Muse Cells Derived from Dermal Tissues Can Differentiate into Melanocytes

Abstract

The objective of the authors has been to obtain multilineage-differentiating stress-enduring cells (Muse cells) from primary cultures of dermal fibroblasts, identify their pluripotency, and detect their ability to differentiate into melanocytes. The distribution of SSEA-3-positive cells in human scalp skin was assessed by immunohistochemistry, and the distribution of Oct4, Sox2, Nanog, and SSEA-3-positive cells was determined by immunofluorescence staining. The expression levels of Sox2, Oct4, hKlf4, and Nanog mRNAs and proteins in Muse cells were determined by reverse transcription polymerase chain reaction (RT-PCR) analyses and Western blots, respectively. These Muse cells differentiated into melanocytes in differentiation medium. The SSEA-3-positive cells were scattered in the basement membrane zone and the dermis, with comparatively more in the sebaceous glands, vascular and sweat glands, as well as the outer root sheath of hair follicles, the dermal papillae, and the hair bulbs. Muse cells, which have the ability to self-renew, were obtained from scalp dermal fibroblasts by flow cytometry sorting with an anti-SSEA-3 antibody. The results of RT-PCR, Western blot, and immunofluorescence staining showed that the expression levels of Oct4, Nanog, Sox2, and Klf4 mRNAs and proteins in Muse cells were significantly different from their parental dermal fibroblasts. Muse cells differentiated into melanocytes when cultured in melanocyte differentiation medium, and the Muse cell-derived melanocytes expressed the melanocyte-specific marker HMB45. Muse cells could be obtained by flow cytometry from primary cultures of scalp dermal fibroblasts, which possessed the ability of pluripotency and self-renewal, and could differentiate into melanocytes in vitro.

Introduction

A novel type of pluripotent stem cells existing among adult human mesenchymal stem cells (MSCs) was initially reported by Kuroda et al. (2010), and since then, Muse cells have attracted a great deal of attention. Muse cells, which have characteristics similar to both pluripotent stem cells and MSCs (Wakao et al., 2011), normally exist in cultured human mesenchymal cells, such as dermal fibroblasts (Ogura et al., 2014; Yang et al., 2013), bone marrow stromal cells, adipose cells, and so on (Wakao et al., 2014). Muse cells can be sorted by flow cytometry as they are double positive for SSEA-3 and CD105, specific markers for undifferentiated human embryonic stem (ES) cells, and mesenchymal cells, respectively. As dermal fibroblasts belong to mesenchymal cells, the anti-CD105 antibody is not required for sorting Muse cells from cultured dermal fibroblasts by flow cytometry (Kuroda et al., 2013).

In this study, the distribution of SSEA-3-positive cells was verified after which flow cytometry was used to sort the cells expressing SSEA-3 from the cultured primary fibroblasts. The cells obtained were cultured in methyl cellulose (MC) medium, and their abilities for self-renewal and pluripotency were further verified.

Materials and Methods

Immunochemistry of human scalp skin

Sections of human scalp skin (discarded scalp specimens after plastic surgery, the use of which had been approved by the Hospital Ethics Committee) were incubated in 3% fresh hydrogen peroxide for 15 minutes to abolish endogenous peroxidase activities, and were then washed with phosphate-buffered saline (PBS). Normal goat serum was used to eliminate nonspecific background before the sections were incubated with the primary antibody (SSEA-3, 1:100, Cat. No. MAB4303; Millipore) for 2 hours at room temperature. After appropriate washing, the sections were incubated with the secondary antibody at room temperature for 15 minutes, treated with a streptavidin–HRP (horseradish peroxidase) complex for 15 minutes, and then stained with 3, 3′-diaminobenzidine and H₂O₂. Finally, the sections were lightly counterstained with hematoxylin. A negative control was performed using PBS instead of the primary antibody.

Culture of dermal fibroblasts from scalp skin

After washing with PBS supplemented with 400 U/mL penicillin and 400 μg/mL streptomycin, the subcutaneous adipose tissue of the scalp was manually removed using a pair of forceps. The remaining tissue, including the epidermis and the dermis, was washed again with PBS and then was cut into small pieces. The dermis was separated from the epidermis after treatment with 0.25% dispase (Cat. No. 4942078001; Roche) for 2 hours. The dermis sheets obtained were treated in 0.25% trypsin-EDTA (Gibco) for 30 minutes to produce cell suspensions, which were filtered through a 200 μm filter, and then centrifuged.

