Hand-Made Cloned Goat ( Capra hircus ) Embryos—A Comparison of Different Donor Cells and Culture Systems

Abstract

Nuclear transfer is a very effective method for propagation of valuable, extinct, and endangered animals. Hand-made cloning (HMC) is an efficient alternative to the conventional micromanipulator-based technique in some domestic species. The present study was carried out for the selection of suitable somatic cells as a nuclear donor and development of an optimum culture system for in vitro culture of zona-free goat cloned embryos. Cleavage and blastocyst rates were observed 72.06 ± 2.94% and 0% for fresh cumulus cells, 81.95 ± 3.40% and 12.74 ± 2.12% for cultured cumulus cells, and 92.94 ± 0.91% and 23.78 ± 3.33% for fetal fibroblast cells, respectively. There was a significant (p < 0.05) increase in blastocyst production in goats when cultured on a flat surface (FS) (23.78 ± 3.33 %) than well of wells (WOW) (15.84 ± 2.12 %) and microdrops (MD) (0.7 ± 0.7%). Furthermore, cleavage and blastocyst production rates were significantly (p < 0.05) more in the WOW (15.84 ± 2.12%) than the MD (0.7 ± 0.7%) system. The quality of HMC blastocysts was studied by differential staining. Genetic similarity was confirmed by polymerase chain reaction (PCR)-based amplification of the second exon of the MHC class II DRB gene, which gave similar bands in electrophoresis (286 bp) both in cloned embryos and donor cells. In conclusion, the present study describes that the fetal fibroblast cell is a suitable candidate as nuclear donor, and the flat surface culture system is suitable for zona-free blastocyst development by the hand-made cloning technique in the goat.

Introduction

Somatic cell nuclear transfer (SCNT) is the most efficient technique to propagate a highly valuable and extinct species (Lanza et al., 2000). This technology has been used successfully for transgenic animal production (Baguisi et al., 1999; Keefer et al., 2001). Although, the conventional micromanipulator-based embryo production was successful (Lagutina et al., 2007), the zona-free hand-made cloning (HMC) technology, today, is considered to be a preferred approach, with a higher success rate in producing cloned offspring of different livestock species. The utility of this technology has been reported in several livestock species, viz., cattle (Tecirlioglu et al., 2003, Vajta et al., 2004), horses (Lagutina et al., 2005), pigs (Du et al., 2005), and buffalo (Shah et al., 2008). Additionally, production of goat blastocysts (Akshey et al., 2008) and transgenic porcine blastocysts (Kragh et al., 2004) has also been reported using this technique.

Goat is an important source of milk, meat, hair, and manure throughout the world and it helps in sustaining the economy of the farmers. In the past, several attempts have been made to produce cloned (Lan et al., 2006; Shen et al., 2006) and transgenic goats (Baguisi et al., 1999; Keefer et al., 2001) using the micromanipulator system. However, no information is available to date, on the application of a HMC technique in goats, except a study by Akshey et al. (2008).

Despite the widespread success of somatic cell cloning, this technology is being hampered by various biological and technical problems (Vajta et al., 2003). Dinnyes et al. (2002) suggested the need to evaluate the technical procedures and the biological materials to further improve the efficiency of cloned embryo production. Various factors, viz., treatment of the donor cells and recipient oocytes, are known to be critical for the successful outcome of this technology.

Since the landmark achievement of Wilmut et al. (1997), there has been constant debate among the researchers about the appropriate donor cell cycle stage and cell type to be used as a nucleus donor. Investigators have evaluated various types of donor cells, such as embryonic stem cells, blastomeres, fibroblast cells, etc., with varied success rate in producing the blastocysts (Keto et al., 1998). Therefore, suitable donor cell types need to be identified for improving the efficiency of producing developmentally competent blastocysts.

Additionally, the culture system is also an important factor that can affect the efficiency of blastocyst production using the HMC method. Several culture systems like well-of-the-wells (WOW) (Vajta et al., 2001), agarose gels (Peura and Vajta, 2003), glass oviduct (Thouas et al., 2003), and microdrops (Oback et al., 2003) have been developed in the past for zona-free cloned embryos with variance in efficiency of blastocyst production. However, not mamy attempts have been made to evaluate the suitability of donor cell types and culture conditions for zona-free reconstituted goat embryos. Therefore, the present study was undertaken to select the suitable donor cells and to develop an optimized culture system for the preimplantation development of zona-free cloned goat embryos.

Materials and Methods

All chemicals and media were purchased from Sigma Chemical Co. (St. Louis, MO, USA) and disposable plastic wares were procured from Falcon-ware Becton-Dickinson (Bedford, MA, USA) unless otherwise stated.

