Thymic Epithelial Cells Induced from Pluripotent Stem Cells by a Three-Dimensional Spheroid Culture System Regenerates Functional T Cells in Nude Mice

Abstract

The thymus is mainly composed of two types of epithelial cells, medullary thymic epithelial cells and cortex thymic epithelial cells (mTECs and cTECs). The tissue structure and mechanism for T cell development are complicated, with generation of the thymus regulated by complex molecular and cellular interactions of the thymic microenvironment during embryogenesis. Since the development of organ regeneration techniques became available, complete in vitro regeneration of the thymus has been attempted. Steric induction systems are thought to be optimal for tissue regeneration, but three-dimensional (3-D) induction of TECs from induced pluripotent stem cells (iPSCs) has not yet been reported. Here, we demonstrate the induction of functional TECs from iPSCs by a 3-D spheroid culture system with recruitment of robust numbers of T cells into the peripheral blood. Purified iPSC-derived TECs showed a sufficient expression level of FoxN1 comparable to TECs, and phenotypic analysis revealed that iPSC-derived TECs were expressing K5. Moreover, transplants of cell aggregations into recipient mice were not rejected and there was normal support of T cell development. Functional analysis revealed that T cells showed immune tolerance to both donor and recipient MHCs and could reject an allogeneic third party's skin graft without tumorigenesis. Taken together, these findings raised the possibility of using iPSC-derived TECs induced by 3-D spheroid culture in future regenerative therapy for patients with immunodeficiency.

Introduction

The thymus is the primary lymphoid organ and plays a crucial role in the normal development of T cells (Miller, 1961). As progenitors of T cells are recruited to the thymus from bone marrow via the peripheral blood, the thymic microenvironment, composed of medullary and cortex thymic epithelial cells (mTECs and cTECs), supports T cell development (Manley et al., 2011). Both mTECs and cTECs derive from a common thymic progenitor, and forkhead box FoxN1 is known as an essential factor for their development (Blackburn et al., 1996; Nehls et al., 1996). The disruption of TECs leads to athymia or immunodeficiency (Holub et al., 1975; Markert et al., 1999). Because the thymus undergoes age-dependent involution and stress-dependent (i.e., irradiation- and chemotherapy-induced) degeneration, the use of stem cells as a potential source of TECs to restore thymic function is of great therapeutic interest. To restore T cell developmental deficiency, thymic transplantation therapy has been performed in human and animal models (Hong et al., 1979; Markert et al., 2003; van den Brink et al., 2004). Since the studies of induced pluripotent stem cells (iPSCs) have shown new insights for hereditary disorders (Hanna et al., 2007; Jiang et al., 2013; Suzuki et al., 2013; Takahashi and Yamanaka 2006), regeneration of thymus or TECs from pluripotent stem cells has also been attempted (Isotani et al., 2011; Lai and Jin, 2009; Parent et al., 2013; Sun et al., 2013). Very recently, genetic modification has enabled fibroblasts to reprogram directly into TECs (Bredenkamp et al., 2014). Although several studies have previously induced TECs from pluripotent stem cells, the optimal condition for TEC induction has not been reported yet.

Previously, we reported the induction of phenotypically TEC-like cells from pluripotent stem cells by two-dimensional (2-D) culture. However, the functionality of these cells has not yet been proven (Inami et al., 2011). Because we thought that spatiotemporal cell–cell interaction was essential to inducing both mTECs and cTECs, we thought that three-dimensional (3-D) spheroid culture system might induce functional TECs. 3-D culture systems are thought to be a more optimal condition for cell differentiation and organ regeneration (Bokhari et al., 2007; Kyba et al., 2002; Saito et al., 2011; Suga et al., 2011), but induction of functional TECs by 3-D culture for organ regeneration has not been reported. In this study, we investigated the induction of TECs from iPSCs by a 3-D spheroid culture system.

Materials and Methods

Mice

Six- to 8-week-old BALB/c, KSN nude, and C57BL/6 mice were purchased from Japan SLC (Shizuoka, Japan). These mice were maintained in the Animal Research Facility at the Nagoya University Graduate School of Medicine under specific pathogen-free conditions and used for these experiments according to institutional guidelines. This study was carried out in strict accordance with the recommendations of the Regulations on Animal Experimentation at Nagoya University. The Animal Care and Use Committee of Nagoya University Graduate School of Medicine approved the protocol.

