Effects of Trichostatin A and PXD101 on the In Vitro Development of Mouse Somatic Cell Nuclear Transfer Embryos

Abstract

The low success rate of animal cloning by somatic cell nuclear transfer (SCNT) is believed to be associated with aberrant epigenetic nuclear reprogramming. It has been demonstrated that treatment with histone deacetylase inhibitors (HDACis) enhances developmental potential of SCNT embryos. Previous studies in many species revealed that treatment of SCNT embryos with trichostatin A (TSA)—an HDACi—significantly enhances the in vitro development of SCNT embryos. In this study, we compared two different SCNT protocols with TSA and investigate, for the first time, the effect of another new HDACi, PXD101 (belinostat), on in vitro development of mouse SCNT embryo. Rates of blastocyst development in mouse SCNT embryos treated with either 5 nM TSA during (6 hours) and after (4 hours) activation (39.1%) or with 50 nM PXD101 during (6 hours) and after (4 hours) activation (40.2%) were significantly higher than those of nontreated SCNT embryos (11.5%) and both treatments also significantly improved the subsequent establishment of NT-ESCs in comparison with the nontreated group (38.1% and 40.9% vs. 11.8%). In conclusion, we optimized the TSA concentration and treatment timing and, for the first time, investigated the effect of PXD101 on mouse development of SCNT embryos and establishment of NT-ESCs.

Highlights

• The trichostatin A (TSA) concentration and treatment timing were optimized for improvement of the development of mouse somatic cell nuclear transfer (SCNT) embryos.

• The effect of PXD101 on mouse development of SCNT embryos was investigated for the first time.

• Five nanomolars TSA treated for 10 hours after activation and 50 nM PXD101 treated for 10 hours after activation could most effectively improve the in vitro developmental capacity of mouse SCNT embryos and establishment of NT-ESCs.

Introduction

Animal cloning using somatic cell nuclear transfer (SCNT) is a powerful technique to preserve a unique diploid genome and has achieved great progress. However, the application of SCNT is limited due to its low efficiency and high incidence of developmental abnormalities in SCNT embryos, especially in mice (Cibelli et al., 2002; Kishigami et al., 2008; Solter, 2000; Yang et al., 2007); for most mammalian species, only 1% to 5% of cloned blastocysts survive to birth (Wilmut and Paterson, 2002). The low efficiency of SCNT is assumed to be due to incomplete or aberrant epigenetic reprogramming of SCNT embryos (Latham, 2005; Yang et al., 2007).

The normal epigenetic regulations play a crucial function in normal embryo development during preimplantation (Marcho et al., 2015). Successful mammalian development requires the differentiation of single-cell zygotes into diverse cell types even though they contain the same genetic material. The reprogramming haploid parental epigenomes to reach a totipotent state play a vital role in successful preimplantation development. This process requires extensive erasure of epigenetic marks shortly after fertilization. During the few short days after formation of the zygote, epigenetic programs (e.g., DNA demethylation, histone acetylation) are established and are essential for the first lineage decisions and differentiation. It has been suggested that epigenetic modification, including DNA demethylation, histone acetylation, and chromatin organization, plays a critical role in establishment of a totipotent embryo as well as directing the first lineage decisions (Marcho et al., 2015).

However, abnormal epigenetic modifications, such as DNA methylation and histone deacetylation, occur in SCNT embryos during early development, resulting in low efficiency of SCNT (Dean et al., 2001; Inoue et al., 2002; Kang et al., 2001; Ohgane et al., 2004; Santos et al., 2003; Wang et al., 2007; Wee et al., 2006; Xu et al., 2012). Therefore, the prevention of such epigenetic errors or improvement of epigenetic reprogramming should improve the efficiency of SCNT and developmental potential of SCNT embryos. The histone deacetylase inhibitor (HDACi) trichostatin A (TSA) has been widely reported to improve epigenetic reprogramming of SCNT embryos in mice (Costa-Borges et al., 2010; Kishigami et al., 2006, 2007; Ono et al., 2010; Rybouchkin et al., 2006), pigs (Beebe et al., 2009; Cong et al., 2013; Li et al., 2008; Luo et al., 2015), cattle (Ding et al., 2008; Luo et al., 2013; Zhang et al., 2014), sheep (Hu et al., 2012; Wen et al., 2014; Yao et al., 2012), and rabbits (Meng et al., 2009; Shi et al., 2008). TSA regulates the epigenetic reprogramming of SCNT embryos by regulating acetylation of lysine residues in positively charged histone tails of nucleosomes (Kishigami et al., 2007).

Despite the obvious improvement of TSA on mouse cloning efficiency, different groups have used slightly different protocols. In particular, Kishigami et al. (2006) first reported an improved cloning efficiency of mouse SCNT embryos treated with 5 or 50 or 500 nM TSA during (6 hours) and after (4 hours) oocyte activation. Although Rybouchkin et al. (2006) obtained a similar result with a different protocol using 100 nM TSA treated before (2 hours) and during (6 hours) oocyte activation and Costa-Borges et al. (2010) found no significant difference using these two protocols, the optimal concentration and timing of the TSA treatment by using the 12 combinations of four different concentrations (5/50/100/500 nM) and three timings of TSA treatment [before (2 hours) and during (6 hours), or during (6 hours) and after (4 hours), or before (2 hours) and during (6 hours) and after (4 hours) of oocyte activation] are not yet clear.

Thus, in the present study, it was necessary to optimize the concentration and timing of the TSA treatment on one hand, and on the other hand, recently, Jin et al. (2015) found that a novel HDACi PXD101 [belinostat, N-hydroxy-3-(phenylsulfamoylphenyl) acryl amide] significantly improved nuclear reprogramming and in vitro developmental competence of porcine SCNT embryos. PXD101, like other hydroxamic acid analogs, is a low-molecular-weight HDACi that inhibits class I and II histone deacetylases and induces the acetylation of histones H3 and H4 in a concentration-dependent manner (Feng et al., 2007; Jin et al., 2015; Plumb et al., 2003). However, the effect of PXD101 on mouse SCNT embryos has not been studied yet. Therefore, in the present study, besides the optimization of the concentration and timing of the TSA treatment, we explored, for the first time, the effect of PXD101 on the in vitro development of SCNT mouse embryos and the effect of these two treatments (TSA and PXD101) on subsequent establishment of NT-ESCs.