In vitro maturation of oocytes

In vitro maturation (IVM) of goat oocytes were carried out as described by Malakar and Majumdar (2005). Briefly, goat ovaries were collected from a local abattoir and transported to laboratory within 3 h of collection in a thermo flask containing 0.9% normal warm (32–35°C) sterile saline fortified with antibiotics (50 μgmL⁻¹ gentamicin sulphate). The ovaries were washed four to five times with normal saline supplemented with antibiotics. Cumulus oocyte complexes (COCs) were aspirated by a puncturing method in the aspiration medium consisting of TCM-199 (HEPES modified) and bovine serum albumin (BSA) (0.3% w/v). COCs with more than three cumulus layers and homogeneous ooplasm were taken for in vitro maturation. COCs were washed two times with washing medium containing TCM 199 (HEPES modified), 10% fetal calf serum (FCS), 0.05 mgmL⁻¹ sodium pyruvate, 0.0035 mg/mL⁻¹ L-glutamine, and 50 μg/mL⁻¹ gentamicin sulphate and three times with maturation medium containing TCM-199 (HEPES modified), 10 μg/mL⁻¹ LH, 5 μg/mL⁻¹ FSH, 1 μg/mL⁻¹ estradiol-17β, 0.05 mg/mL⁻¹ sodium pyruvate, 5.5 mg/mL⁻¹ glucose, 35 μg/mL⁻¹ L-glutamine, 50 μg/mL⁻¹ gentamicin, 3 mg/mL⁻¹ BSA, and 10% EGS (heat-inactivated estrous goat serum). COCs (15–20 oocytes) were placed in 100 μL of maturation medium, covered with mineral oil and incubated in a CO₂ incubator (5% CO₂ in air) at 38.5°C for 22 h with maximum humidity.

Preparation of recipient cytoplast

The recipient cytoplasts were prepared as described previously (Vajta et al., 2006) with minor modifications. COCs with expanded cumulus cells were removed from the maturation droplet 24 h postmaturation and pipetted vigorously in TCM-199 medium supplemented with 25 mM HEPES and 5% FCS to remove the cumulus cells. The denuded oocytes with evenly granular ooplasm were incubated with pronase (2 mg/mL⁻¹) in T10 medium (where T denotes HEPES modified M-199 supplemented with 2.0 mM L-Glutamine, 0.2 mM Sodium Pyruvate, 50 μg/mL⁻¹ gentamicin, and the following number denotes 10% FBS) for 8 min at 38.5°C. When the oocytes with completely digested zona pellucida were transferred to T20 medium (T medium containing 20% FBS) and incubated at 38.5°C until a prominent protrusion cone was observed. The oocytes showing a protrusion cone were transferred to a 35-mm dish containing T20 medium with 2.5 μg/mL⁻¹ cytochalasin-B and mechanically bisected under a stereo zoom microscope (Olympus, Japan) using an ultrasharp splitting blade (SurgeEdge^TM) in such a way that the protrusion cone remains in the smaller half of the oocyte. The larger demioocytes with no protrusion cones were incubated in T20 medium for 15 min to regain the spherical shape.

Preparation of donor cells

Three types of somatic cells, viz., fetal fibroblast cells, fresh cumulus cells, and cultured cumulus cells, were evaluated to be used as the nucleus donor.

The source for fetal fibroblast cells were skin explants from goat fetuses of about 60 days collected from a local abattoir. The skin explants were washed seven to eight times with sterile Dulbecco's phosphate buffer saline (DPBS). Tissue slices were cultured using separate four-well dishes (4WD) (Nunc, Denmark) in Dulbecco's modified eagles medium (DMEM) supplemented with 20% FBS and 50 μg/mL⁻¹ gentamicin sulphate in 5% CO₂ at 37°C with maximum humidity. Monolayers of fibroblast cells were grown until confluency and were subcultured by partial trypsinization.

Cumulus cells were collected from in vitro matured COCs. After maturation, the expanded COCs were removed from the maturation droplet and pipetted vigorously in TCM-199 medium containing 25 mM HEPES and 5% FCS. The collected cumulus cells were cultured in 4WDs containing DMEM supplemented with 20% FBS at 37°C, 5% CO₂ in air, with maximum humidity. After reaching confluence, the monolayer was trypsinized and the cells were passaged further.

The confluent cells (both fetal fibroblast and cumulus cells) at the fifth to sixth passage were allowed to grow, for another 3 days, in order to achieve overconfluence. As a result, the majority of the cells were expected to reach the G0/G1 stage of the cell cycle. The cells were trypsinized and collected in T20 medium in order to be used as a nucleus donor.

