Overexpression of Nuclear Enriched Autosomal Transcript 1 Facilitates Cell Proliferation,Migration Invasion,and Suppresses Apoptosis in Endometrial Cancer by Targeting MicroRNA-202-3p/T Cell Immunoglobulin and Mucin Domain 4 Axis

Abstract

Background:

Endometrial cancer (EC) is an intractable gynecological cancer with increasing incidence and mortality worldwide. Accumulating studies indicated that long noncoding RNA nuclear enriched autosomal transcript 1 (NEAT1) was a novel oncogene implicated in a variety of cancers. However, whether NEAT1 could accelerate cell growth in EC is unclear.

Materials and Methods:

NEAT1, microRNA (miR)-202-3p, and T cell immunoglobulin and mucin domain 4 (TIMD4) levels were detected by quantitative real-time polymerase chain reaction. Cell proliferation and apoptosis were examined by cell counting kit-8 and flow cytometry. Transwell assay was employed for the evaluation of cell migration and invasion. The relationship between miR-202-3p and NEAT1 or TIMD4 was determined by luciferase reporter system. TIMD4 protein expression was assessed by Western blot assay.

Results:

NEAT1 was upregulated, whereas miR-202-3p was downregulated in EC tumors and cells. Depletion of NEAT1 restrained EC cell proliferation, migration, invasion, and improved apoptosis. MiR-202-3p was targeted by NEAT1 and could bind to TIMD4. Subsequently, it is observed that miR-202-3p inhibitor neutralized NEAT1 silencing mediated suppression on EC cell progression. Meanwhile, TIMD4 rescued miR-202-3p induced inhibition on cell progression in EC. Furthermore, it was obvious that NEAT1 facilitated TIMD4 expression by absorbing miR-202-3p in EC.

Conclusions:

Upregulation of NEAT1 accelerated EC cell progression through sponging miR-202-3p to facilitate TIMD4 expression, providing potential novel treatment method for EC.

Introduction

Endometrial cancer (EC) is an aggressive cancer and mainly occurred in women, especially young women.¹ It is clarified as EC type I and type II. Type I EC is the common EC with the favorable prognosis. Type II EC with poor prognosis and a high risk of metastasis is relatively high grade and has the histology of serous or clear cell.² Although type II accounts for only 10% of EC tumors, it accounts for 40% of all deaths.³ This study focused on type II EC. The risk factors for EC are complex, such as obesity, estrogen stimulation, infertility, polycystic ovarian syndrome, insulin resistance, and aberrant endometrial hyperplasia.^4,5 The standard treatment for EC is hysterectomy. However, the 5-year survival is still ∼15%–50% due to local recurrence, delayed diagnosis, and distal metastases.^6
–8 Therefore, illumination of the specific pathogenesis genetically might provide effective therapy methods for EC.

Long noncoding RNAs (lncRNAs) are conserved transcripts that regulate cell cycle, metabolism, proliferation, inflammation, metastasis, and apoptosis in multiple diseases.^9
–11 The nuclear enriched autosomal transcript 1 (NEAT1) acted as novel oncogene in various cancers, including melanoma, hepatocellular carcinoma, and cervical cancer.^12
–14 For instance, NEAT1 was overexpressed in retinoblastoma and overexpression of NEAT1 facilitated the development of human retinal pigment epithelium cells by binding to miRNA (miR)-204 and boosting chemokine CXC receptor 4 expression.¹⁵ Similarly, NEAT1 expedited the exacerbation of EC by facilitating cell proliferation, invasion, and inhibiting apoptosis through miR-361/STAT3 axis.¹⁶ NEAT1 sponged miR-23a-3p to upregulate SMC1A expression, thereby accelerating tumorigenesis and progression of acute myeloid leukemia.¹⁷ Thus, the authors suggested that NEAT1 functions as a significant tumor promotor involved in tumorigenesis and progression of EC.

