cytoskeletal integrity,³⁰ and it was reported that inhibition of 70% Vimentin expression would effectively reduce the invasion and migration of tumors.³¹ Furthermore, Snail, as a transcription factor of EMT-related marker, has been proved to participate in the progression and metastasis of BC cells.^32,33 In view of this, to gain insight into this underlying mechanism of action, the authors detected mRNA and protein-level changes of E-cadherin, N-cadherin, Vimentin, and Snail by up- and downregulation of DNASE1L2 expression.

The data showed that reducing DNASE1L2 levels in MCF7 cells could significantly restrain the EMT process, which raised the levels of E-cadherin and lowered the levels of N-cadherin, Vimentin, and Snail. Increasing DNASE1L2 expression reversed these results. These outcomes implied that DNASE1L2, as a cancer-promoting gene, facilitates the cell proliferative, invasive, and migratory abilities partly by regulating the EMT relative markers in BC cells. Evidence has demonstrated that EMT plays a key role in the progression and metastasis of BC, and participates in antagonizing chemotherapy.³⁴ Thus, it is of great clinical significance to elucidate the specific molecular mechanism by which EMT regulates metastasis, and more in-depth studies are needed.

In summary, this study is the first to explore the role of DNASE1L2 in BC. The data indicated that DNASE1L2 was significantly upregulated in BC cells, and had a correlation with the overall survival, and illustrated that DNASE1L2 affects the cells phenotype through modulating EMT-related markers. All these outcomes suggested that DNASE1L2 might serve as a carcinogenic biomarker in the progression and metastasis of BC cells, which provide the basis for further investigation of underlying mechanism and exploitation of novel target options for BC therapeutic.

Footnotes

Authors' Contribution

Chang-Rui Liu and Fan-Hua Meng designed this study. Chang-Rui Liu performed the experiments and wrote the article. Fan-Hua Meng explained the data and revised the article. All the authors approved the final version of this article.

Disclosure Statement

No competing financial interests exist.

Funding Information

No funding was received for this article.

References

Liu

, Chen

. Signet-ring cell carcinoma of the breast. Pathol Int, 2000; 50:67.

Anastasiadi

, Lianos

, Ignatiadou

, et al. Breast cancer in young women: An overview. Updates Surg, 2017; 69:313.

Sambi

, Qorri

, Harless

, et al. Therapeutic Options for Metastatic Breast Cancer. Adv Exp Med Biol, 2019; 1152:131.

Wang

, Zhou

, et al. Knockdown of PEBP4 suppresses proliferation, migration and invasion of human breast cancer cells. Biomed Pharmacother, 2017; 90:659.

Asif

, Sultana

, Ahmed

, et al. HER-2 Positive Breast Cancer - a Mini-Review. Asian Pac J Cancer Prev, 2016; 17:1609.

Sun

, Shi

, Shen

, et al. Analysis of different HER-2 mutations in breast cancer progression and drug resistance. J Cell Mol Med, 2015; 19:2691.

Han

, Zhang

, Cao

, et al. Prognostic and clinicopathological value of NM23 expression in patients with breast cancer: A systematic review and meta-analysis. Curr Probl Cancer, 2017; 41:80.

Yokdang

, Nordmeier

, Speirs

, et al. Blockade of extracellular NM23 or its endothelial target slows breast cancer growth and metastasis. Integr Cancer Sci Ther, 2015; 2:192.

Shiokawa

, Matsushita

, Kobayashi

, et al. Characterization of the human DNAS1L2 gene and the molecular mechanism for its transcriptional activation induced by inflammatory cytokines. Genomics, 2004; 84:95.

10.

Ueki

, Takeshita

, Utsunomiya

, et al. Survey of single-nucleotide polymorphisms in the gene encoding human deoxyribonuclease I-like 2 producing loss of function potentially implicated in the pathogenesis of parakeratosis. PLoS One, 2017; 12:e0175083.

11.

Manils

, Fischer

, Climent

, et al. Double deficiency of Trex2 and DNase1L2 nucleases leads to accumulation of DNA in lingual cornifying keratinocytes without activating inflammatory responses. Sci. Rep, 2017; 7:11902.

12.

Fischer

, Eckhart

, Mildner

, et al. DNase1L2 degrades nuclear DNA during corneocyte formation. J Invest Dermatol, 2007; 127:24.

13.

Raval

, Parekh

, Patel

, et al. Role of sialic acid and alkaline DNase in breast cancer. Int J Biol Markers, 1997; 12:61.

14.

D Antonio

, Weghorn D

D A

, ntonio-Chronowska

, et al. Identifying DNase I hypersensitive sites as driver distal regulatory elements in breast cancer. Nat Commun, 2017; 8:436.

15.

Odle

. Precision medicine in breast cancer. Radiol Technol, 2017; 88:401m.