Pairing and fusion

The enucleated demioocytes were incubated in phytohemagglutinin (0.5 mg/mL⁻¹) for 3–4 sec and transferred to T20 medium containing a low density of donor cells. These cells were prepared during the incubation period of 10–15 min to allow rounding up of the demioocytes. Each demioocyte was allowed to get attached to a single, rounded, medium-sized donor cell by phytohemagglutinin treatment for couplet formation. The couplets (demioocyte and donor cell pairs) were transferred to fusion medium containing 0.3 M Mannitol, 0.1 mM MgSO₄, 0.05 mM CaCl₂, and 3 mg/mL⁻¹ BSA for equilibration. The couplets and the other enucleated demioocytes were transferred to northern and southern parts of the fusion chamber (BTX micro slide 0.5-mm gap, model 450; BTX, San Diego, CA, USA) containing the fusion medium. Electrofusion of the triplets (couplet–demioocyte sandwich) was then carried out by a single-step method. A demioocyte and a couplet were picked up using a fine pulled capillary pipette (Unopette® Becton Dickinson, Franklin Lake, NJ, USA) having an inner diameter of 100–120 μm. Initially, the couplet was expelled and aligned with an AC pulse (7 volts) using a BTX Electrocell Manipulator 2000 (BTX), so that the somatic cell faces the negative electrode. Immediately after alignment, another demioocyte was introduced into the fusion chamber close to the couplet. As soon as the somatic cell was sandwiched between the demioocytes, a double DC pulse of 2.31 kV/cm for 15 μsec was applied. The triplets were then incubated in T20 medium for rounding up and subsequent reprogramming for 4 h at 38.5°C in a CO₂ incubator.

Activation and in vitro culture of the cloned embryo

The reconstructed oocytes were activated using 2 μM Ca ionophore in T20 medium for 5 min at 38.5°C after 4 h of fusion. The triplets were washed three times in T20 media and kept in individual droplets of 5 μL of T20 containing 2 mM 6-Dimethylaminopurine (6-DMAP) followed by incubation for 3 h in 5% CO₂ in air at 38.5°C.

The activated embryos were washed with embryo development medium (EDM) containing TCM-199 (HEPES modified), 10% FCS, 10 μL/mL⁻¹ essential and 5 μL/mL⁻¹ nonessential amino acids (from Sigma Chemicals) and 10 mg/mL⁻¹ BSA and cultured in three different culture systems: (1) WOW: hand-made microwells of 300 μm width and deepth were prepared with the help of a smooth, “V”-shaped darning needle (Booth et al., 2001) in a well of a 4WD (Nunc; Roskilde, Denmark) containing 400 μL of embryo development medium. This culture system is known as the WOW system (Vajta et al., 2001). The WOWs were prepared a day before the in vitro culture (IVC) of embryos, rinsed, and replaced with fresh medium just before IVC and covered with 400 μL of mineral oil. (2) Micro drops (MD): 5 μL droplets of EDM were prepared in a 4WD (10 microdrops in each well) and covered with 400 μL of mineral oil, (3) flat surface (FS): 400 μL of EDM was added to each well of the 4WD and covered with 400 μL of mineral oil and 10–15 presume cloned embryos were cultured in each well of 4WDs (FS). The embryos were kept carefully well apart in the periphery of the well of the 4WD to avoid aggregation or separation of single blastomere. The attachment of embryos was prevented due to high viscosity of culture medium owing to 10% FCS and 10 mg/mL⁻¹ BSA.

Quality assessment of HMC embryos and determination of blastocyst cell number

Rates of embryo development in terms of cleavage and blastocyst formation were observed on day 7 of IVC, and percentage of development of each stage of embryo was determined. The health of the blastocysts was determined by counting the cell numbers by differential stainings as described by Thouas et al. (2001). The blastocysts were incubated in DPBS with 1% Triton X-100 and 100 μg/mL⁻¹ propidine iodine for 15 sec and immediately transferred to 500 μL of fixative solution containing 100% ethanol with 25 μg/mL⁻¹ Hoechst 33342 for overnight incubation at 4°C. The cell number was counted using an inverted microscope (Nikon) fitted with an UV lamp and excitation filters.

Confirmation for production of cloned embryos from donor cells

Genomic DNA was isolated from the cloned embryos and nuclear donor cells. The second exon of the goat major histocompatibility complex (MHC) class II DRB gene (286 base pair) was amplified using the primer pair (F: 5′TATCCCGTCTCTGCAGCACATTTC3 ′; R: 5′ATCGCCGCTGCACACTGAAACTC3 ′) suggested by Keefer et al. (2002). The PCR product from the cloned embryos and nuclear donor cells was further analyzed through SSCP to confirm their genetic identity.

Statistical analysis

The data was analyzed using SYSTAT 7.0 (SPSS Inc., Chicago, IL, USA) after arcin transformation. Differences between means were analyzed by one-way analysis of variance (ANOVA) followed by a Fisher's LSD test. Significance was determined at p < 0.05.

Results

Oocyte bisection method and enucleation efficiency

A prominent protrusion cone was observed on the surface of each oocyte (Fig. 1A) upon transfer and subsequent incubation of zona pellucida-free oocytes in T20 medium (Fig. 1A). The higher enucleation efficiency of >95% (380/400, 6 replicates), achieved in the present work through protrusion cone guided bisection and selection of enucleated demioocyte without Hoechst 33342 staining indicated this approach to be a superior one for enucleating the zona-free goat oocytes (Fig. 1B).

FIG. 1.

Protrusion cone (arrow) produced on the surface of zona-free IVM goat oocytes within 30 min in T20 medium. (A) Individual oocytes during enucleation by oriented bisection with prominent protrusion cone. (B) Eight cell stage HMC embryos cultured in a well of well system. (C) Compact morula. (D) Blastocyst on the eighth day (E) and quality assessment of hand-made cloned blastocyst with Hoechst 33342 staining (F).