Cell culture and cell differentiation of iPSCs

Generation of mouse embryonic fibroblast-derived iPSCs (C57BL/6) was as previously described by Cheng et al. (2011). For TEC induction, the culture conditions used were according to our previous method (Inami et al., 2011) and were modified to 3-D spheroid conditions. Ten thousand iPSCs were seeded onto 96-well low-cell-adhesion plates (Lipidure Coat, NOF Corp., Japan) in SF-O3 culture medium (Sanko Junyaku, Tokyo, Japan) supplemented with 0.2% bovine serum albumin (BSA), 5% fetal bovine serum (FBS), and 0.1 mM 2-mercaptoethanol with the addition of the following materials. From days 1 to 4, these cultures were supplemented with 10 ng/mL Activin A (R&D systems, Minneapolis, MN, USA) and 5 mM LiCl (Sigma-Aldrich). At day 4, the culture supernatant was replaced with fibroblast growth factor 8 (FGF8; R&D Systems) and LiCl. At day 8, the culture supernatant was replaced with FGF7, FGF10 (R&D Systems), Bone Morphogeneic Protein (BMP4) (R&D Systems), and LiCl. At day 12, the medium was changed to the day 8 conditions supplemented with 20 ng/mL receptor activator of nuclear factor kappa-B ligand (RANKL), and cells were cultured in the medium for 4 days.

Flow cytometric analyses

Cultured cells were trypsinized by 0.05% trypsin–EDTA (Gibco) and harvested. The single-cell suspensions were incubated with BV605-conjugated anti-CD326 (EpCAM1; BD Biosciences, San Jose, CA, USA) and purified anti-SSEA1 (Millipore) antibodies. Cells were then incubated with phycoerythrin (PE)-conjugated anti-mouse immunoglobulin M (IgM) antibody. For double negative (DN) cells and TEC purification, thymus tissue was minced and incubated with collagenase for 30 min at 37°C. Cells were stained with fluorescein isothiocyanate (FITC)-conjugated anti-CD4, PE-conjugated anti-CD8, allophycocyanin (APC)-conjugated anti-CD45, and BV605-conjugated anti-CD326 (EpCAM1). To analyze recipient-mouse peripheral blood cells, the erythrocytes were lysed, and the remaining cells were stained with FITC-conjugated anti-B220, PE-conjugated anti-CD4, and APC-conjugated anti-CD8 antibodies. Biotinylated antibodies were detected with streptavidin–APC–Cy7. Analysis and cell sorting were performed on a FACSCantoII or FACSAriaII (Becton Dickinson, Japan) and analyzed using FlowJo software (Tree Star, Ashland, OR, USA).

Subrenal capsule transplantation

Purified EpCAM1⁺SSEA1⁻ cells derived from iPSCs (100,000) were cultured and reaggregated with or without CD4⁻CD8⁻CD45⁺ DN thymocytes (100,000) from BALB/c mice on Lipidure plates for 24 h. The reaggregates were grafted under the subrenal capsule of nude mice. Aggregations of DN cells from neonatal thymus of BALB/c or iPSC-derived TECs were used as a control. The peripheral blood of recipient mice was assessed after 6 weeks of transplantation.

Skin grafting

Skin graft analysis was performed as previously described (Oikawa et al., 2007). In brief, tail skins of C57BL/6 and C3H were cut into small pieces and placed on the shaved back of recipients. The grafts were protected by wrapping with a bandage, and rejection was assessed every 2 days after day 6 of the skin graft.

Hematoxylin & Eosin staining and immunostaining

Histological analysis was performed as previously described (Inami et al., 2011; Ito et al., 2013). In brief, the sections were fixed with 4% paraformaldehyde and stained with Hematoxylin & Eosin (H&E). For immunohistochemistry, the sections were fixed with 4% paraformaldehyde. Blocking was done in PBS containing 2% BSA for 1 h, followed by incubation with the primary antibody rabbit anti-cytokeratin5. Alexa Fluor 488–conjugated goat anti-rabbit IgG was used as a secondary antibody. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI).

RT-PCR

Total RNA was isolated using TRIzol reagent (Invitrogen). First-strand cDNA was synthesized using the Superscript First-Strand Synthesis System (Invitrogen) for RT-PCR and oligo d(T)12–18 primers. The cDNA was diluted with DNase-free water to a concentration of 10 ng/mL. RT-PCR was performed using the Ex-Taq PCR kit (TaKaRa) according to the manufacturer's instructions.