MicroRNAs (miRNAs) are small noncoding RNAs with 16–25 nucleotides and cannot be translated into protein.¹⁸ Increasing data have proved that miRNAs participate in many physiological processes by gene regulation at post-transcriptional level, including messenger RNAs (mRNAs) degradation and protein translation interference.^19
–21 They also participate in cell viability, migration, infiltration, autophagy, apoptosis, and radio resistance in different cancers.²² For example, miR-202-3p acted as a tumor suppressor in papillary thyroid carcinoma to restrain cell migration and invasion by regulation of wingless (WNT) signaling.²³ Similarly, miR-202-3p could interact with the metastasis-associated lung adenocarcinoma transcript 1/periostin axis to suppress proliferation, epithelial-mesenchymal transition (EMT), and invasion through protein kinase B/mammalian target of rapamycin pathway.²⁴ Zhao et al. discovered that miR-202-3p was reduced in gastric cancer and played suppressive role in tumor cell development through binding to Gli1.²⁵ Thus, it is imperative to probe into the effect of miR-202-3p on EC.

The authors purposed to elucidate the biological mechanism of NEAT1 during cell development in EC. Upregulation of NEAT1 in EC tumors and cells suggested the oncogenic role of NEAT1. Silencing of NEAT1 repressed EC cell proliferation, migration, invasion, and accelerated apoptosis, clarified the promotive effects of NEAT1. Significantly, it is discovered that NEAT1 facilitated EC cell development through sponging miR-202-3p to enhance T cell immunoglobulin and mucin domain 4 (TIMD4) expression.

Materials and Methods

Tissue samples

Type II EC patients (n = 20) without preoperative treatment were recruited from Beijing Tongren Hospital. All the EC tumors and the adjacent normal tissues were harvested from those participants by surgery. Those patients have signed informed consent. The protocols were approved by Ethics Committee of Beijing Tongren Hospital.

Cell culture and transfection

EC cells RL95, AN3CA, and neuroendocrine cells (NE) were bought from ATCC (Manassas, VA) and cultured in Dulbecco's modified Eagle's medium (Gibco, Carlsbad, CA) with 0.05% penicillin/streptomycin and 10% fetal bovine serum. Small interfering RNA of NEAT1 (si-NEAT1), control (si-control), cDNA plasmid (pcDNA), and TIMD4 overexpression vector were synthesized from Genepharma (Shanghai, China). MiR-202-3p mimics, miR-202-3p inhibitor (anti-miR-889-3p), and their controls (miR-NC and anti-miR-NC) were purchased from RIBOBIO (Guangzhou, China). Lipofectamine 2000 (Invitrogen, Carlsbad, CA) was employed for cell transfection.

Quantitative real-time polymerase chain reaction

TRIzol reagent (Invitrogen) was applied to isolated total RNA by TRIzol reagent (Invitrogen) was used to synthesize complementary DNA (cDNA) by All-in-One™ First-Strand cDNA. SYBR green (Applied Biosystems, Foster City, CA) was used for quantitative polymerase chain reaction. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and U6 were used to normalize NEAT1, miR-202-3p and TIMD4 levels. The primers were as follows (5′ to 3′): NEAT1 (forward [F], CTTCCTCCCTTTAACTTATCCATTCAC; reverse [R], CTCTTCCTCCACCATTACCAACAATAC); miR-202-3p (F, AGAGGTATAGGGCATGGGAA; R, GGAGACCGCCTGGGAATA); TIMD4 (F, CAAACACGTGCCTTTCACTAACC; R, GACTCAACACTACTCCAGGAATCAC); GAPDH (F, AGGTCGGTGTGAACGGATTTG; R, GGGGTCGTTGATGGCAACA); U6 (F, ACCCTGAGAAATACCCTCACAT; R, GACGACTGAGCCCCTGATG).

Cell counting kit-8 assay

Cell counting kit-8 (CCK-8) assay was applied to determined cell proliferation. In brief, transfected RL95 and AN3CA cells were inoculated on 96-well plates. After proliferation for 24, 48, and 72 h, each well was added with 10 μL CCK-8 (Beyotime, Shanghai, China) and incubated for 2 h. Finally, a microplate reader was used to measure the optical density value at 450 nm.

Flow cytometry

Annexin V-Fluorescein (FITC)/PI apoptosis detection kit (Vazyme, Nanjing, China) was exploited for the analysis of cell apoptosis. In brief, at 48 h after transfection, the cells were collected, centrifuged, resuspended, and stained with Annexin V-FITC and PI for 15 min. Finally, the cells were detected by a flow cytometer.