Experiment 1: Effect of different donor cells on development of hand-made cloned embryos

The three types of donor cells evaluated in the present study showed no significant difference in the couplet formation, triplet formation, fusion, cleaved embryo (Fig. 1C), and blastocyst (Fig. 1E) production rate. However, in terms of triplet formation and fusion rate, cultured cumulus cells provided relatively better result than fresh cumulus cells and fetal fibroblast cells (Table 1).

Table 1.

Couplet Formation Rate, Triplet Formation Rate, Fusion Rate, Cleavage Rate, and Blastocyst Formation Rate Using Different Donor Somatic Cells and Cultured in Embryo Development Medium

Cell type	Number of reconstructed Embryos	Couplet Formation rate¹ (N)	Triplet formation rate¹	Fusion rate¹	Cleavage rate¹	Blastocyst formation rate¹
Fetal fibroblast cells	142	86.72 ± 3.2^a (261)	80.62 ± 6.84^a (219)	71.63 ± 1.95^a (159)	92.94 ± 0.91^a	23.78 ± 3.33^a
Fresh cumulus cells	62	88.44 ± 1.23^a (140)	81.50 ± 2.19^a (114)	68.30 ± 5.99^a (78)	72.06 ± 2.94^b	0.00 ± 0.00^b
Cultured Cumulus cells	117	91.3 ± 0.45^a (174)	91.33 ± 0.84^b (159)	79.24 ± 1.97^b (126)	81.95 ± 3.40^c	12.74 ± 2.12^c

Figures quoted as percent mean ± SEM (n). Data from six trials for each donor cell type.

Values having different superscripts in the same column differ significantly (p < 0.05).

A significant (p < 0.05) increase in cleavage rate (92.94 ± 0.91%) and blastocyst production rate (23.78 ± 3.33%) was observed with fetal fibroblast cells compared to fresh cumulus cells (72.06 ± 2.94% and 0.00 ± 0.00%) and cultured cumulus cells (81.95 ± 3.40% and 12.74 ± 2.12%) (Table 1). Interestingly, no blastocyst production was seen with fresh cumulus cells, which might be attributed to the factors like composition of medium and/or biological materials.

Experiment 2: Effect of different culture systems on development of hand-made cloned embryos

Embryo development medium was used for comparing the development of cloned embryos in different culture systems. Considering the high cleavage and production rate observed, fetal fibroblast cells were used as nuclear donors for the present work. When compared, development and cleavage rates were better using a flat culture system (Table 2). Even in the case of zona-free reconstructed embryos, flat systems showed a significant (p < 0.05) increase in blastocyst production rate than the WOW or MD system (Table 2). Furthermore, cleavage and blastocyst production rate were significantly (p < 0.05) more in the WOW (15.84 ± 2.12 %) than the MD (0.7 ± 0.7%) system (Table 2).

Table 2.

Development Arte of Hand-made Cloned Goat Embryos in Different Culture Systems Using Fetal Fibroblast Cells

Culture system	Reconstructed (n)	Cleaved¹	Total blastocysts¹
FS	142	92.94 ± 0.91^a (132)	23.78 ± 3.33^a (34)
WOW	128	84.95 ± 2.40^b (110)	15.84 ± 2.12^b (16)
Microdrop	132	37.8 ± 7.12^c (50)	00.70 ± 0.7^c (1)

Figures quoted as percent mean ± SEM (n). Data from six trials.Values having different superscripts in the same column differ significantly (p < 0.05).

FS, flat surface; WOW, well of the wells.

The Hoechst 33342 staining reflected the good quality of HMC blastocyst (∼155 cells/blastocyst; Fig. 1F). HMC embryos produced from donor somatic cells were confirmed by PCR amplification of the highly polymorphic second exon of MHC class II DRB (Fig. 2). The PCR-SSCP analysis of the 286-bp product revealed a similar pattern for both cloned goat embryos and donor cells, confirming their genetic identity.

FIG. 2.

PCR analysis of the second exon of the caprine MHC class II DRB gene a. Lane 1: hand-made cloned embryos; lane 2: cumulus cells; lane 3: markers.

Discussion

In vitro cultured oocytes from different livestock species are known to take different time periods to reach the metaphase II stage. The reported time for in vitro maturation during IVF for bovine and ovine oocytes is 18–24 h (Chauhan et al., 1997a), whereas for caprine oocytes a slightly longer period of 27 h has been observed (Cognie et al., 2004; Crozet et al., 1995, Malakar and Majumdar 2005). For micromanipulator-based nuclear transfer, goat oocytes matured for 19–24 h are generally used (Daniel et al., 2008; Lan et al., 2006). In the present study as well, HMC goat oocytes were matured for 22 h before being processed for enucleation of oocytes.