The cell pellets were resuspended in α-Minimum Essential Medium Eagle Modification (α-MEM, Cat. No. M4526; Sigma-Aldrich) containing 20% fetal bovine serum (085-150; Wisent), 2 mM l-glutamine (25030-081; Gibco), and 100 IU/mL penicillin–streptomycin (Gibco), and cultured at 37°C, 5% CO₂ in an incubator. When the cells reached 80%–90% confluence, they were treated with 0.05% trypsin-EDTA and passaged at a ratio of 1:5, after which the culture medium was changed every 2 days. In this study, fibroblasts were obtained from the dermal skin and the hair follicles.

Sorting of Muse cells by FACS (fluorescence activated cell sorting)

The human dermal fibroblasts were incubated with an antibody against FITC-SSEA-3 (1:5; R&D Systems) for 20 minutes at room temperature or with an FITC-Goat-IgM antibody used as an isotype control. After washing three times in PBS, the cells were resuspended in PBS and then were immediately analyzed and sorted on an EPICS XL-MCL cell sorter (Beckman Coulter) using a low stream speed to ensure greater survival and the highest purity of cells. The sorted cells were cultured in MC medium (Cat. No. 04100; StemCell Technologies) in Poly-HEMA (2-hydroxethylmethacrylate) coated six-well plates with 500 μL MC medium added every 2 days. Four days later, the dead cells were removed through low speed centrifugation, and the viable cells were further cultured in suspension media. To evaluate their self-renewal property, the firstly generated clusters of Muse cells were transferred onto matrigel-coated plates for adherent culture and were expanded after 5–7 days of suspension culture.

Alkaline phosphatase staining

The first generation Muse clusters were directly transferred into six-well culture plates and were grown for 3 days. The growth outward from the clusters was observed. The clusters and their proliferating cells were washed at least three times (5 minutes each wash) with PBS. Staining was performed using a leukocyte alkaline phosphatase (ALP) kit (Cat. No. 86R; Sigma-Aldrich) according to the manufacturer's instructions.

Immunofluorescence staining for pluripotent markers

Staining of M-clusters in suspension culture was difficult, so cells in adherent culture for at least 3 hours were used for immunofluorescence staining. These cells were fixed with 4% paraformaldehyde for 15 minutes at room temperature, and then were incubated in 0.1% Triton X-100 in PBS for 10 minutes. After washing with PBS three times, cells were incubated with a blocking solution containing 5% BSA (Sigma) at room temperature for 60 minutes. The cells were stained with primary antibodies specific for Oct4 (1:200, ab19857; Abcam), Sox2 (1:200, ab59776; Abcam), Nanog (1:100, ab21624; Abcam), and SSEA-3 (1:100, Cat. No. MAB4303; Millipore). All primary antibodies were prediluted in PBS/0.1% BSA solution and incubated overnight at 4°C. After washing three times, the specimens were incubated with secondary antibodies for 2 hours at room temperature in a ventilated area. After proper washing, the cells were observed using a fluorescence microscope.

RT-PCR (reverse transcription polymerase chain reaction)

Total RNA was extracted from Muse cells using a Trizol kit (Invitrogen) with the parental fibroblast cells serving as a negative control. The concentration and purity of the extracted RNA were determined using a UV spectrophotometer. The first-strand cDNA was generated from 5 μL RNA using a First Strand cDNA synthesis kit (Invitrogen) according to the manufacturer's protocol. The obtained cDNA was used as a template for polymerase chain reaction (PCR) amplification using a Go Taq green Master Mix PCR kit (Promega). The primer sequences used are shown in Table 1. The PCR products were analyzed through electrophoresis in 1% agarose gels containing 0.1 mg/mL ethidium bromide. The gels were photographed under UV light. mRNA expression levels were quantified by densitometry of the cDNA bands using software Quantity One (Bio-Rad).

Table 1.

Nucleotide Sequence of Primers for RT-PCR

Gene	Primer sequence (5′→ 3′)
en-hSox2 (F)	GGGAAATGGGAGGGGTGCAAAAGAGG
en-hSox2 (R)	CGT GAG TGT GGA TGG GAT TGG TG
en-hKlf4 (F)	ACGATCGTGGCCCCGGAAAAGGACC
en-hKlf4 (R)	TGATTGTAGTGCTTTCTGGCTGGGCTCC
hNANOG (F)	ACAACTGGCCGAAGAATAGCA
hNANOG (R)	GGTTCCCAGTCGGGTTCAC
en-hOct4 (F)	GGGTTTTTGGGATTAAGTTCTTCA
En-hOct4 (R)	GCCCCCACCCTTTGTGTT
hGAPDH (F)	ATCCTCAGTGAGTTCTCCCG
hGAPDH (R)	CTTTGCCATCACTGCCATTA

F, forward; R, reverse.