16.

Donepudi

, Kondapalli

, Amos

, et al. Breast cancer statistics and markers. J Cancer Res Ther, 2014; 10:506.

17.

Gatselis

, Vakrakou

, Zachou

, et al. Decreased serum DNase1-activity in patients with autoimmune liver diseases. Autoimmunity, 2017; 50:125.

18.

Keyel

. Dnases in health and disease. Dev Biol, 2017; 429:1.

19.

Dittmar

, Bischofs

, Matheis

, et al. A novel mutation in the DNASE1 gene is related with protein instability and decreased enzyme activity in thyroid autoimmunity. J Autoimmun, 2009; 32:7.

20.

Fischer

, Buchberger

, Napirei

, et al. Inactivation of DNase1L2 and DNase2 in keratinocytes suppresses DNA degradation during epidermal cornification and results in constitutive parakeratosis. Sci Rep, 2017; 7:6433.

21.

Fischer

, Szabo

, Scherz

, et al. Essential role of the keratinocyte-specific endonuclease DNase1L2 in the removal of nuclear DNA from hair and nails. J Invest Dermatol, 2011; 131:1208.

22.

Rodriguez

, Rodin

, Nomura

, et al. Identification, localization, and expression of two novel human genes similar to deoxyribonuclease I. Genomics, 1997; 42:507.

23.

Bhalla

, Chaudhary

, Kumar

, et al. Gene expression-based biomarkers for discriminating early and late stage of clear cell renal cancer. Sci Rep, 2017; 7:44997.

24.

Malecki

, Dahlke

, Haig

, et al. Eradication of human ovarian cancer cells by transgenic expression of recombinant DNASE1, DNASE1L3, DNASE2, and DFFB controlled by EGFR promoter: Novel strategy for targeted therapy of cancer. J Genet Syndr Gene Ther, 2013; 4:152.

25.

Bill

, Christofori

. The relevance of EMT in breast cancer metastasis: Correlation or causality?. FEBS Lett, 2015; 589:1577.

26.

Dongre

, Rashidian

, Reinhardt

, et al. Epithelial-to-mesenchymal transition contributes to immunosuppression in breast carcinomas. Cancer Res, 2017; 77:3982.

27.

Cooke

, LeBleu

, Keskin

, et al. Pericyte depletion results in hypoxia-associated epithelial-to-mesenchymal transition and metastasis mediated by met signaling pathway. Cancer Cell, 2012; 21:66.

28.

Zheng

, Shen

, Zha

, et al. PKD1 phosphorylation-dependent degradation of SNAIL by SCF-FBXO11 regulates epithelial-mesenchymal transition and metastasis. Cancer Cell, 2014; 26:358.

29.

Gheldof

, Berx

. Cadherins and epithelial-to-mesenchymal transition. Prog Mol Biol Transl Sci, 2013; 116:317.

30.

Liu

, Lin

, Tang

, et al. Vimentin contributes to epithelial-mesenchymal transition cancer cell mechanics by mediating cytoskeletal organization and focal adhesion maturation. Oncotarget, 2015; 6:15966.

31.

McInroy

, Maatta

. Down-regulation of vimentin expression inhibits carcinoma cell migration and adhesion. Biochem Biophys Res Commun, 2007; 360:109.

32.

, Wang

, Lin

, et al. Dub3 inhibition suppresses breast cancer invasion and metastasis by promoting Snail1 degradation. Nat Commun, 2017; 8:14228.

33.

Qiu

, Liu

, Li

, et al. P2Y2 receptor promotes the migration and invasion of breast cancer cells via EMT-related genes Snail and E-cadherin. Oncol Rep, 2018; 39:138.

34.

Huang

, Li

, Ren

. Epithelial-mesenchymal transition and drug resistance in breast cancer (Review). Int J Oncol, 2015; 47:840.

DNASE1L2,as a Carcinogenic Marker,Affects the Phenotype of Breast Cancer Cells Via Regulating Epithelial–Mesenchymal Transition Process

Abstract

Purpose:

Methods:

Results:

Conclusion:

Introduction

Materials and Methods

Bioinformatics analysis

Cell culture and transfection

Quantitative real-time PCR

Western blot

Cell proliferation assay

Plate clone formation assay

Transwell migration and invasion assays

Statistical analysis

Results

The expression of DNASE1L2 in BC cells

The prognostic values of DNASE1L2

Detection of DNASE1L2 silencing and overexpression transfection efficiency

Detection of proliferative capacity of BC cells with different expression of DNASE1L2

Detection of invasive and migratory abilities of BC cells with different expression of DNASE1L2

Association of DNASE1L2 levels and EMT process

Discussion

Footnotes

Authors' Contribution

Disclosure Statement

Funding Information

References