For the removal of zona pellucida, several methods, viz., mechanical opening, chemical lysis, and enzymatic digestion, have been reported (Ji and Bavister 2000; Wells and Powell 2000). However, due to the slow nature of the mechanical procedure and irreversible damage caused during chemical lysis, enzymatic digestion is considered to be the preferred method for removal of zona pellucida in domestic livestock species. In the present study, enzymatic digestion using pronase was followed for zona digestion as suggested by Vajta et al. (2004). Interestingly, complete digestion of goat zona pellucida was achieved in 7 min compared to 10–15 min in cattle (Vajta et al., 2001) and 8 min in buffalo oocytes (Shah et al., 2008).

In the case of zona-digested oocytes, the first polar body moves away from the zona-free oocytes. Due to the opaqueness of the cytoplasm, the MII spindle and chromosomes remain invisible under light microscope. However, by localizing the second polar body (Pb2), the position of the chromosomes can be estimated indirectly (Fulka et al., 2001). The Pb2 remains closer to the nuclear materials because it does not have sufficient time to migrate, and thus can easily be visualized with a protrusion cone on the surface of matured oocytes. For murine and bovine oocytes, chemicals like sucrose and demecolcine (Vajta et al., 2001) are essential to make the protrusion cone clearer, whereas in the case of goat oocytes, the culture medium is found to be sufficient to produce a protrusion cone (Akshey et al., 2008).

A high rate (93%) of formation of the protrusion cone on the surface of matured oocytes was observed. In each of the oocytes, nuclear material was observed in the protrusion cone after Hoechst staining under UV light. However, damage resulting from exposure to this dye and UV light has been widely reported (Fulka et al., 2001; Galli et al., 2003). Because there is an enormous application of MII oocytes in nuclear transfer (NT), it is of immense importance to evaluate the different means to improve the enucleation process at this stage. Protrusion cone-guided bisection is considered to be one such method that can be used for enucleation of zona-free goat oocytes. In the present work, oocytes exhibiting a surface protrusion cone were selected for manual bisection. which resulted in a high (95%) enucleation rate.

The fusion efficiency of the hand-made method in cattle has been reported to be higher (90%) than the traditional NT technique (60–80%) in a number of studies (Booth et al., 2001; Kato et al., 2000; Vajta et al., 2003; Tecirlioglu et al., 2003; Wells et al., 1999). Similar observations have also been made in horses (Galli et al., 2003; Lagutina et al., 2005). In the present study, the single-step fusion (sandwich) protocol employed was observed to be more efficient (80% fusion rate) (Table 1) and convenient compared to a two-step fusion protocol. Activation of the recipient cytoplast by electric or a combination of electric and chemical stimuli (6-DMAP) is a critical element of the NT procedure. This combination has been successfully used for cattle (Cibelli et al., 1998) and rabbits (Mitalipov et al., 1999). However, prolonged exposure of 6-DMAP treatment to an electrofused oocyte–cell complex in cattle may affect the reprogramming process of the donor nuclear material resulting in chromosomal abnormalities (Van de Velde et al., 1999). On the other hand, shorter exposure of 6-DMAP does not cause any such abnormalities (Liu et al., 1998). In the case of cattle oocytes, the incubation period for activation during exposure to 6-DMAP was optimized to 4 to 6 h (Beyhan et al., 2002), whereas in the goat, it was optimized to 1–2.5 h (Lan et al., 2006). In the present study, the activation of triplets, though, was optimized to 3 h.

Chemicals like Ca ionophore and 6-DMAP have been used to obtain cloned embryos in cattle (Bhojwani et al., 2005; Tecirlioglu et al., 2005). However, in the goat, ionomycine is reported to be more effective than Ca ionophore and ethanol. Electric pulses were applied for production of cloned goat embryos using the traditional method (Melican et al., 2005; Shen et al., 2006). Melican et al. (2005) suggested that an additional electric pulse for activation was successful in producing live offspring. In the present study, electric pulse activation proved to be more efficient than Ca ionophore activation and resulted in a significant increase in cleavage and blastocyst production (data not shown).

Many cell types, including embryonic cells (Campbell et al., 1993), fibroblasts (Kato et al., 1998), mammary gland cells (Wilmut et al., 1997), cumulus cells (Wakayama et al., 1998), fibroblast cells from skin and internal organs, oviduct cells (Kato et al., 2000), sertoli cells (Ogura et al., 2000), blood leukocytes (Galli et al., 1999; Hochedlinger and Jaenisch, 2002), mural granulosa cells (Wells et al., 1999), germ cells (Bordignon et al., 2003), embryonic stem cells (Eggan et al., 2002), and colostrum-derived mammary gland epithelial cells (Kishi et al., 2000) have been successfully utilized as nucleus donors. However, it is still unclear which type cell is the most efficient for NT into oocytes (Kato et al., 2000).

Kato et al. (2000) compared efficiency of cloning using various somatic cell types from adult, newborn, and fetal female and male donor cattle. The percentage of blastocysts that developed from each of the donor cell types was not significantly different. Similarly, no differences among embryos derived from fetal and adult bovine fibroblasts with regard to fusion, cleavage, and blastocyst formation rates were detected (Nakajima et al., 2000). Similar results were obtained using various cell types derived from mice of different strains, sexes, and ages (Wakayama and Yanagimachi, 2001). In the present study, cleavage and blastocyst production rate were significantly (p < 0.05) higher when fetal fibroblast cells (92.94 ± 0.91% and 23.78 ± 3.33%) were used as nuclear donors than fresh cumulus cells (72.06 ± 2.94% and 0.00 ± 0.00%) and cultured cumulus cells (81.95 ± 3.40% and 12.74 ± 2.12%).