Materials and Methods

Unless otherwise indicated, all reagents were purchased from Sigma (China).

Animals

Kunming female mice were used as oocytes and somatic cell (cumulus cell) donors. All animals were maintained in accordance with the Animal Experiment Handbook at the Center for Developmental Biology, and experiments were carried out in accordance with the UK Animals (Scientific Procedures) Act, 1986, and associated guidelines.

Collection of oocytes and cumulus cells

Mature oocytes were collected from the oviducts of females (8 to 12 weeks of age) that were induced to superovulate with 5 IU of pregnant mare serum gonadotropin, followed by 5 IU of human chorionic gonadotropin (hCG) 48 hours later. Oocytes were collected from oviducts 16 hours after hCG injection, placed in Hepes-buffered CZB medium (H-CZB), and treated with 0.1% hyaluronidase until the cumulus cells dispersed. The oocytes were transferred to fresh droplets of H-CZB and denuded of almost all cumulus cells by gentle pipetting. The denuded oocytes were then washed twice in H-CZB and then kept in K-modified simplex optimization medium (KSOM) containing nonessential amino acid and essential amino acid supplemented with 1 mg/mL bull serum albumin, covered with paraffin oil, and cultured at 37°C in an atmosphere of 5% CO₂ in air with 100% humidity until use.

Cumulus cells were removed from the hyaluronidase drops and placed in an Eppendorf tube with H-CZB medium to be washed by centrifugation at 250 g. The cumulus cell pellet was then resuspended in a small volume of 3% polyvinyl pyrrolidone in H-CZB and kept on ice until the moment of the nuclear injection.

Preparation of TSA and PXD101

The preparation and treatment of TSA and PXD101 were described previously (Jin et al., 2015; Kishigami et al., 2006). The final concentrations of both HDACis were prepared by dilution of the stock solutions in the culture or activation media, depending on the experimental procedure.

Production of cloned embryos by SCNT

The method for nuclear transfer referred to the previous description (Wakayama et al., 1998). Our self-made, beveled injection needle was used for easier operation. Enucleated oocytes were injected individually with a cumulus cell nucleus. The nuclear transfer operated as shown in Figure 1A–H. After nuclear transfer, the reconstructed oocytes were activated using 10 mM SrCl₂ in Ca²⁺-free CZB medium in the presence of 5 μg/mL cytochalasin B supplemented with TSA (5/50/100/500 nM) or PXD101 (5/50/100/500 nM) for different treatment times. Depending on the experimental procedure, different protocols for the two HDACis were detailed in following section.

FIG. 1.

NT operation and in vitro development of NT embryo. (A) Immature oocytes ( × 400); (B) mature MI oocytes ( × 400); (C) H33342 staining ( × 200); (D) injection needle ( × 400); (E) fixation needle ( × 400); (F, G) enucleation of oocyte ( × 400); (H) injection of the donor cumulus cell nucleus ( × 400); (I) two-cell embryo after NT ( × 200); (J) four-cell embryo after NT ( × 400); (K) morula after NT ( × 400); (L) blastocyst after NT ( × 400). NT, nuclear transfer.

After three washes in KSOM, cloned embryos were cultured in the same medium for development. Usually, one droplet (10–15 μL) contained about 20 embryos and was cultured in KSOM until the end of the experiment. At the end of the culture, embryos that reached the blastocyst stage at 96 hours were washed three times in phosphate-buffered saline (PBS) and placed onto slides in a drop of mounting medium [mixture of glycerol and PBS (9:1) containing 25 μg/mL of Hoechst 33342] (Jin et al., 2015). A coverslip was placed on top of the blastocysts, the edge was sealed with nail polish, and the number of nuclei was counted under ultraviolet light. The SCNT embryo from two-cell to blastocyst stage is shown in Figure 1I–L.

Experimental design

Investigation of the optimal concentration and timing of TSA treatment

To determine the optimal concentration and timing of the TSA treatment that most effectively improves the development, mouse SCNT embryos were treated with 12 combinations of four different concentrations (5/50/100/500 nM) and three timings of TSA treatment, and the developmental rates and cell number of the blastocyst of the various groups in vitro from the pronuclear to the blastocyst stage at 96 hours after oocyte activation were compared.

Different concentrations (5/50/100/500 nM) of TSA:

(a) Before (2 hours) and during (6 hours): after nuclear transfer and before oocyte activation, the reconstructed oocytes were put first in H-CZB medium supplemented with TSA (5/50/100/500 nM) for 2 hours, and then were activated using 10 mM SrCl₂ in Ca²⁺-free CZB medium in the presence of 5 μg/mL cytochalasin B supplemented with TSA (5/50/100/500 nM) for 6 hours;

(b) During (6 hours) and after (4 hours): after nuclear transfer, the reconstructed oocytes were activated using 10 mM SrCl₂ in Ca²⁺-free CZB medium in the presence of 5 μg/mL cytochalasin B supplemented with TSA (5/50/100/500 nM) for 6 hours, and then the embryos were moved to KSOM with TSA (5/50/100/500 nM) supplementation for another 4 hours after activation;

(c) Before (2 hours) and during (6 hours) and after (4 hours): after nuclear transfer and before oocyte activation, the reconstructed oocytes were put first in H-CZB medium supplemented with TSA (5/50/100/500 nM) for 2 hours, and then were activated using 10 mM SrCl₂ in Ca²⁺-free CZB medium in the presence of 5 μg/mL cytochalasin B supplemented with TSA (5/50/100/500 nM) for 6 hours, and then moved to KSOM with TSA (5/50/100/500 nM) supplementation for another 4 hours after activation.