Transwell assay

Transwell chambers were employed for the detection of migration and invasion. Matrigel was precoated into the upper chamber for invasion assay (without Matrigel for migration assay). Then, transfected RL95 and AN3CA cells were added in the upper chamber for 48 h. Next, 0.1% crystal violet (Sigma, St. Louis, MO) was used to stain the migrated and invaded cells at lower chamber. The migration and invasion rated was measured by a microscope.

Luciferase reporter assay

The fragment of NEAT1 and TIMD4 containing binding sequences of miR-202-3p (NEAT1-WT and TIMD4-WT) and their mutant sequences (NEAT1-MUT and TIMD4-MUT) were constructed into pGL3 luciferase vector. Subsequently, RL95 and AN3CA cells were co-transfected with reporter vector and miR-202-3p or miR-NC for 48 h. Next, luciferase activities were measured through a luminometer (Promega GloMax 20/20 Luminometer).

Western blot

TIMD4 and GAPDH protein were extracted from RL95 and AN3CA cells. Protein expression of TIMD4 and GAPDH was analyzed by Western blot. Polypropylene gel electrophoresis was exploited to separate the proteins. After that, the proteins were transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA) and then blocked by 5% nonfat milk. Primary antibodies against TIMD4 and GAPDH (Abcam, Cambridge, MA) were used to incubate the membranes overnight at 4°C. Finally, the membranes were incubated with secondary antibody (Sangon, Shanghai, China) and detected by an ECL Western blot kit (Beyotime).

Statistical analysis

Data were conducted by SPSS software and GraphPad Prism 7 and showed as means ± standard deviation. Pearson's correlation coefficient was employed to detect the correlation between miR-202-3p and NEAT1 or TIMD4. Statistically significant was determined when p-value <0.05.

Results

Upregulation of NEAT1 in EC

The potential role of NEAT1 during EC development was evaluated by measuring NEAT1 levels in EC tumors and cells using quantitative real-time polymerase chain reaction. As exhibited in Figure 1A, NEAT1 level was evidently elevated in EC tumors relative to the adjacent normal tissues. Meanwhile, NEAT1 was upregulated in EC cell lines (RL95, AN3CA) in comparison with neuroendocrine cells NE (Fig. 1B). Therefore, the authors implicated that NEAT1 might act as oncogene in EC.

FIG. 1.

NEAT1 expression was upregulated in EC tumors and cell lines. (A) NEAT1 expression in EC tumors and adjacent normal tissues was measured by qRT-PCR. (B) NEAT1 expression in EC cell lines (RL95, AN3CA) and neuroendocrine cells NE was measured by qRT-PCR. *p < 0.05. EC, endometrial cancer; NE, neuroendocrine; NEAT1, nuclear enriched autosomal transcript 1; qRT-PCR, quantitative real-time polymerase chain reaction.

Elimination of NEAT1 inhibited cell proliferation, migration, invasion, and facilitated apoptosis in EC

The regulatory effects of NEAT1 on EC cells was investigated by silencing of NEAT1 in EC cells. Apparently, the expression of NEAT1 in RL95 and AN3CA cells was decreased after NEAT1 knockdown (Fig. 2A, B). As expected, proliferation of EC cells was repressed when transfected with si-NEAT1 compared with si-control (Fig. 2C, D). Conversely, cell apoptosis was boosted by NEAT1 silencing (Fig. 2E, F). Synchronously, transwell assay exhibited that depletion of NEAT1 attenuated cell migration and invasion in EC (Fig. 2G, H). Taken together, depletion of NEAT1 inhibited cell progression in EC.

FIG. 2.

NEAT1 knockdown repressed cell proliferation, migration, and invasion in EC. RL95 and AN3CA cells were transfected with si-NEAT1 and si-control. (A, B) NEAT1 expression was analyzed by qRT-PCR. (C, D) Cell proliferation was examined by CCK-8 assay. (E, F) Cell apoptosis was detected by flow cytometry. (G, H) Cell migration and invasion were evaluated by transwell assay. *p < 0.05. CCK-8, cell counting kit-8.