The embryo culture system also plays a significant role in determining the proportion of cloned embryo development to blastocysts formation. SCNT goat embryos have been cultured in 30–100-μL droplets of medium either in feeder-free culture (Das et al., 2003) or cocultured with cumulus cells (Keefer et al., 2002) with a periodic replacement with fresh medium during the 7 days of culture. The HMC embryos have been found to have a compromised development in microdrop culture (Vajta et al., 2000, 2001). Similar observations were made in present study; wherein in vitro development of HMC goat embryos in microdrops was significantly lower than the WOW and flat systems. WOW was the preferred and most efficient culture system for culturing zona-free cloned embryos (Booth et al., 2001a; Vajta et al., 2001) with a blastocyst yield of about 50% in cattle (Vajta, 2007). In comparison to cattle, lower developmental rates was observed in goats embryos in the WOW as well as the FS culture system. The FS culture system was found to be more efficient than WOW for in vitro development of HMC goat embryos. There was a significant increase in the rate of blastocyst production in flat culture than WOW (23.78 ± 3.33% vs. 15.84 ± 2.12%) Culturing of cloned embryos on a flat surface of a 4WD was advantageous, as lesser trophoblast adhesion of blastocyst to the plastic surface occurred. However, in the WOW system a higher number of embryo adhesion was observed, which has also been reported by Vajta et al. (2001). Care should be taken for successful FS culture to avoid aggregation of zona-free embryos by seeding them at a distance apart from each other, gentle handling, and undisturbed incubation until blastocyst formation.

The total number of cells (∼155) in HMC blastocysts (day 7) produced in the present study was comparable to those reported earlier in IVF goat blastocysts (data not shown). DRB gene was chosen to confirm the genetic identity of cloned goat embryos and donor cells, as they are highly polymorphic in nature. Keefer et al. (2002) has also confirmed the genetic identity of somatic cells and SCNT embryos/kids using the DRB gene.

In conclusion, a highly effective culture system for the development of HMC goat embryos has been developed, and it was observed that a flat surface system was superior in supporting the growth of HMC embryos in comparison to WOW or MD. Furthermore, fetal fibroblast cells has proved to be a better nuclear donor than fresh cumulus cells or cultured cumulus cells. This report also provides information regarding the comparison of different donor cells and culture systems in HMC embryo production in goat.

Footnotes

Acknowledgments

The authors are thankful to the Council of Scientific and Industrial Research (CSIR), India for supporting this work.

Author Disclosure Statement

The authors declare that no financial conflicts of interest exist.

References

Akshey

Y.S.

, Malakar

, De

A.K.

2008. Production of handmade cloned goat blastocysts using fibroblast cells. Reprod. Fertil. Dev, 2:91–92.

Baguisi

, Behboodi

, Melican

D.T.

et al. 1999. Production of goats by somatic cell nuclear transfer. Nat. Biotechnol., 17:456–461.

Beyhan

, Milatipova

, Chang

T.C.

et al. 2002. Donor cell passage number, starvation period and fusion-activation interval affect preimplantation development of bovine nuclear transfer embryos. Theriogenology, 57:396.

Bhojwani

, Vajta

, Callesen

et al. 2005. Developmental competence of HMCTM derived bovine cloned embryos obtained from somatic cell nuclear transfer of adult fibroblasts and granulosa cells. J. Reprod. Dev., 51:465–475.

Booth

P.J.

, Tan

S.J.

, Holm

et al. 2001a. Application of the zona-free manipulation technique to porcine somatic cell nuclear transfer. Cloning Stem Cells, 4:191–197.

Bordignon

, Keyston

, Lazaris

et al. 2003. Transgene expression of green fluorescent protein and germ cell line transmission in cloned calves derived from in vitro transfected somatic cells. Biol. Reprod., 68:2013–2023.

Campbell

K.H.S.

, Ritchie

W.A.

, Wilmut

1993. Nuclear–cytoplasmic interactions during the first cell cycle of the nuclear transfer reconstituted bovine embryos: implications for deoxyribonucleic acid replication and development. Biol. Reprod., 49:933–942.

Chauhan

M.S.

, Katiyar

P.K.

, Madan

M.L.

1997a. In vitro production of blastocysts in goats, sheep and buffaloes. Ind. J. Anim. Sci., 65:394–396.

Cibelli

J.B.

, Stice

S.L.

, Golueke

P.J.

et al. 1998. Cloned transgenic calves produced from nonquiescent fetal fibroblasts. Science, 280:1256–1258.

10.

Cognie

, Poulin

, Locatelli

et al. 2004. State of the art production, conservation and transfer of in vitro produced embryos in small ruminants. Reprod. Fertil. Dev., 16:437–445.