Investigation of the effect of PXD101 on development of mouse SCNT embryos

To determine the concentration and treatment time of PXD101 that most effectively improve the development, mouse SCNT embryos were treated with various concentrations of PXD101 (5/50/100/500 nM) for four various timings [before (2 hours) and during (6 hours); during (6 hours) and after (4 hours); before (2 hours) and during (6 hours) and after (4 hours); and during (6 hours) and after (8 hours)], and the developmental rates and cell number of blastocysts of the various groups were compared.

Comparison of the effect of TSA and PXD101 on development of mouse SCNT embryos and on establishment of NT-ES cell lines

The optimal concentration and timing of TSA treatment were obtained [5 nM TSA treated during (6 hours) + after (4 hours)] and the optimal concentration and treatment time of PXD101 that most effectively improve development were obtained [50 nM PXD101 treated during (6 hours) + after (4 hours)], and the development of mouse SCNT embryos and establishment of NT-ESCs lines of the two groups treated by the two inhibitors (TSA and PXD101) with their obtained optimal protocols were compared.

Establishment of NT-ESCs lines

Cloned embryos were produced as described above and, when they reached the blastocyst stage, they were used to establish NT-ESCs, as previously described (Wakayama et al., 2001; Wang and Liu, 2007). When the inner cell masses were growing normally and had been passaged five to six times, they formed ESCs-like colonies, and we selected two at random to determine their pluripotency using real-time polymerase chain reaction (PCR) for pluripotency-related genes (POU5F1, NANOG, CDX2, REX01) and the relative expression levels of these genes were compared among TSA or PXD101-treated or -untreated (control) NT-ESCs groups.

Total RNA extraction, reverse transcription-polymerase chain reaction (RT-PCR), and real-time PCR

Total RNA was isolated from previously frozen (−80°C) NT-ESCs, using the easy-spin TM (DNA-free) Total RNA Extraction Kit according to the manufacturer's instructions, and immediately stored at −80°C until used for quantitative RT-PCR (qRT-PCR). cDNA was produced from 1 μg of total RNA from NT-ESC samples using the Omniscript RT Kit (Qiagen, Hilden, Germany).

Individual RT reactions contained 2 μL dNTP mix, 2 μL of 10 μM Oligo-dT primer, 1 μL of 10 U/μL RNase inhibitor, 2 μL RT buffer, and 1 μL Omniscript reverse transcriptase and were adjusted to a total volume of 20 μL using RNase-free water. cDNA synthesis was performed by incubation at 37°C for 60 minutes and inactivation of the enzyme at 95°C for 10 minutes. qRT-PCR was performed using LightCycler 2.0 (Roche, Germany). PCR products for four genes (POU5F1, NANOG, CDX2, REX-1) were detected in three replicates by SYBR Green probes, and each reaction consisted of 2 μL of cDNA, 2 μL of SYBR Green I Master Mix (Toyobo, Japan), and 2 μL each of the forward and reverse primers and was adjusted to a total volume of 20 μL using distilled water.

The amplification conditions consisted of initial preincubation (95°C for 30 seconds) for Hot Start DNA polymerase activity, followed by 45 amplification cycles at 95°C for 5 seconds, 60°C for 20 seconds, and 72°C for 20 seconds. The fluorescence values were collected after each elongation step to determine the threshold cycle and the cycle during the log-linear phase of the reaction at which fluorescence increased above background. At the end of the amplification cycle, a melting curve analysis was performed to determine the specificity of amplification. The melting protocol included holding at 60°C for 15 seconds and then heating from 60°C to 95°C. The fluorescence values were collected during the whole procedure with a temperature ramp rate at 20°C/min. Primer sequences and approximate sizes of amplified fragments of all transcripts (POU5F1, NANOG, CDX2, REX-1) are shown in Table 1.

Table 1.

Oligonucleotide Primers Used in qRT-PCR Amplification for Genes (POU5F1, CDX-2, NANOG, and REX-1)

Gene	Gene oligonucleotide sequences (5′- to 3′-)	Product (bp)	GenBank no.
POU5F1	F:TTTGGGAAGGTGTTCAGCCAAACG	198	NM_001113060
	R: TCGGTTCTCGATACTTGTCCGCTT
CDX-2	F: TGTGCGAGTGGATGCGGAAG	149	gij262070767
	R: CCGAATGGTGATGTAGCGACTG
NANOG	F: GTACCTCAGCCTCCAGCA	161	AJ877915
	R: CTGAGCCCTTCTGAATCAC
REX-1	F: TTTCTGAGTACGTGCCAGGCAA	201	TC206866
	R:CTCTGAGAAAGCATCTCTCCGTTC

Teratoma formation

TSA or PXD101-treated NT-ESCs were injected subcutaneously into 4-week-old immunodeficient nude mice to test for teratoma formation. The mouse embryonic fibroblast cells were injected as the control.

Statistical analyses

Each experiment was repeated three times. Data (%) were analyzed using the chi-square test. Numbers of nuclei were analyzed using an analysis of variance. Statistical analyses were performed using SPSS 16.0 software (SPSS, Inc., Chicago, IL). p values <0.05 were regarded as statistically significant.

Results

Effect of TSA treatment concentration and timing on the in vitro development of mouse SCNT embryo

Compared with the TSA-untreated group, except the concentration of 500 nM, the TSA with 5, 50, and 100 nM concentrations for all the three treatment timings significantly improved in vitro development of mouse SCNT embryo, including the blastocyst formation rate and the cell number per blastocyst (Table 2; p < 0.05).

Table 2.