NEAT1 acted as a sponger of miR-202-3p

Bioinformatics analysis by online database starbase predicted that miR-202-3p had potential binding sites of NEAT1 (Fig. 3A). To validate the prediction, NEAT1-WT and NEAT1-MUT were co-transfected in RL95 and AN3CA cells with miR-202-3p or miR-NC. As displayed in Figure 3B and C, miR-202-3p reduced the luciferase activity of NEAT1-WT in EC cells. Moreover, miR-202-3p expression was enhanced by NEAT1 silencing in RL95 and AN3CA cells (Fig. 3D). More importantly, downregulated miR-202-3p was observed in EC tumors and cells compared with their counterparts (Fig. 3E, F). All the data proved that NEAT1 was a sponger of miR-202-3p in EC.

FIG. 3.

MiR-202-3p was directly interacted with NEAT1. (A) The putative binding sites between NEAT1 and miR-202-3p were predicted by starbase. (B, C) Luciferase activity in RL95 and AN3CA cells co-transfected with NEAT1-WT or NEAT1-MUT and miR-202-3p or miR-NC using luciferase reporter assay. (D) The expression of miR-202-3p in RL95 and AN3CA cells transfected with si-control and si-NEAT1 was evaluated by qRT-PCR. (E) The expression of miR-202-3p in EC tumors compared with the adjacent normal tissues. (F) MiR-202-3p level in EC cell lines compared with NE cells. *p < 0.05.

NEAT1 modulated EC cell progression by sponging miR-202-3p

RL95 and AN3CA cells were transfected with si-control, si-NEAT1, si-NEAT1+anti-miR-NC, and si-NEAT1+anti-miR-202-3p to explore the influences of NEAT1/miR-202-3p axis on EC cell development. Interestingly, miR-202-3p level in RL95 and AN3CA cells was increased after si-NEAT1 transfection and decreased after anti-miR-202-3p transfection (Fig. 4A, B). CCK-8 results demonstrated that NEAT1 silencing-induced suppressive effect on cell proliferation was restored by miR-202-3p inhibitor (Fig. 4C, D). Consistently, abundance of miR-202-3p restricted cell migration and invasion. However, elimination of miR-202-3p reversed the effects (Fig. 4E, F). Oppositely, NEAT1 silencing-induced apoptosis was blocked by miR-202-3p inhibitor (Fig. 4G, H). Altogether, miR-202-3p inhibitor abolished NEAT1 silencing-mediated effects on cell progression in EC.

FIG. 4.

Inhibiting of MiR-202-3p attenuated NEAT1 knockdown-mediated effects on EC cells. RL95 and AN3CA cells were transfected with si-control, si-NEAT1, si-NEAT1+anti-miR-NC, and si-NEAT1+anti-miR-202-3p. (A, B) The level of miR-202-3p was detected by qRT-PCR. (C, D) Cell proliferation was examined by CCK-8 assay. (E, F) Cell migration and invasion were evaluated by transwell assay. (G, H) Cell apoptosis was detected by flow cytometry. *p < 0.05.

TIMD4 was targeted by miR-202-3p

By searching from Targetscan, miR-202-3p was found to comprise the binding sites of 3′-untranslated regions of TIMD4 (Fig. 5A). Reduction of luciferase activity in RL95 and AN3CA cells co-transfected with TIMD4-WT and miR-202-3p validated that miR-202-3p was directly interacted with TIMD4 (Fig. 5B, C). Furthermore, TIMD4 protein level was significantly decreased by miR-202-3p in RL95 and AN3CA cells (Fig. 5D, E). These findings clarified that TIMD4 was targeted by miR-202-3p in EC.

FIG. 5.

TIMD4 was a target of miR-202-3p. (A) The putative binding sites between TIMD4 and miR-202-3p were predicted by Targetscan. (B, C) Luciferase activity in RL95 and AN3CA cells co-transfected with TIMD4-WT or TIMD4-MUT and miR-202-3p or miR-NC using luciferase reporter assay. (D, E) Protein expression of TIMD4 in RL95 and AN3CA cells transfected with miR-NC and miR-202-3p was determined by qRT-PCR. *p < 0.05. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; UTR, untranslated region.