Results

Induction of TEC-like cells from iPSCs by 3-D spheroid culture system

Since we previously reported the induction of TEC-like cells from iPSCs in 2-D culture (Inami et al., 2011), we attempted to induce TECs from iPSCs by using low-attachment 96-well plates for 3-D culture (Fig. 1A) (Suga et al., 2011; Wataya et al., 2008). In this study, we used C57BL/6-derived iPSCs (H-2^b) (Cheng et al., 2011). When the 10,000 iPSCs were seeded onto low-attachment U-bottomed 96-well plates, cell aggregates were formed after 4 days of induction and became large spheroids at day 8. After 16 days of induction, a 3-D capsule-like structure was formed (3-D spheroid) (Fig. 1B). When we examined TEC marker genes in the 3-D spheroid, we could detect the expression of TEC marker genes, such as AIRE, DLL1, K5, or K8 at several time points. Furthermore, the expression of FoxN1, a key marker gene for TEC differentiation, was distinctly detected. However, we could still detect the expression of Nanog, an indicator of pluripotency, which might be the result of contamination with undifferentiated iPSC cells (Fig. 2A).

FIG. 1.

Induction of TECs from iPSCs by 3-D culture system. (A) A schematic representation of TECs induction from iPSCs by 3-D culture. Ten thousand iPSCs were harvested and seeded onto low-attachment, U-bottomed 96-well plates. Combinations of cytokine cocktails were changed on days 4, 8, and 12. (B) Representative microscopic images of the spheroids induced from iPSCs at 4–16 days postinduction. Note that we could detect the spheroids in the culture (40× at day 4 and 10× at day 8 and day 16).

FIG. 2.

Induction of TECs from iPSCs by a 3-D culture system. (A) RT-PCR analysis using specific primer sets to examine expression of the TEC marker. Distilled water (DW), no template control; TTF (tail tip fibroblast), negative control for TEC marker; Thymus, positive control for TEC marker. (B) Periodical analysis of frequency of EpCAM1⁺SSEA1⁻ cells. Cells were gated from 20,000 PI-negative live cells. Numbers along the horizontal axis show days after induction (7, 10, and 13 days). (C) Immunofluorescence analysis of the expression of K5 (left panel) on day 14 of spheroids that induced in a 5% FBS-containing condition A. Nuclei were stained with DAPI. Bar, 100 μm. (D) RT-PCR analysis using specific primer sets to examine expression of the TEC marker. EpCAM1⁺SSEA1⁻ cells, sample that purified from day 10 of 5% FBS-containing condition A; distilled water (DW), no template control; TTF (tail tip fibroblast), negative control for TEC marker; Thymus, positive control for TEC marker.

To examine the contamination with undifferentiated iPSCs in spheroids, we performed flow cytometry analysis. Although a previous study showed that EpCAM1 could be used as a TEC marker (Rossi et al., 2006), we found that EpCAM1 was also expressed in pluripotent stem cells (data not shown). Therefore, we added the marker SSEA1⁺ to EpCAM1⁺ spheroids to exclude iPSC contamination. When the frequency of EpCAM1⁺SSEA1⁻ cells was assessed on days 7, 10, and 13 of TEC induction by flow cytometry with or without FBS, we found that the day-10 spheroids with 5% FBS yielded the largest number of EpCAM1⁺SSEA1⁻ cells (∼17% of culture cells) (Fig. 2B). Furthermore, 3-D spheroid cultures with 5% FBS highly expressed K5 (Fig. 2C).

Purification of TEC-like cells from the 3-D spheroid induction culture

We then decided to enrich TEC-like cells from spheroids. We purified EpCAM1⁺SSEA1⁻ cells on day 10 of induction with 5% FBS. As we expected, EpCAM1⁺SSEA1⁻ cells expressed FoxN1 preferentially at a comparable level to wild-type thymus cells, whereas EpCAM1⁺SSEA1⁻ cells did not express Nanog. We could also detect the expression of DLL4, a key molecule for T cell development that expresses on TECs (Fig. 2D). These results showed that iPSCs were differentiated into TECs using the 3-D spheroid culture system. As we have previously demonstrated in a 2-D culture system, we found that stepwise differentiation of TECs via definitive endoderm and anterior foregut endoderm was also necessary in 3-D spheroid culture by stimulating pluripotent stem cells consecutively with Activin A, FGF8, BMP4, FGF7, and FGF10 (Figs. 1 and 2).