Effect of Trichostatin A Treatment Concentration and Timing on In Vitro Development of Mouse Somatic Cell Nuclear Transfer Embryo (No. and Mean ± Standard Deviation Percentage)

Concentration of TSA (nM)	Timing of TSA ^*	No. with PN formation	No. (M ± SD%) two-cell embryos	No. (M ± SD%) blastocysts	Cell no. per blastocyst (M ± SD)
0	0	218	175 (80.2 ± 4.1)^a	25 (11.5 ± 1.1)^a	41 ± 13^a
5	Before (2 hours) + during (6 hours)	256	201 (78.5 ± 5.1)^a	54 (21.1 ± 2.4)^b	56 ± 14^bc
	During (6 hours) + after (4 hours)	238	188 (79.0 ± 4.7)^a	93 (39.1 ± 3.2)^c	60 ± 10^c
	Before (2 hours)+ during (6 hours) + after (4 hours)	289	226 (78.2 ± 6.3)^a	105 (36.3 ± 4.1)^c	56 ± 13^bc
50	Before (2 hours) + during (6 hours)	198	154 (77.8 ± 3.2)^a	40 (20.2 ± 2.2)^b	55 ± 15^bc
	During (6 hours) + after (4 hours)	254	202 (79.5 ± 6.0)^a	91 (35.8 ± 1.2)^c	56 ± 13^bc
	Before (2 hours)+ during (6 hours) + after (4 hours)	187	145 (77.5 ± 3.2)^a	60 (32.1 ± 3.2)^c	54 ± 9b^c
100	Before (2 hours) + during (6 hours)	287	223 (77.7 ± 4.8)^a	59 (20.6 ± 3.1)^b	53 ± 13^bc
	During (6 hours) + after (4 hours)	245	192 (78.4 ± 6.1)^a	83 (33.9 ± 2.6)^c	54 ± 11^bc
	Before (2 hours)+ during (6 hours) + after (4 hours)	317	240 (75.7 ± 5.0)^a	101 (31.9 ± 3.0)^c	55 ± 10^bc
500	Before (2 hours) + during (6 hours)	176	134 (76.1 ± 4.9)^a	25 (14.2 ± 1.7)^ab	47 ± 13^ab
	During (6 hours) + after (4 hours)	182	137 (75.3 ± 7.2)^a	30 (16.5 ± 0.9)^ab	48 ± 13^ab
	Before (2 hours)+ during (6 hours) + after (4 hours)	209	155 (74.2 ± 5.2)^a	33 (15.8 ± 1.2)^ab	47 ± 13^ab

Different lowercase superscripts in the same column indicate difference at p < 0.05.

Treatment time (h) before or during or after activation.

TSA, trichostatin A.

There was an effect of TSA concentration and timing on the rate of blastocyst formation. There was no significant difference between the treatment timing of during (6 hours) + after (4 hours) and before (2 hours)+ during (6 hours) + after (4 hours) for all the three concentrations (5, 50, and 100 nM) on the rate of blastocyst formation (5 nM: 39.1% vs. 36.3%; 50 nM: 35.8% vs. 32.1%; 100 nM: 33.9% vs. 31.9%; Table 2; p > 0.05), but they were all significantly higher than the treatment timing of before (2 hours) + during (6 hours) (Table 2; p < 0.05). Five nanomolars TSA with the treatment timing of during (6 hours) + after (4 hours) had the highest in vitro blastocyst formation rate of mouse SCNT embryo (39.1%; Table 2).

There was no effect of TSA concentration and timing on the cell number per blastocyst. TSA with 5, 50, and 100 nM concentrations for all the three treatment timings had the similar cell number per blastocyst (Table 2; p > 0.05), but they were significantly more than the TSA-untreated group (Table 2; p < 0.05). Five nanomolars TSA with the treatment timing of during (6 hours) + after (4 hours) had the highest cell number per blastocyst (60 ± 10; Table 2).

Effect of the concentration of PXD101 and timing on development of mouse SCNT embryos

Compared with the PXD101-untreated group, the PXD101 with all concentration groups (5 nM, 50, 100, and 500 nM) for all four treatment timings significantly improved in vitro development of mouse SCNT embryo, including the blastocyst formation rate and the cell number per blastocyst (Table 3; p < 0.05).

Table 3.

Effect of PXD101 Treatment Concentration and Timing on In Vitro Development of Mouse Somatic Cell Nuclear Transfer Embryo (No. and Mean ± Standard Deviation Percentage)

Concentration of PXD101 (nM)	Timing of PXD101 ^*	No. with PN formation	No. (M ± SD%) two-cell embryos	No. (M ± SD%) blastocysts	Cell no. per blastocyst (M ± SD)
0	0	302	249 (82.5 ± 5.1)^a	35 (11.6 ± 1.6)^a	38 ± 10^a
5	Before (2 hours) + during (6 hours)	198	159 (80.3 ± 6.2)^a	40 (20.2 ± 1.8)^b	51 ± 14^b
	During (6 hours) + after (4 hours)	208	165 (79.3 ± 4.2)^a	54 (26.0 ± 3.0)^b	56 ± 15^b
	Before (2 hours)+ during (6 hours) + after (4 hours)	237	183 (77.2 ± 5.3)^a	61 (25.7 ± 1.1)^b	58 ± 10^b
	During (6 hours) + after (8 hours)	191	147 (77.0 ± 3.5)^a	48 (25.1 ± 2.1)^b	50 ± 9^b
50	Before (2 hours) + during (6 hours)	295	235 (79.7 ± 5.1)^a	72 (24.4 ± 1.4)^b	55 ± 13^b
	during (6 hours) + after (4 hours)	301	247 (82.1 ± 8.2)^a	121 (40.2 ± 4.1)^c	59 ± 14^b
	Before (2 hours)+ during (6 hours) + after (4 hours)	217	168 (77.4 ± 3.9)^a	85 (39.2 ± 2.4)^c	55 ± 9^b
	During (6 hours) + after (8 hours)	267	202 (75.7 ± 6.0)^a	100 (37.5 ± 4.4)^c	58 ± 15^b
100	Before (2 hours) + during (6 hours)	227	178 (78.4 ± 7.1)^a	51 (22.5 ± 1.3)^b	54 ± 14^b
	During (6 hours) + after (4 hours)	205	165 (80.5 ± 6.8)^a	78 (38.0 ± 3.5)^c	55 ± 10^b
	Before (2 hours)+ during (6 hours) + after (4 hours)	187	143 (76.5 ± 8.2)^a	69 (36.9 ± 4.8)^c	53 ± 15^b
	During (6 hours) + after (8 hours)	200	151 (75.5 ± 6.1)^a	74 (37.0 ± 1.6)^c	51 ± 13^b
500	Before (2 hours) + during (6 hours)	185	142 (76.8 ± 3.7)^a	40 (21.6 ± 3.0)^b	55 ± 14^b
	During (6 hours) + after (4 hours)	272	213 (78.3 ± 5.6)^a	100 (36.8 ± 4.1)^c	50 ± 10^b
	Before (2 hours)+ during (6 hours) + after (4 hours)	293	219 (74.7 ± 4.5)^a	109 (37.2 ± 4.2)^c	57 ± 15^b
	During (6 hours) + after (8 hours)	238	179 (75.2 ± 6.1)^a	85 (35.7 ± 2.2)^c	53 ± 9^b