11.

Crozet

, Ahmed-Ali

, Dubos

M.P.

1995. Development competence of goat oocytes from follicles of different size categories following maturation, fertilization and culture in vitro. J. Reprod. Fertil., 103:293–298.

12.

Daniel

S.M.

, Raipuria

, Sarkhel

B.B.

2008. Efficiency of cloned embryo production using different types of donor and electric fusion strengths in goats. Small Rumin. Res., 77:45–50.

13.

Das

S.K.

, Majumdar

A.C.

, Sharma

G.T.

2003. In vitro development of reconstructed goat oocytes after somatic cell nuclear transfer with fetal fibroblast cells. Small Rumin. Res., 48:217–225.

14.

Dinnyes

, De Sousa

, King

et al. 2002. Somatic cell nuclear transfer: recent progress and challenges. Cloning Stem Cells, 4:81–90.

15.

, Kragh

P.M.

, Zhang

et al. 2005. Overall in vitro efficiency of porcine hand-made cloning (HMC) combing partial zona digestion and oocyte trisection with sequential culture. Cloning Stem cells, 7:199–205.

16.

Eggan

, Rhode

, Jentsch

et al. 2002. Male and female mice derived from the same ES cell clone by tetraploid embryo complementation. Nat. Biotechnol., 20:455–459.

17.

Fulka

Jr. , Loi

, Ledda

et al. 2001. Nucleus transfer in mammals: how the oocyte cytoplasm modifies the transferred nucleus. Theriogenology, 55:1373–1380

18.

Galli

, Duchi

, Moor

R. M.

et al. 1999. Mammalian leucocytes contain all the genetic information necessary for the development of new individual. Cloning, 1:161–170.

19.

Galli

, Lagutina

, Crotti

et al. 2003. Pregnancy: a cloned horse born to its dam twin. Nature, 424:635.

20.

Hochedlinger

, Jaenisch

2002. Monoclonal mice generated by nuclear transfer from mature B and T donor cells. Nature, 415:1035–1038.

21.

, Bavister

B.D.

2000. Development of zona free hamster ova to blastocysts in vitro. Theriogenology, 54:827–834.

22.

Kasinathan

, Knott

J.G.

, Moreira

P.N.

et al. 2001a. Effect of fibroblast donor cell age and cell cycle on development of bovine nuclear transfer embryos in vitro. Biol. Reprod., 64:1487–1493.

23.

Kato

, Tani

, Sotomaru

et al. 1998. Eight calves cloned from somatic cells of a single adult. Science, 282:2095–2098.

24.

Kato

, Tani

, Tsunoda

2000. Cloning of calves from various somatic cell types of male and female adult, newborn, and fetal cows. J. Reprod. Fertil., 120:231–237.

25.

Keefer

C.L.

, Baldassarre

, Keyston

et al. 2001. Generation of dwarf goat (Capra hircus) clones following nuclear transfer with transfected and nontransfected fetal fibroblasts and in vitro matured oocytes. Biol. Reprod., 64:849–856.

26.

Keefer

C.L.

, Keyston

, Lazaris

et al. 2002. Production of cloned goats from nuclear transfer using adult somatic cells. Biol. Reprod., 66:199–203.

27.

Kishi

, Itagoki

, Takakura

et al. 2000. Nuclear transfer in cattle using colostrums-derived mammary epithelial cells and ear-derived fibroblast cells. Theriogenology, 54:675–684.

28.

Kragh

, Vajta

, Corydon

T.J.

et al. 2004. Production of transgenic porcine blastocyst by hand-made cloning. Reprod. Fertil. Dev., 16:315–318.

29.

Lagutina

, Lazzari

, Duchi

et al. 2005. Somatic cell nuclear transfer in horses: effect of oocyte morphology, embryo reconstruction method and donor cell type. Reproduction, 130:559–567.

30.

Lagutina

, Lazzari

, Duchi

et al. 2007. Comparative aspects of somatic cell nuclear transfer with conventional and zona-free method in cattle, horse, pig and sheep. Theriogenology, 67:90–98

31.

Lan

G.C.

, Chang

Z.L.

, Luo

M.J.

et al. 2006. Production of cloned goats by nuclear transfer of cumulus cells and long-term cultured fetal fibroblast cells into abattoir-derived oocytes. Mol. Reprod. Dev., 73:834–840.

32.

Lanza

R.P.

, Cibelli

J.B.

, Blackwell

et al. 2000. Extension of cell life-span and telomere length in animals cloned from senescent somatic cells. Science, 288:665–669.

33.

Liu

, Ju

J.C.

, Yang

1998. Differential inactivation of maturation-promoting factor and mitogen-activated protein kinase following parthenogenetic activation of bovine oocytes. Biol. Reprod., 59:537–545.

34.

Malakar

, Majumdar

A.C.

2005. Isolation, identification and characterization of secretory proteins of IVMFC embryos and blood circulation of estrus and early pregnant goat. Indian J. Expl. Biol., 43:414–419.

35.