Transplantation of iPSC-derived TECs enhances T cell development in nude mice

To analyze the functionality of iPSC-derived TECs in vivo, 100,000 purified EpCAM1⁺SSEA1⁻ cells were reaggregated for 24 h in low-attachment 96-well plates with equivalent number of CD4⁻CD8⁻CD45⁺ DN thymocytes derived from the neonatal thymus of BALB/c mice and transplanted into subrenal capsule of nude mice (Fig. 3) (Anderson et al., 1993). Six weeks after transplantation, the peripheral blood of the recipient mice was analyzed to assess whether iPSC-derived TECs could contribute to T cell development. CD8⁺ T cells were detected in the peripheral blood of recipient mice, which were transplanted with iPSC-derived TECs mixed with DNs, but not with TECs alone or DNs alone (Fig. 4A, B).

FIG. 3.

Schematic diagram for assessment of iPSC-derived TECs. One hundred thousand EpCAM1⁺SSEA1⁻ iPSC-derived TECs were purified and reaggregated with 100,000 CD4⁻CD8⁻CD45⁺ DN cells derived from BALB/c mice in low-attachment, U-bottomed 96-well plates overnight. One day after reaggregation, cells were transplanted into the subrenal capsule of nude mice. Reaggregations of EpCAM1⁺SSEA1⁻ iPSC-derived TECs (TEC only) or CD4⁻CD8⁻CD45⁺ DN cells (DN only) were used as a control.

FIG. 4.

Analysis of T cell reconstitution after transplantation of iPSC-derived TECs. (A) Representative flow cytometric profiles of peripheral blood mononuclear cells obtained from recipient mice after 6 weeks of transplantation. Dot plots display expression of CD45 and B220 (upper panel) and CD4 and CD8 (lower panel). (B) The percentage of lymphocytes (CD45⁺B220⁺, CD45⁺CD8⁺, or CD45⁺CD8⁺) obtained from recipient mice was analyzed at 6 weeks after transplantation (n = 3–5). Nude mice and wild BALB/c mice were used as a control. Values are shown as the mean ± standard error of the mean (SEM).

When the kidneys of the recipient mice were assessed histologically, the thymus-like structure was detected from recipient mice that were transplanted with iPSC-derived TECs mixed with DNs. No thymus-like structure was detected from the recipient mice, which were transplanted with DNs only (Fig. 5A). Interestingly, we detected all four T cell populations, such as CD4⁻CD8⁻, CD4⁺CD8⁺, CD4⁻CD8⁺, and CD4⁺CD8⁻, in thymus-like structures in kidney grafts transplanted with iPSC-derived TECs mixed with DNs. Additionally, we found that CD4⁺ T cells were higher than CD8⁺ T cells in this kidney transplant, resembling the normal thymus (Fig. 5B). These results indicate that iPSC-derived TECs have ability of supporting differentiation of both single CD4⁺ cells and CD8⁺ cells, but migration of CD4⁺ T cells to blood vessels was impaired for unknown reasons. To elucidate this question with further analysis, such as optimization for induction of thymic microenvironment, assessment of precise functionality of iPSC-derived TECs, and long-term observation after transplantation, are needed.

FIG. 5.

Functional analysis of reconstituted T cells in nude mice. (A) Representative microscopic images of the kidneys of recipient mice transplanted with iPSC-derived TECs, DN thymocytes, or both iPSC-derived TECs and DN thymocytes after 10 weeks of transplantation. Tissues were stained with H&E staining. Bar, 100 μm. (B) Representative flow cytometric profiles of aggregates transplanted in subrenal capsule of nude mice after 10 weeks of transplantation. Dot plots display expression of CD4 and CD8. Thymus from wild-type BALB/c mice was used as a positive control. (C) Skin graft rejection of nude mice that were transplanted with iPSC-derived TECs. Tail skins of C57BL/6 (syngeneic to iPSC-derived TEC; left) and C3H (third party; right) mice were grafted on the backs of these mice. Rejection time was determined as the day when the grafted tissue completely came off (n = 3 each).