Different lowercase superscripts in the same column indicate difference at p < 0.05.

Treatment time (h) before or during or after activation.

There was an effect of PXD101 concentration and timing on the rate of blastocyst formation. There was no significant difference among the treatment timings of during (6 hours) + after (4 hours) and before (2 hours)+ during (6 hours) + after (4 hours) and during (6 hours) + after (8 hours) for the three concentrations (50, 100, and 500 nM) on the rate of blastocyst formation (Table 3; p > 0.05), but they were all significantly higher than the treatment timing of before (2 hours) + during (6 hours) (Table 3; p < 0.05), and there was no significant difference among the four treatment timings for 5 nM PXD101on the rate of blastocyst formation (Table 3; p > 0.05). Fifty nanomolars PXD101 with the treatment timing of during (6 hours) + after (4 hours) had the highest in vitro blastocyst formation rate of mouse SCNT embryo (40.2%; Table 3).

There was no effect of PXD101 concentration and timing on the cell number per blastocyst. PXD101 with 5, 50, 100, and 500 nM concentrations for all the four treatment timings had the similar cell number per blastocyst (Table 3; p > 0.05), but they were significantly more than the PXD101-untreated group (Table 3; p < 0.05). Fifty nanomolars PXD101 with the treatment timing of during (6 hours) + after (4 hours) had the highest cell number per blastocyst (60 ± 14; Table 3).

Effect of TSA and PXD101 on establishment of NT-ESCs lines

The two NT-ESCs colonies that we randomly selected had similar results, and the rates of establishing ntESCs from HDACi-treated (TSA or PXD101) cloned blastocysts were three to four times greater than from control clones (Table 4), which are comparable with our previous study for TSA (data not shown). qRT-PCR for pluripotency-related genes (POU5F1, NANOG, CDX2, REX01) showed that the relative expression levels of these genes were similar between TSA and PXD101-treated groups, but both significantly higher than the untreated (control) group (Fig. 2), suggesting that TSA and PXD101 had a similar effect on the increase of rates of establishing NT-ESCs (Fig. 2 and Table 4). Four weeks after injection of HDACi-treated ntESCs into 4-week-old immunodeficient nude mice, the teratoma (2 cm in size, similar for TSA or PXD101 treated) was formed, and no teratoma formed from mouse embryonic fibroblast cells (control), further demonstrating the pluripotency of the isolated NT-ESCs.

FIG. 2.

(A–D) Expression profiles of pluripotency-related genes (POU5F1, NANOG, CDX2, REX01) among TSA or PXD101-treated and untreated (control) NT-ESCs groups. Each bar represents the relative fold change between treated and untreated groups. Data shown in the figure are from three replicates and values are presented as mean ± SEM. Values with different superscripts (a, b) within groups are significantly different (p < 0.05). TSA, trichostatin A.

Table 4.

Establishment of NT-ESCs from Trichostatin A and PXD101-Treated Cloned Blastocysts (No. and Mean ± Standard Deviation Percentage)

Treatment of HDACi ^*	No. with PN formation	No. (M ± SD%) of blastocysts	No. (M ± SD%) of NT-ESCs established
0	137	17 (12.4 ± 1.1)^a	2 (11.8 ± 0.7)^a
5 nM TSA during (6 hours) + after (4 hours)	108	42 (38.9 ± 4.1)^b	16 (38.1 ± 2.2)^b
50 nM PXD101 during (6 hours) + after (4 hours)	111	44 (39.6 ± 3.5)^b	18 (40.9 ± 3.8)^b

Different lowercase superscripts in the same column indicate difference at p < 0.05.

Treatment time (h) during or after activation.

HDACi, histone deacetylase inhibitor.

Discussion

In the present study, rates of blastocyst development in SCNT embryos treated with 5, 50, and 100 nM TSA during and after activation (39.1%, 35.8%, and 33.9%, respectively) or before, during, and after activation (36.3%, 32.1%, and 31.9%, respectively) were significantly higher than those of nontreated SCNT embryos (11.5%), confirming the beneficial effects of TSA treatment on in vitro development of mouse SCNT embryos reported previously (Costa-Borges et al., 2010; Kishigami et al., 2006, 2007; Rybouchkin et al., 2006) and demonstrating, for the first time, the potential of PXD101 in in vitro development of mouse SCNT embryo, with an improved blastocyst development of 35.7%–40.2%, at a similar level as TSA.