Restoration of TIMD4 counteracted miR-202-3p mediated inhibition on cell progression in EC

To investigate the effects of miR-202-3p/TIMD4 axis on EC cell growth, miR-NC, miR-202-3p, miR-202-3p+pcDNA, and miR-202-3p+TIMD4 was transfected into RL95 and AN3CA cells. TIMD4 level in RL95 and AN3CA cells was reduced by miR-202-3p and enhanced by TIMD4 (Fig. 6A, B). As expected, upregulation of TIMD4 accelerated, whereas downregulation of TIMD4 attenuated EC cell proliferation (Fig. 6C, D). By contrast, cell apoptosis promoted by miR-202-3p was reversed by TIMD4 (Fig. 6E). Moreover, TIMD4 restored the suppressed cell migration and invasion caused by miR-202-3p (Fig. 6F, G). Likewise, the colonies exhibited the same trend (Fig. 6H). Hence, it is demonstrated that miR-202-3p regulated cell progression by targeting TIMD4 in EC.

FIG. 6.

TIMD4 abrogated miR-202-3p mediated inhibitory effect on EC cells. RL95 and AN3CA cells were transfected with miR-NC, miR-202-3p, miR-202-3p+pcDNA and miR-202-3p+TIMD4. (A, B) Protein expression of TIMD4 was analyzed by Western blot. (C, D) Cell proliferation was evaluated by CCK-8 assay. (E) Cell apoptosis was proved by flow cytometry. (F, G) Cell migration and invasion were examined by transwell assay. (H) Analysis of colonies in transfected RL95 and AN3CA cells. *p < 0.05.

NEAT1 affected regulated cell growth through miR-202-3p/TIMD4 axis in EC

The regulatory mechanism of NEAT1/miR-202-3p/TIMD4 axis was further studied. As illustrated in Figure 7A and B, TIMD4 mRNA expression was decreased by NEAT1 silencing, whereas increased by anti-miR-202-3p. Meanwhile, miR-202-3p silencing attenuated the inhibition induced by NEAT1 silencing on TIMD4 protein expression in EC (Fig. 7C, D). Collectively, NEAT1 was able to target miR-202-3p to regulate TIMD4 in EC.

FIG. 7.

NEAT1 regulated TIMD4 expression by sponging miR-202-3p. RL95 and AN3CA cells were transfected with si-control, si-NEAT1, si-NEAT1+anti-miR-NC, and si-NEAT1+anti-miR-202-3p. (A, B) TIMD4 mRNA expression in transfected RL95 and AN3CA cells was analyzed by qRT-PCR. (C, D) TIMD4 protein expression in transfected RL95 and AN3CA cells was determined by Western blot. *p < 0.05. mRNA, messenger RNA.

Discussion

Recently, numerous evidences proved that dysregulation expression of lncRNA NEAT1 was a critical prognostic biomarker in many diseases, such as Alzheimer, liver injury, and nasopharyngeal carcinoma.^26
–28 For example, NEAT1 contributed to cell progression in pancreatic ductal adenocarcinoma by interacting with miR-302a-3p to modulate RELA proto-oncogene.²⁹ Increased expression of NEAT1 was reported to accelerate proliferation and repressed apoptosis in colon cancer through targeting miR-495-3p/CDK6 axis.³⁰ Consistently, Wang and colleagues revealed that NEAT1 contributed to hemangioma progression through binding to miR-361-5p to regulated vascular endothelial growth factor A.³¹ In addition, NEAT1 interacted with miR-34a-5p to drive nasopharyngeal carcinoma cell survival, migration, invasion, and EMT by modulation of Wnt/β-catenin signaling.³² Furthermore, NEAT1 activated EC cell viability, migration, and invasion.^16,32
–34 Consistent with the previous study, it is found that NEAT1 was upregulated in EC tissues and cells (RL95 and AN3CA). Furthermore, the knockdown of NEAT1 inhibited cell proliferation, migration, and invasion, and induced apoptosis in vitro.