T cells developed by iPSC-derived TECs were immunologically functional

Finally, we examined the immune responses of recipient mice to allogeneic skin grafts. Because allogeneic thymic grafts can induce immune tolerance to allogeneic major histocompatibility complexs (MHCs), we used the tail skin of C57BL/6 mice (H-2^b), which is syngeneic to iPSCs, to assess whether T cells developed within iPSC-derived TECs are immunologically tolerant to H-2^b, and we used that of C3H mice (H-2^k) for assessment of rejection response to third party against nude mice (H-2^d). The recipient mice showed the rejection of allogeneic C3H skin grafts within 2 weeks after transplantation, whereas grafts of C57BL/6 were not rejected, suggesting that iPSC-derived TECs induce immune tolerance to donor MHCs but not to a third party (Fig. 5C). These results indicate that our 3-D spheroid culture system can induce TECs from iPSCs that are able to develop functional T cells in nude mice.

Discussion

Although several studies succeeded in inducing TECs by 2-D culture (Hidaka et al., 2010; Lai and Jin, 2009; Parent et al., 2013; Sun et al., 2013), there are no reports to succeed in functional TEC induction from iPSCs using a 3-D culture system. Here, we reported the induction of TECs from iPSCs using a 3-D spheroid culture system, which induces development of functional T cells in allogeneic nude mice. We assessed: (1) Expression of FoxN1; (2) T cell development; and (3) functionality of T cells in recipient mice. Because the 2-D culture system can stimulate cultured cells homogeneously, it may be not sufficient to induce functional tissue, which is composed of several kinds of cells. Our culture system showed the robust expression of FoxN1 at day 10 of induction after differentiation of iPSCs; thus, we suggest that spatiotemporal cell–cell interaction in the 3-D spheroid culture may mimic the stepwise embryonic development of thymus and enhance induction of functional TECs by stimulation with activin A, BMP4, FGF8, FGF7, and FGF10. Several reports also performed the enrichment of differentiated cells from iPSC-derived spheroids for use as a disease therapeutic model (Hidaka et al., 2010; Kyba et al., 2002; Matsumoto et al., 2009), suggesting purification of target cells can be used for one of the strategic technologies to remove contamination of unexpected factors for regenerative therapy.

Table 1.

Primers Used for RT-PCR

Gene	Primer 5′ → 3′
FoxN1	cttcccaaagccatct
	gcacttgttgagggacaggt
AIRE	caactctggcctcaaagagc
	cctgactcaaacacctgctg
GAPDH	aactttggcattgtggaagg
	acacattgggggtaggaaca
K5	cctgactcaaacacctgctg
	aactcattctcagccgtggt
K8	atcgagatcaccacctaccg
	tgaagccagggctagtgagt
DLL1	ccggctgaagctacagaaac
	taagtgttggggcgatcttc
DLL4	tcagccaaatcatcatccaa
	gtgggggatacattcattgc
Nanog	caggagtttgagggtagctc
	cggttcatcatggtacagtc

In addition, we could detect the both CD4⁺ and CD8⁺ T cells in the kidney graft of iPSC-derived TECs recipient mice. The reason for the lower number of CD4⁺ T cells in the peripheral blood of the recipient mice remains unknown. We speculate that the reaggregates of iPSC-derived TECs was partially functional to support T cell recruitment into peripheral blood. To answer this question, precise analysis of the architecture and cell population distributing the reaggregation is essential. However, it is important that the T cells differentiated by iPSC-derived TECs could reject allogeneic skin grafts with acquiring immune tolerance to donor MHC, indicating that these T cells are functional. This may enhance the future clinical applications of pluripotent stem cells to acquire cell-mediated immunity in patients with both primary and secondary immunodeficiencies. Further analysis is needed to confirm normal T cell functionality and development by assessing the T cell receptor (TCR) rearrangement, cytokine production, and differentiation of other T cell subsets.

Footnotes

Acknowledgments

We thank M. Tanaka and I. Mizuguchi for technical support, N. Oiwa for administrative assistance, and M.A. Malek for critical review of the manuscript. This work was supported by Micro-Nano GCOE program provided by the Ministry of Education, Science, Technology, Sports and Culture, Japan.

Author Disclosure Statement

The authors declare that they have no competing interests.

References

Anderson

, Jenkinson

E.J.

, Moore

N.C.

, and Owen

J.J.