Melican

, Butler

, Hawkins

et al. 2005. Effect of serum concentration, methods of trypsinization and fusion/activation utilizing transfected fetal cells to generate transgenic dairy goats by somatic cell nuclear transfer. Theriogenology, 63:1549–1563.

36.

Mitalipov

S.M.

, White

K.L.

, Farrar

V.R.

et al. 1999. Development of nuclear transfer and parthenogenetic rabbit embryos activated with inositol 1,4,5-trisphosphate. Biol. Reprod., 60:821–827.

37.

Nakajima

, Kim

Y.B.

, Terano

et al. 2000. FR90 a potent antitumor antibiotic is a novel histone deacetylase inhibitor. Exp. Cell Res., 241:126–133.

38.

Oback

, Wiersema

A.T.

, Gaynor

et al. 2003. Cloned cattle derived from a novel zona-free embryo reconstruction system. Cloning Stem Cells, 5:3–12.

39.

Ogura

, Inoue

, Ogonuki

et al. 2000. Production of male cloned mice from fresh, cultured, and cryopreserved immature Sertoli cells. Biol. Reprod., 62:1579–1584.

40.

Peura

T.T.

, Vajta

2003. A comparison of established and new approaches in ovine and bovine nuclear transfer. Cloning Stem Cells, 5:257–277.

41.

Shah

R.A.

, George

, Singh

M.K.

et al. 2008. Hand-made cloned buffalo (Bubalus bubalis) embryos: comparison of different media and culture systems. Cloning Stem Cells, 10:435–442.

42.

Shen

P.C.

, Lee

S.N.

, Wu

J.S.

et al. 2006. The effect of electrical field strength on activation and development of cloned caprine embryos. Anim. Reprod. Sci., 92:310–320.

43.

Tecirlioglu

R.T.

, French

A.J.

, Lewis

I.M.

et al. 2003. Birth of a cloned calf derived from a vitrified hand-made cloned embryo. Reprod. Fertil. Dev., 15:361–366.

44.

Tecirlioglu

R.T.

, Cooney

M.A.

, Lewis

I.M.

et al. 2005. Comparison of two approaches to nuclear transfer in the bovine: hand-made cloning with modifications and the conventional nuclear transfer technique. Reprod. Fertil. Dev., 17:573–585.

45.

Thouas

G.A.

, Jones

G.M.

, Trounson

A.O.

2001. A novel method for micro-culture of mouse zygotes to the blastocyst stage—the “GO” system. Proceedings of the 17th Annual Conference of the European Society of Human Reproduction and Embryology (ESHRE), Lausanne, SwitzerlandAbstract 168.

46.

Thouas

G.A.

, Jones

G.M.

, Trounson

A.O.

2003. The “GO” system: a novel method for microculture for in vitro development of mouse zygotes to the blastocyst stage. Reproduction, 126:161–169.

47.

Vajta

2007. Handmade cloning: the future way of nuclear transfer. Trends Biotechnol., 25:250–253.

48.

Vajta

, Peura

T.T.

, Holm

et al. 2000. New method for culture of zona-included or zona-free embryos: the well of the well (WOW) system. Mol. Reprod. Dev., 55:256–264.

49.

Vajta

, Lewis

I.M.

, Hyttel

, Thouas

G.A.

, Trounson

A.O.

2001. Somatic cell cloning without micromanipulators. Cloning, 3:89–95.

50.

Vajta

, Lewis

I.M.

, Trounson

A.O.

et al. 2003. Handmade somatic cell cloning in cattle: analysis of factors contributing to high efficiency in vitro. Biol. Reprod., 68:571–578.

51.

Vajta

, Peura

T.T.

, Lai

et al. 2004. Highly efficient and reliable chemically assisted enucleation method for hand-made cloning (HMC) in cattle and pig. Reprod. Fertil. Dev., 16:159.

52.

Vajta

, Lewis

I.M.

, Tecirlioglu

R. T.

2006. Handmade somatic cell cloning in cattle. Methods Mol. Biol., 348:183–196.

53.

Van de Velde

, Liu

, Bols

P.E.J.

et al. 1999. Cell allocation and chromosomal complement of parthenogenetic and IVF bovine embryos. Mol. Reprod. Dev., 54:57–62.

54.

Wakayama

, Perry

A.C.

, Zuccotti

et al. 1998. Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature, 394:369–374.

55.

Wakayama

, Yanagimachi

2001. Mouse cloning with nucleus donor cells of different age and type. Mol. Reprod. Dev., 58:376–383.

56.

Wells

D.N.

, Misica

P.M.

, Tervit

H.R.

1999. Production of cloned calves following nuclear transfer with cultured adult mural granulosa cells. Biol. Reprod., 60:996–1005.

57.

Wells

K.D.

, Powell

A.M.

2000. Blastomere from somatic cell nuclear transfer embryos are not allocated randomly in chimeric blastocysts. Cloning, 2:9–22.

58.

Wilmut

, Schniek

A.E.

, McWhir

et al. 1997. Viable offspring derived from fetal and adult mammalian cells. Nature, 385:810–813.