The rates of blastocyst development obtained in the present study were similar to the rates of TSA treatment reported by Costa-Borges et al. (2010) (31.8% and 34.5%) and by Maalouf et al. (2009) (34.9%), but were lower than the studies by the group of Wakayama (Kishigami et al., 2006; Van Thuan et al., 2009). It is important to point out that the mouse strain used in our study is the Kunming mice, whereas the studies with higher rates by the group of Wakayama were performed with the B6D2F1 strain. It is known that there is an effect of mouse strain on the development of SCNT embryos and efficiency of the SCNT technique (Gao et al., 2003; Van Thuan et al., 2009). Kishigami et al. (2006) reported the rates of blastocyst development of 75% (from two-cell embryos) in B6D2F1mouse SCNT embryos treated with 5 nM TSA for 10 hours after activation. Besides, Rybouchkin et al. (2006) obtained 63% of blastocysts in B6D2F1mouse SCNT embryos treated with 100 nM TSA for 8 hours immediately after nuclear injection and during activation.

These rates of in vitro blastocyst development of SCNT embryos are higher than those obtained in the present study with either TSA (31.9%–39.1%) or PXD101 (35.7%–40.2%). The B6D2F1 strain has been widely used in cloning experiments, but the use of Kunming mice has been much more limited and, therefore, fewer results on this strain are available. This study, for the first time, investigates the development of SCNT embryos in Kunming mice, making a contribution of the extra knowledge about the effect of mouse strain on the development of SCNT embryos and efficiency of the SCNT technique.

In the present study, we found that a dose range of TSA from 5, 50, and 100 nM had an improved rate of blastocyst development, but not for the high dose (500 nM). It has been suggested that the TSA itself is teratogenic (Svensson et al., 1998) and a high-dose TSA treatment is toxic in somatic cloning (Kishigami et al., 2006), which is probably the reason why, in our study, the high concentration of TSA treatment (500 nM) led to significant reduction of the rates of blastocyst development as well as blastocyst quality, as judged by the reduced number of total cells in comparison with the dose range of 5 to100 nM.

However, differently, in this study, the high dose, 500 nM of PXD101, had an improved rate of blastocyst development as well as blastocyst quality at a similar level as 5, 50, and 100 nM. PXD101, like other hydroxamic acid analogs, is a low-molecular-weight HDACi that induces the acetylation of histones in a concentration-dependent manner (Feng et al., 2007; Jin et al., 2015; Plumb et al., 2003), which probably explained the reason in this study why the best rate of blastocyst development was obtained by 5 nM TSA treatment (39.1%), with a higher 50 nM concentration of PXD101 (40.2%). To our knowledge, the effect of PXD101 treatment on nuclear reprogramming and in vitro developmental competence of SCNT embryos has been reported in porcine by Jin et al. (2015).

However, its effect on mouse SCNT embryos has been much more limited and therefore fewer results are available. This study suggested for the first time that a dose range of PXD101 from 5 to 500 nM improved the rate of mouse blastocyst development as well as the blastocyst quality; however, the effect of its much more higher dose needs further study.

In addition, in this study, the increased in vitro development rates in the HDACi-treated embryos were accompanied by an improved blastocyst quality, as judged by the increased number of total cells in comparison with the nontreated SCNT embryos (30%–45% increase for TSA treatment and 32%–55% increase for PXD101 treatment). Besides the improved blastocyst quality, previous studies in mice have suggested that the TSA treatment can increase levels of histone H3K14 or H3K9 acetylation (Costa-Borges et al., 2010; Rybouchkin et al., 2006).

Among the different epigenetic modifications involved in the process of nuclear reprogramming, histone acetylation seems to be very important for successful reprogramming (Luo et al., 2015; Rybouchkin et al., 2006). Our study optimized the TSA concentration and treatment timing and, for the first time, investigated the effect of PXD101 on mouse development of SCNT embryos, suggesting that the concentration and treatment time of PXD101 that most effectively improve the development of mouse SCNT embryos were 50 nM and treated for 10 hours after activation, with main focus on the technical aspect rather than the mechanism of how PXD101 enhances the reprogramming of somatic nuclei; therefore, whether the PXD101 had the same effect as TSA on histone acetylation in mice needs further study.

In this study, it was found that proper TSA or PXD101 treatment after SCNT significantly improved the subsequent establishment of NT-ESCs in comparison with the nontreated group (38.1% for TSA; 40.9% for PXD101; vs. 11.8% for nontreated control). Nowadays, NT-ESCs are attracting more public attention due to their application in regenerative medicine (Hwang et al., 2004, 2005). However, there is a limit for its application due to its low establishing rates. Our study here suggests that a new technique of TSA or PXD101 treatment can be applied to improve the rates when establishing NT-ESCs.

Our study here optimized the TSA concentration and treatment timing and, for the first time, investigated the effect of PXD101 on mouse development of SCNT embryos and establishment of NT-ESCs, providing for a new approach for the practical improvement of mouse cloning techniques and may open new opportunities to improve cloning efficiencies in other mouse strains or species. Future study should be focused on the health of PXD101-treated cloned mice and the molecular mechanism underlying its improvement.

Conclusion

In conclusion, in this study, we optimized the TSA treatment conditions (5 nM for 10 hours after activation) and first determined the PXD101 treatment conditions (50 nM for 10 hours after activation) that most effectively improved the in vitro developmental capacity of mouse SCNT embryos and establishment of NT-ESCs.

Footnotes

Acknowledgments

This study was supported by the Scientific Research Funds of Southwest University (Grant No. SWU116037) and the National Natural Science Foundation of China (Grant No. 31572488).

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

Beebe

L.F.

, McIlfatrick

S.J.

, and Nottle

M.B.

(2009). Cytochalasin B and trichostatin A treatment postactivation improves in vitro development of porcine somatic cell nuclear transfer embryos. Cloning Stem Cells, 11, 477–482.

Cibelli

J.B.

, Campbell

K.H.

, Seidel

G.E.

, West

M.D.

, and Lanza

R.P.

(2002). The health profile of cloned animals. Nat. Biotech., 20, 13–14.