(1993). MHC class II-positive epithelium and mesenchyme cells are both required for T-cell development in the thymus. Nature, 362, 70–73.

Blackburn

C.C.

, Augustine

C.L.

, Li

, Harvey

R.P.

, Malin

M.A.

, Boyd

R.L.

, Miller

J.F.

, and Morahan

(1996). The nu gene acts cell-autonomously and is required for differentiation of thymic epithelial progenitors. Proc. Natl. Acad. Sci. USA, 93, 5742–5746.

Bokhari

, Carnachan

R.J.

, Cameron

N.R.

, and Przyborski

S.A.

(2007). Culture of HepG2 liver cells on three dimensional polystyrene scaffolds enhances cell structure and function during toxicological challenge. J. Anat., 211, 567–576.

Bredenkamp

, Ulyanchenko

, O'Neill

K.E.

, Manley

N.R.

, Vaidya

H.J.

, and Blackburn

C.C.

(2014). An organized and functional thymus generated from FOXN1-reprogrammed fibroblasts. Nat. Cell Biol., 16, 902–908.

Cheng

, Ito

, Nishio

, Xiao

, Zhang

, Suzuki

, Okawa

, Murohara

, and Isobe

(2011). Establishment of induced pluripotent stem cells from aged mice using bone marrow-derived myeloid cells. J. Mol. Cell. Biol., 3, 91–98.

Hanna

, Wernig

, Markoulaki

, Sun

C.W.

, Meissner

, Cassady

J.P.

, Beard

, Brambrink

, Wu

L.C.

, Townes

T.M.

, and Jaenisch

(2007). Treatment of sickle cell anemia mouse model with iPS cells generated from autologous skin. Science, 318, 1920–1923.

Hidaka

, Nitta

, Sugawa

, Shirai

, Schwartz

R.J.

, Amagai

, Nitta

, Takahama

, and Morisaki

(2010). Differentiation of pharyngeal endoderm from mouse embryonic stem cell. Stem Cells Dev., 19, 1735–1743.

Holub

, Rossmann

, Tlaskalova

, and Vidmarova

(1975). Thymus rudiment of the athymic nude mouse. Nature, 256, 491–493.

Hong

, Schulte-Wissermann

, Jarrett-Toth

, Horowitz

S.D.

, and Manning

D.D.

(1979). Transplantation of cultured thymic fragments. II. Results in nude mice. J. Exp. Med., 149, 398–415.

10.

Inami

, Yoshikai

, Ito

, Nishio

, Suzuki

, Sakurai

, and Isobe

(2011). Differentiation of induced pluripotent stem cells to thymic epithelial cells by phenotype. Immunol. Cell Biol., 89, 314–321.

11.

Isotani

, Hatayama

, Kaseda

, Ikawa

, and Okabe

(2011). Formation of a thymus from rat ES cells in xenogeneic nude mouse←→rat ES chimeras. Genes Cells, 16, 397–405.

12.

Ito

, Tanaka

, Nishio

, Thanasegaran

, and Isobe

(2013). Establishment of self-renewable GM-CSF-dependent immature macrophages in vitro from murine bone marrow. PLoS One, 8, e76943.

13.

Jiang

, Jing

, Cost

G.J.

, Chiang

J.C.

, Kolpa

H.J.

, Cotton

A.M.

, Carone

D.M.

, Carone

B.R.

, Shivak

D.A.

, Guschin

D.Y.

, Pearl

J.R.

, Rebar

E.J.

, Byron

, Gregory

P.D.

, Brown

C.J.

, Urnov

F.D.

, Hall

L.L.

, and Lawrence

J.B.

(2013). Translating dosage compensation to trisomy 21. Nature, 500, 296–300.

14.

Kyba

, Perlingeiro

R.C.

, and Daley

G.Q.

(2002). HoxB4 confers definitive lymphoid-myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors. Cell, 109, 29–37.

15.

Lai

, and Jin

(2009). Generation of thymic epithelial cell progenitors by mouse embryonic stem cells. Stem Cells, 27, 3012–3020.

16.

Manley

N.R.

, Richie

E.R.

, Blackburn

C.C.

, Condie

B.G.

, and Sage

(2011). Structure and function of the thymic microenvironment. Front. Biosci., 16, 2461–2477.

17.

Markert

M.L.

, Boeck

, Hale

L.P.

, Kloster

A.L.

, McLaughlin

T.M.