Accumulated studies have demonstrated that lncRNAs are capable of regulating gene expression through targeting miRNAs.^35
–37 As predicted by starbase, it is indicated that miR-202-3p had potential binding sites of NEAT1. Also, the relationship between NEAT1 and miR-202-3p was verified by luciferase reporter assay. Aberrant expression of miR-202-3p was the pathogenesis in various diseases.³⁸ For instance, upregulated miR-202-3p could decrease myocardial ischemia-reperfusion injury through stimulating transforming growth factor beta 1/Smads signaling.³⁹ Interestingly, miR-202-3p was implicated in nonobstructive azoospermia by participating in sertoli cell progression and synthesis function regulation.⁴⁰ Moreover, miR-202-3p was reported to suppress tumor development by targeting ARL5A in human colorectal carcinoma.⁴¹ In this study, miR-202-3p was downregulated in EC tissues and cell lines. Interestingly, miR-202-3p inhibitor could reverse the effects of NEAT1 knockdown on cell proliferation, migration, invasion, and apoptosis. Therefore, NEAT1 regulated EC cell growth through sponging miR-202-3p.

The abnormal protein expression of oncogene plays a crucial role in the progression of cancers. Thus, the authors further explored the downstream proteins regulated by miR-202-3p in EC. The online software Targetscan revealed that TIMD4 had the binding sites of miR-202-3p. And the interaction between them was verified by dual-luciferase reporter assay. TIMD4 is a type of TIMD family, which is mainly in antigen presenting cells. Previous reports showed that the TIMD4 was related to various malignant cancers.^42,43 The findings were in agreement with the previously described that TIMD4 acted as an oncogene in EC. In addition, there were inverse correlation between TIMD4 and miR-202-3p, and TIMD4 overexpression neutralized miR-202-3p-induced inhibitory effects on EC cells. In addition, NEAT1 enhanced TIMD4 expression through miR-202-3p in EC. Although the limitation of this study is the lack of in vivo experiments, a novel regulatory mechanism of NEAT1/miR-202-3p/TIMD4 might provide the new directions for further study in EC.

Conclusions

In summary, it is elucidated that NEAT1 facilitated cell proliferation, migration, invasion, and inhibited apoptosis through binding to miR-202-3p to upregulate TIMD4 expression in EC. These results might provide prospective markers for the diagnosis and treatment of EC.

Footnotes

Authors' Contributions

C.X. was in charge of project development, data collection, data analysis, and article writing. J.Z. was responsible for project development, data collection, data analysis, and article editing. Y.F. did data collection and data analysis.

Disclosure Statement

The authors have no conflict of interest to declare.

Funding Information

This research received no specific fund from any funding agency in the public and commercial.

References

Zhou

, Zhao

, Mao

, et al. Long non-coding RNA NIFK-AS1 inhibits M2 polarization of macrophages in endometrial cancer through targeting miR-146a. Int J Biochem Cell Biol, 2018; 104:25.

Supernat

, Łapińska-Szumczyk

, Majewska

, et al. A multimarker qPCR platform for the characterisation of endometrial cancer. Oncol Rep, 2014; 31:1003.

Braun

, Overbeek-Wager

, Grumbo

. Diagnosis and management of endometrial cancer. Am Fam Physician, 2016; 93:468.

Conza

, Mirra

, Cali

, et al. The SGK1 inhibitor SI113 induces autophagy, apoptosis, and endoplasmic reticulum stress in endometrial cancer cells. J Cell Physiol, 2017; 232:12.

Zhao

, Sun

, Feng

, et al. Metformin is associated with reduced cell proliferation in human endometrial cancer by inhibiting PI3K/AKT/mTOR signaling. Gynecol Endocrinol, 2018; 34:5.

Zheng

, Liu

, Song

, et al. Long noncoding RNA-ATB impairs the function of tumor suppressor miR-126-mediated signals in endometrial cancer for tumor growth and metastasis. Cancer Biother Radiopharm, 2019; 34:1.

Wilczynski

, Danielska

, Domanska-Senderowska

, et al. Association of microRNA-200c expression levels with clinicopathological factors and prognosis in endometrioid endometrial cancer. Acta Obstet Gynecol Scand, 2018; 97:5.