Cong

, Zhu

, Ji

, Zhao

, and Chen

(2013). Effects of trichostatin A on histone acetylation and methylation characteristics in early porcine embryos after somatic cell nuclear transfer. J. Anim. Sci., 84, 639–649.

Costa-Borges

, Santalo

, and Ibanez

(2010). Comparison between the effects of valproic acid and trichostatin A on the in vitro development, blastocyst quality, and full-term development of mouse somatic cell nuclear transfer embryos. Cell Reprogram. 12, 437–446.

Dean

, Santos

, Stojkovic

, Zakhartchenko

, Walter

, Wolf

, and Reik

(2001). Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc. Natl. Acad. Sci. U.S.A., 98, 13734–13738.

Ding

, Wang

, Zhang

, Guo

, and Zhang

(2008). Increased pre- implantation development of cloned bovine embryos treated with 5-aza- 2'-deoxycytidine and trichostatin A. Theriogenology, 70, 622–630.

Feng

, Oton

, Mapara

M.Y.

, Anderson

, Belani

, and Lentzsch

(2007). The histone deacetylase inhibitor, PXD101, potentiates bortezomib-induced anti-multiple myeloma effect by induction of oxidative stress and DNA damage. Br. J. Haematol., 139, 385–397.

Gao

, McGarry

, and Priddle

(2003). Effects of donor oocytes and culture conditions on development of cloned mice embryos. Mol. Reprod. Dev., 66, 126–133.

, Ni

, Chen

, Sai

, Hazi

, and He

(2012). Comparison between the effects of valproic acid and trichostatin A on in vitro development of sheep somatic cell nuclear transfer embryos. J. Anim. Vet. Adv., 11, 1868–1872.

10.

Hwang

W.S.

, Roh

S.I.

, Lee

B.C.

, Kang

S.K.

, Kwon

D.K.

, Kim

S.J.

, Park

S.W.

, Kwon

H.S.

, Lee

C.K.

, Lee

J.B.

, Kim

J.M.

, Ahn

, Paek

S.H.

, Chang

S.S.

, Koo

J.J.

, Yoon

H.S.

, Hwang

J.H.

, Hwang

Y.Y.

, Park

Y.S.

, Oh

S.K.

, Kim

H.S.

, Park

J.H.

, Moon

S.Y.

, Schatten

(2005). Patient-specific embryonic stem cells derived from human SCNT blastocysts. Science, 308, 1777–1783.

11.

Hwang

W.S.

, Ryu

Y.J.

, Park

J.H.

, Park

E.S.

, Lee

E.G.

, Koo

J.M.

, Jeon

H.Y.

, Lee

B.C.

, Kang

S.K.

, Kim

S.J.

, Ahn

, Hwang

J.H.

, Park

K.Y.

, Cibelli

J.B.

, and Moon

S.Y.

(2004). Evidence of a pluripotent human embryonic stem cell line derived from a cloned blastocyst. Science, 303, 1669–1674.

12.

Inoue

, Kohda

, Lee

, Ogonuki

, Mochida

, Noguchi

, Tanemura

, Kaneko-Ishino

, Ishino

, and Ogura

(2002). Faithful expression of imprinted genes in cloned mice. Science, 295, 297.

13.

Jin

J.X.

, Kang

J.D.

, Li

, Jin

, Zhu

H.Y.

, Guo

, Gao

Q.S.

, Yan

C.G.

, and Yin

X.J.

(2015). Pxd101 significantly improves nuclear reprogramming and the in vitro developmental competence of porcine SCNT embryos. Bioch. Biophy. Res. Commun., 456, 156–161.

14.

Kang

Y.K.

, Koo

D.B.

, Park

J.S.

, Choi

Y.H.

, Chung

A.S.

, Lee

K.K.

, and Han

Y.M.

(2001). Aberrant methylation of donor genome in cloned bovine embryos. Nat. Genet., 28, 173–177.

15.

Kishigami

, Bui

H.T.

, Wakayama

, Tokunaga

, Van Thuan

, Hikichi

, Mizutani

, Ohta

, Suetsugu

, and Sata

(2007). Successful mouse cloning of an outbred strain by trichostatin A treatment after somatic nuclear transfer. J. Reprod. Dev., 53, 165–170.

16.

Kishigami

, Mizutani

, Ohta

, Hikichi

, Thuan

N.V.

, Wakayama

, Bui

H.T.

, and Wakayama

(2006). Significant improvement of mouse cloning technique by treatment with trichostatin A after somatic nuclear transfer. Biochem. Biophys. Res. Commun., 340, 183–189.

17.

Kishigami

, Wakayama

, Hosoi

, Iritani

, and Wakayama

(2008). Somatic cell nuclear transfer: infinite reproduction of a unique diploid genome. Exp. Cell Res., 314, 1945–1950.

18.

Latham

K.E.

(2005). Early and delayed aspects of nuclear reprogramming during cloning. Biol. Cell, 97, 119–132.

19.

, Svarcova

, Villemoes

, Kragh

P.M.

, Schmidt

, Bogh

I.B.

, Zhang

, Du

, Lin

, and Purup

(2008). High in vitro development after somatic cell nuclear transfer and trichostatin A treatment of reconstructed porcine embryos. Theriogenology, 70, 800–808.

20.

Luo

, Ju

, Muneri

C.W.

, and Rui

(2015). Effects of histone acetylation status on the early development of in vitro porcine transgenic cloned embryos. Cell. Reprogram., 17, 41–48.

21.

Luo

, Lu

, Wang

, Li

, Gong

, Jiang

, Liu

, and Shi

(2013). Treatment of donor cells with trichostatin a improves in vitro development and reprogramming of buffalo (bubalus bubalis) nucleus transfer embryos. Theriogenology, 80, 878–886.

22.

Maalouf

W.E.

, Liu

, Brochard

, Renard

J.P.