Western blot

The cultured Muse cells and their parental fibroblast cells were resuspended in lysis buffer, incubated on ice for 30 minutes, and then centrifuged at 12,000 g for 30 minutes. These supernatants were collected and protein concentrations were determined using a BCA protein assay kit (Thermo Fisher Scientific). The lysate sample (50 μg) was separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Millipore). The membranes were then blocked and incubated with primary antibodies overnight at 4°C. The primary antibodies used were as follows: Oct4 (1 μg/mL, ab19857; Abcam), Sox2 (0.5 μg/mL, ab59776; Abcam), Nanog (1:200, ab21624; Abcam), and Tubulin (1:1000; Biyuntian, control); secondary antibodies used were horseradish peroxidase-labeled goat antimouse (GAM-007; Santa Cruz), and goat antirabbit (SC-2004; Santa Cruz) IgG. The immunoreactive bands were quantitatively analyzed with Image J software.

Differentiation of Muse cells to melanocytes

Muse cells were seeded at a density of 10,000 cells per well in six-well culture plates coated with fibronectin (10 ng/mL; Becton Dickinson) and were cultured for 1 day in α-MEM. Muse cells were then cultured in media containing the following ingredients: 0.05 μM dexamethasone (Sigma), 1 × insulin transferrin selenium (Sigma), 1 mg/mL linoleic acid-BSA (Sigma), 30% low-glucose DMEM (Invitrogen), 20% MCDB-201 medium (Sigma), 10⁻⁴ M L-vitamin C (Sigma), 50 ng/mL L-Wnt3a (ATCC), 100 ng/mL SCF (R&D Systems), 100 nM endothelin-3 (American Peptide, Sunnyvale, CA), 20 pM cholera toxin (Sigma), 50 nM phorbolester 12-O-tetradecanoylphorbol-13-acetate (Sigma), and 4 ng/mL basic fibroblast growth factor (R&D Systems). The medium was changed every 2 days, and immunofluorescence staining for HMB45 was performed after 6 weeks.

Results

Distribution of SSEA-3 antigen in scalp skin

In normal scalp skin, expression of SSEA-3 was not observed in the epidermal layer. A few SSEA-3-positive cells were scattered in the sebaceous gland, blood vessel, and eccrine gland (Fig. 1a), as well as in the outer root sheath of the hair follicle and the dermal papilla (Fig. 1b).

FIG. 1.

(a) A few SSEA-3-positive cells were scattered in the sebaceous gland, blood vessel, and eccrine gland (400 × ). (b) A few SSEA-3-positive cells were scattered in the outer root sheath of the hair follicle and the dermal papilla (400 × ). Color images available online at www.liebertpub.com/cell

Muse cells derived from dermal fibroblasts by FACS sorting

The ratio of SSEA-3-positive cells in dermal fibroblasts was 5% (Fig. 2), which was slightly higher than the ratio previously reported. When individual Muse cells collected by sorting were cultured in MC medium, the clones gradually formed were very similar to embryonic bodies derived from ES cells, namely M-clusters. The M-clusters were round or oval, had good transparency and a clear boundary, and were usually generated by 4 days (Fig. 3a). The size of the clusters reached a maximum at 7–10 days, and they then stopped growing. However, when transferred to adherent growth conditions in gelatin-coated dishes, these cells began to proliferate again (Fig. 3b). When the cells expanded and achieved 80%–90% confluence, they were collected using a 5 minutes trypsin treatment and were again grown in suspension culture. The M-clusters were observed again. The sixth-generation clusters were still positive for ALP staining and expressed pluripotent markers.

FIG. 2.

The ratio of SSEA-3-positive cells in dermal fibroblasts was about 5%. Color images available online at www.liebertpub.com/cell

FIG. 3.

(a) Single Muse cells gained by sorting were cultured in MC medium at day 1, the clones gradually formed were round or oval and had good transparency and clear boundary at day 4. The size of the clusters reached the maximum at day 7, which appeared slightly black. (b) After adherent culture, expanded cells developed from M-clusters radially. MC, methyl cellulose.