, Zhu

, Yang

, et al. Risk factors for ovarian involvement in young and premenopausal endometrioid endometrial cancer patients. Eur J Obstet Gynecol Reprod Biol, 2018; 222:151.

Tian

, Wang

, Xiao

, et al. Long noncoding RNA SBF2-AS1 act as a ceRNA to modulate cell proliferation via binding with miR-188-5p in acute myeloid leukemia. Artif Cells Nanomed Biotechnol, 2019; 47:1.

10.

, Li

, Qi

, et al. SNHG14 confers gefitinib resistance in non-small cell lung cancer by up-regulating ABCB1 via sponging miR-206-3p. Biomed Pharmacother, 2019; 116:108995.

11.

, Dong

, Mao

, et al. Loss of lncRNA-SNHG7 promotes the suppression of hepatic stellate cell activation via miR-378a-3p and DVL2. Mol Ther Nucleic Acids, 2019; 17:P235.

12.

Yan

, Fu

, Zhu

, et al. Repression of lncRNA NEAT1 enhances the antitumor activity of CD8+T cells against hepatocellular carcinoma via regulating miR-155/Tim-3. Int J Biochem Cell Biol, 2019; 110:1.

13.

Yuan

, Zhou

, Lv

, et al. Involvement of NEAT1/miR-133a axis in promoting cervical cancer progression via targeting SOX4. J Cell Physiol, 2019; 234:10.

14.

Xia

, Zhou

, Han

, et al. lncRNA NEAT1 facilitates melanoma cell proliferation, migration, and invasion via regulating miR-495-3p and E2F3. J Cell Physiol, 2019; 234:11.

15.

Zhong

, Yang

, Li

, et al. Long noncoding RNA NEAT1 promotes the growth of human retinoblastoma cells via regulation of miR-204/CXCR4 axis. J Cell Physiol, 2019; 234:7.

16.

Dong

, Xiong

, Yue

, et al. Long noncoding RNA NEAT1 drives aggressive endometrial cancer progression via miR-361-regulated networks involving STAT3 and tumor microenvironment-related genes. J Exp Clin Cancer Res, 2019; 38:1.

17.

Zhao

, Wang

, Zhao

, et al. Long noncoding RNA NEAT1 modulates cell proliferation and apoptosis by regulating miR-23a-3p/SMC1A in acute myeloid leukemia. J Cell Physiol, 2019; 234:5.

18.

Sun

, Cheng

, Zhang

, et al. MicroRNA-889-3p targets FGFR2 to inhibit cervical cancer cell viability and invasion. Exp Ther Med, 2019; 18:2.

19.

Zhang

, Li

, Zhao

, et al. MiR-494 acts as a tumor promoter by targeting CASP2 in non-small cell lung cancer. Sci Rep, 2019; 9:1.

20.

, Fang

, Cao

, et al. miR-449a Regulates proliferation and chemosensitivity to cisplatin by targeting cyclin D1 and BCL2 in SGC7901 cells. Dig Dis Sci, 2014; 59:2.

21.

Shen

, Xiao

, Wu

, et al. Epigenetic silencing of miR-490-3p reactivates the chromatin remodeler SMARCD1 to promote Helicobacter pylori-induced gastric carcinogenesis. Cancer Res, 2015; 75:4.

22.

Liu

, Feng

, Chen

, et al. Downregulation of NEAT1 reverses the radioactive iodine resistance of papillary thyroid carcinoma cell via miR-101-3p/FN1/PI3K-AKT signaling pathway. Cell Cycle, 2019; 18:2.

23.

Chen

, Yin

, Liu

, et al. MiR-202-3p functions as a tumor suppressor and reduces cell migration and invasion in papillary thyroid carcinoma. Eur Rev Med Pharmacol Sci, 2019; 23:1145.

24.

Han

, Wang

, et al. Long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1/microRNA-202-3p/periostin axis modulates invasion and epithelial-mesenchymal transition in human cervical cancer. J Cell Physiol, 2019; 234:8.

25.