, Debey

, and Beaujean

(2009). Trichostatin A treatment of cloned mouse embryos improves constitutive heterochromatin remodeling as well as developmental potential to term. BMC Dev. Biol., 9, 1–10.

23.

Marcho

, Cui

, and Mager

(2015). Epigenetic dynamics during preimplantation development. Reproduction, 150, R109–R120.

24.

Meng

, Polgar

, Liu

, and Dinnyes

(2009). Live birth of somatic cell-cloned rabbits following trichostatin A treatment and cotransfer of parthenogenetic embryos. Cloning Stem Cells, 11, 203–208.

25.

Ohgane

, Wakayama

, Senda

, Yamazaki

, Inoue

, Ogura

, Marh

, Tanaka

, Yanagimachi

, and Shiota

(2004). The Sall3 locus is an epigenetic hotspot of aberrant DNA methylation associated with placentomegaly of cloned mice. Genes Cells, 9, 253–260.

26.

Ono

, Li

, Mizutani

, Terashita

, Yamagata

, and Wakayama

(2010). Inhibition of class IIb histone deacetylase significantly improves cloning efficiency in mice. Biol. Reprod., 83, 929–937.

27.

Plumb

J.A.

, Finn

P.W.

, Williams

R.J.

, Bandara

M.J.

, Romero

M.R.

, Watkins

C.J.

, La Thangue

N.B.

, and Brown

(2003). Pharmacodynamic response and inhibition of growth of human tumor xenografts by the novel histone deacetylase inhibitor PXD101. Mol. Cancer Ther., 2, 721–728.

28.

Rybouchkin

, Kato

, and Tsunoda

(2006). Role of histone acetylation inreprogramming of somatic nuclei following nuclear transfer. Biol. Reprod., 74, 1083–1089.

29.

Santos

, Zakhartchenko

, Stojkovic

, Peters

, Jenuwein

, Wolf

, Reik

, and Dean

(2003). Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr. Biol., 13, 1116–1121.

30.

Shi

L.H.

, Miao

Y.L.

, Ouyang

Y.C.

, Huang

J.C.

, Lei

Z.L.

, and Yang

J.W.

(2008). Trichostatin A (TSA) improves the development of rabbit-rabbit intraspecies cloned embryos, but not rabbit-human interspecies cloned embryos. Dev. Dyn., 237, 640–648.

31.

Solter

(2000). Mammalian cloning: advances and limitations. Nat. Rev. Genet., 1, 199–207.

32.

Svensson

, Mattsson

, James

T.C.

, Wentzel

, Pilartz

, MacLaughlin

, Miller

S.J.

, Olsson

, Eriksson

U.J.

, and Ohlsson

(1998). The paternal allele of the H19 gene is progressively silenced during early mouse development: the acetylation status of histones may be involved in the generation of variegated expression patterns. Development, 125, 61–69.

33.

Van Thuan

, Bui

H.T.

, Kim

J.H.

, Hikichi

, Wakayama

, Kishigami

, Mizutani

, and Wakayama

(2009). The histone deacetylase inhibitor scriptaid enhances nascent mRNA production and rescues full-term development in cloned inbred mice. Reproduction, 138, 309–317.

34.

Wakayama

, Perry

A.C.

, Zuccotti

, Johnson

K.R.

, and Yanagimachi

(1998). Full term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature, 394, 369–374.

35.

Wakayama

, Tabar

, Rodriguez

, Perry

A. C.

, Studer

, and Mombaerts

(2001). Differentiation of embryonic stem cell lines generated from adult somatic cells by nuclear transfer. Science, 292, 740–743.

36.

Wang

, Kou

, Zhang

, and Gao

(2007). Dynamic reprogramming of histone acetylation and methylation in the first cell cycle of cloned mouse embryos. Biol. Reprod., 77, 1007–1016.

37.

Wang

J.X.

, and Liu

H.W.

(2007). Isolation, culture and differentiation of embryonic stem cells from the blastocyst of 3.5-day kunming mice into insulin precursor cells. J. Clin. Rehabil. Tissue Eng. Res., 15, 208–211.

38.

Wee

, Koo

D.B.

, Song

B.S.

, Kim

J.S.

, Kang

M.J.

, Moon

S.J.

, Kang

Y.K.

, Lee

K.K.

, and Han

Y.M.

(2006). Inheritable histone H4 acetylation of somatic chromatins in cloned embryos. J. Biol. Chem., 281, 6048–6057.

39.

Wen

B.Q.

, Li

J.J.

, Tian

S.J.

, Sun

S.C.

, Qi

, Cai

W.T.

, and Chang

Q.L.

(2014). The histone deacetylase inhibitor scriptaid improves in vitro developmental competence of ovine somatic cell nuclear transferred embryos. Theriogenology, 81, 332–339.

40.

Wilmut

, and Paterson

(2002). Somatic cell nuclear transfer. Nature, 419, 303–307.

41.

, Wang

, Li

, Wang

, Xiong

, Su

, and Zhang

(2012). Valproic acid improves the in vitro development competence of bovine somatic cell nuclear transfer embryos. Cell Reprogram. 14, 138–145.

42.

Yang

, Smith

S.L.

, Tian

X.C.

, Lewin

H.A.

, Renard

J.P.

, and Wakayama

(2007). Nuclear reprogramming of cloned embryos and its implications for therapeutic cloning. Nat. Genet., 39, 295–302.

43.

Yao

Y.X.

, Guan

W.J.

, Li

X.C.

, Su

X.H.

, Ma

Y.H.

, and Li

H.P.

(2012). Trichostatin A treatment on two types of donor cells for somatic cell nuclear transfer. J. Anim. Vet. Adv., 11, 1812–1818.

44.

Zhang

, Xiao

, Wang

, Riaz

, Li

, Fu

, Xin

, Shi

, Ma

, Li

, and Yang

(2014). Effects of histone deacetylase inhibitors on the early development of bovine androgenetic embryos. Cell Reprogram., 16, 54–64.