, Batchvarova

M.N.

, Douek

D.C.

, Koup

R.A.

, Kostyu

D.D.

, Ward

F.E.

, Rice

H.E.

, Mahaffey

S.M.

, Schiff

S.E.

, Buckley

R.H.

, and Haynes

B.F.

(1999). Transplantation of thymus tissue in complete DiGeorge syndrome. N. Engl. J. Med., 341, 1180–1189.

18.

Markert

M.L.

, Sarzotti

, Ozaki

D.A.

, Sempowski

G.D.

, Rhein

M.E.

, Hale

L.P.

, Le Deist

, Alexieff

M.J.

, Li

, Hauser

E.R.

, Haynes

B.F.

, Rice

H.E.

, Skinner

M.A.

, Mahaffey

S.M.

, Jaggers

, Stein

L.D.

, and Mill

M.R.

(2003). Thymus transplantation in complete DiGeorge syndrome: Immunologic and safety evaluations in 12 patients. Blood, 102, 1121–1130.

19.

Matsumoto

, Isagawa

, Nishimura

, Ogaeri

, Eto

, Miyazaki

, Aburatani

, Nakauchi

, and Ema

(2009). Stepwise development of hematopoietic stem cells from embryonic stem cells. PLoS One, 4, e4820.

20.

Miller

J.F.

(1961). Immunological function of the thymus. Lancet, 2, 748–749.

21.

Nehls

, Kyewski

, Messerle

, Waldschutz

, Schuddekopf

, Smith

A.J.

, and Boehm

(1996). Two genetically separable steps in the differentiation of thymic epithelium. Science, 272, 886–889.

22.

Oikawa

, Ito

, Seguchi

, Okabe

, Migishima

, Eshima

, Azuma

, Song

S.Y.

, Kaneko

, and Shinohara

(2007). Development of immunocompetent lymphocytes in vivo from murine umbilical cord blood cells. Transplantation, 84, 23–30.

23.

Parent

A.V.

, Russ

H.A.

, Khan

I.S.

, LaFlam

T.N.

, Metzger

T.C.

, Anderson

M.S.

, and Hebrok

(2013). Generation of functional thymic epithelium from human embryonic stem cells that supports host T cell development. Cell Stem Cell, 13, 219–229.

24.

Rossi

S.W.

, Jenkinson

W.E.

, Anderson

, and Jenkinson

E.J.

(2006). Clonal analysis reveals a common progenitor for thymic cortical and medullary epithelium. Nature, 441, 988–991.

25.

Saito

, Takeuchi

, Chida

, and Miyajima

(2011). Generation of glucose-responsive functional islets with a three-dimensional structure from mouse fetal pancreatic cells and iPS cells in vitro. PLoS One, 6, e28209.

26.

Suga

, Kadoshima

, Minaguchi

, Ohgushi

, Soen

, Nakano

, Takata

, Wataya

, Muguruma

, Miyoshi

, Yonemura

, Oiso

, and Sasai

(2011). Self-formation of functional adenohypophysis in three-dimensional culture. Nature, 480, 57–62.

27.

Sun

, Xu

, Lu

, Liu

, Miao

, Sui

, Liu

, Su

, Du

, He

, Chen

, Shi

, and Deng

(2013). Directed differentiation of human embryonic stem cells into thymic epithelial progenitor-like cells reconstitutes the thymic microenvironment in vivo. Cell Stem Cell, 13, 230–236.

28.

Suzuki

, Yamazaki

, Yamaguchi

, Okabe

, Masaki

, Takaki

, Otsu

, and Nakauchi

(2013). Generation of engraftable hematopoietic stem cells from induced pluripotent stem cells by way of teratoma formation. Mol. Ther., 21, 1424–1431.

29.

Takahashi

, and Yamanaka

(2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126, 663–676.

30.

van den Brink

M.R.

, Alpdogan

, and Boyd

R.L.

(2004). Strategies to enhance T-cell reconstitution in immunocompromised patients. Nat. Rev. Immunol., 4, 856–867.

31.

Wataya

, Ando

, Muguruma

, Ikeda

, Watanabe

, Eiraku

, Kawada

, Takahashi

, Hashimoto

, and Sasai

(2008). Minimization of exogenous signals in ES cell culture induces rostral hypothalamic differentiation. Proc. Natl. Acad. Sci. USA, 105, 11796–11801.