Zhao

, Li

, Wang

, et al. Decrease of miR-202-3p expression, a novel tumor suppressor, in gastric cancer. PLoS One, 2013; 8:7.

26.

Liu

, Wu

, et al. NEAT1 is a potential prognostic biomarker for patients with nasopharyngeal carcinoma. J Cell Biochem, 2019; 120:6.

27.

Zhao

, Wang

, et al. The long-non-coding RNA NEAT1 is a novel target for Alzheimer's disease progression via miR-124/BACE1 axis. Neurol Res, 2019; 41:6.

28.

Zhang

, Niu

. LncRNA NEAT1 promotes inflammatory response in sepsis-induced liver injury via the Let-7a/TLR4 axis. Int Immunopharmacol, 2019; 75:105731.

29.

Luo

, Yi

, Ou

, et al. RELA/NEAT1/miR-302a-3p/RELA feedback loop modulates pancreatic ductal adenocarcinoma cell proliferation and migration. J Cell Physiol, 2019; 234:4.

30.

, Dang

, Song

, et al. NEAT1 promotes colon cancer progression through sponging miR-495-3p and activating CDK6 in vitro and in vivo. J Cell Physiol, 2019; 234:11.

31.

, Liu

, Wang

, et al. Long non-coding RNA NEAT1 promotes the progression of hemangioma via the miR-361-5p/VEGFA pathway. Biochem Biophys Res Commun, 2019; 512:4.

32.

, Wang

, Li

, et al. The long noncoding RNA NEAT1 targets miR-34a-5p and drives nasopharyngeal carcinoma progression via Wnt/β-catenin signaling. Yonsei Med J, 2019; 60:4.

33.

Wang

, Ge

, Xu

, et al. LncRNA NEAT1 promotes endometrial cancer cell proliferation, migration and invasion by regulating the miR-144-3p/EZH2 axis. Radiol Oncol, 2019; 53:434.

34.

Dong

, Xiong

, Yue

, et al. Exploring lncRNA-mediated regulatory networks in endometrial cancer cells and the tumor microenvironment: Advances and challenges. Cancers (Basel), 2019; 11:234.

35.

Huang

. The novel regulatory role of lncRNA-miRNA-mRNA axis in cardiovascular diseases. J Cell Mol Med, 2018; 22:5768.

36.

Wang

, Lou

, Ding

, et al. A novel mRNA-miRNA-lncRNA competing endogenous RNA triple sub-network associated with prognosis of pancreatic cancer. Aging (Albany NY), 2019; 11:2610.

37.

Fan

, Ma

, Liu

. Systematic analysis of lncRNA-miRNA-mRNA competing endogenous RNA network identifies four-lncRNA signature as a prognostic biomarker for breast cancer. J Transl Med, 2018; 16:264.

38.

Farahani

, Rubbi

, Liu

, et al. CLL exosomes modulate the transcriptome and behaviour of recipient stromal cells and are selectively enriched in miR-202-3p. PLoS One, 2015; 10:10.

39.

, Wu

, Ni

. Overexpression of microRNA-202-3p protects against myocardial ischemia-reperfusion injury through activation of TGF-beta1/Smads signaling pathway by targeting TRPM6. Cell Cycle, 2019; 18:5.

40.

Yang

, Yao

, Tian

, et al. miR-202-3p regulates sertoli cell proliferation, synthesis function, and apoptosis by targeting LRP6 and cyclin D1 of Wnt/β-catenin signaling. Mol Ther Nucleic Acids, 2019; 14:1.

41.

Wang

, Huang

, Guo

, et al. microRNA-202-3p inhibits cell proliferation by targeting ADP-ribosylation factor-like 5A in human colorectal carcinoma. Clin Cancer Res, 2014; 20:5.

42.

Liu

, Wang

, Bai

, et al. IL-6 promotes metastasis of non-small-cell lung cancer by up-regulating TIM-4 via NF-κB. Cell Prolif, 2020; 53:e12776.

43.

Tan

, Zhang

, Yao

, et al. Tim-4 promotes the growth of colorectal cancer by activating angiogenesis and recruiting tumor-associated macrophages via the PI3K/AKT/mTOR signaling pathway. Cancer Lett, 2018; 436:119.