ALP staining

ALP staining is related to the pluripotency of cells, which is characteristic of undifferentiated cells. ALP staining can indirectly reflect the pluripotent state of cells. The M-clusters and immediate expanded cells were positive for ALP staining (Fig. 4), which were a deep mauve color in the centers of the M-clusters, and the color hue gradually faded from the proximate M-clusters to the distant cells. These results indicate that the M-clusters represent the population of stem cells.

FIG. 4.

Alkaline phosphatase showed that the color was deep in the center of M-clusters, but gradually faded in expanded cells around the M-clusters.

Pluripotent markers of the M-clusters

It is well known that Oct4, Sox2, Nanog, and SSEA-3 are specific markers of pluripotent cells. After 3 hours of adherent culture, the M-clusters were fixed in 4% paraformaldehyde and were stained with specific antibodies to various surface markers, including SSEA-3, Nanog, Oct4, and Sox2. The results displayed a slightly weaker fluorescence for Nanog than for Oct4, SSEA-3, and Sox2 (Fig. 5).

FIG. 5.

Immunofluorescence staining showed that the expression levels of Oct4, Sox2, Nanog, and SSEA-3 were positive. Color images available online at www.liebertpub.com/cell

The expression of SOX2, OCT4, hKlf4, and Nanog mRNAs in Muse cells

In this study, RT-PCR was used to detect the expression of Sox2, Oct4, hKlf4, and Nanog mRNAs, which are related to pluripotency. The RT-PCR results showed that Oct4, Nanog, hKlf4, and Sox2 mRNA expression patterns by Muse cells were significantly different compared with their parental dermal fibroblasts (Fig. 6). Meanwhile, the expression of Sox2, Oct4, and Nanog proteins was detected by Western blot, and the results show a significant difference between the Muse cells and their parental dermal fibroblasts (Fig. 7).

FIG. 6.

RT-PCR results showed that Oct4, Sox2, Klf4, and Nanog gene expression of Muse cells had significant difference compared with parental FC.

FIG. 7.

The expression of Sox2, Oct4, and Nanog proteins was detected by Western blot, and the results show a significant difference between the Muse cells and their parental dermal fibroblasts.

Differentiation of Muse cells into melanocytes

At the first week, many Muse cells that were cultured in melanocyte differentiation medium died and floated off, but the surviving cells began to change their morphology and appeared dendritic by week 3. At 6 weeks, these cells presented the morphology of melanocytes, and expressed the melanocyte-specific antigen HMB45 (Fig. 8a, b) (Adema et al., 1994; Kapur et al., 1992).

FIG. 8.

(a) Morphology of Muse cells after differentiation for 6 weeks began to have two or many dendrities, like melanocyte morphology. (b) Muse cell-derived melanocytes express melanocyte marker HMB45 in the sixth week.

Discussion

Melanocytes can produce and transfer melanin to their neighboring keratinocytes. Both kinds of cells form the melanocyte–keratinocyte unit that protects the skin from UV damage (Seiberg, 2001). Melanocyte dysfunction leads to a variety of pigmentation disorders, such as albinism and vitiligo (Tsuchiyama et al., 2013). These not only lead to aesthetic problems but also increase the risk of skin cancer because of incomplete protection from UV damage. At present, the treatment protocols for vitiligo include the topical application of corticosteroids and calcium phosphatase inhibitors (Sanclemente et al., 2008), immune regulation therapy, UV therapy (Whitton et al., 2015), and autologous skin transplantation (Saldanha et al., 2012). For treating intractable vitiligo, the transplantation of autologous cultured melanocytes is a good choice.

However, transplantation is not widely used because the cultivation and amplification of adult mature melanocytes in vitro are difficult. It has been reported that embryonic stem cells and pluripotent stem cells can be induced to differentiate into melanocytes, but ethical problems of embryonic stem cells and the tumorigenic risks of both types of stem cells have hindered their clinical application (Sviderskaya et al., 2009; Yang et al., 2011).

In 2010, Muse cells were first identified in mesenchymal tissues, such as bone marrow, adipose tissue (Simerman et al., 2014), and the dermis. Muse cells express the pluripotent stem cell marker SSEA-3 and the mesenchymal marker CD105. Because dermal fibroblasts belong to mesenchymal cells, if dermal fibroblasts are used to isolate Muse cells by flow cytometry sorting, only the anti-SSEA-3 antibody is required. Muse cells can differentiate into all three types of germ cells (Dezawa, 2016), have no oncogenic nature, and only a low level of telomerase activity. In suitable differentiation medium, Muse cells can directly differentiate into melanocytes (Tsuchiyama et al., 2013). In contrast, because of the hair cover and its good tensile properties, using scalp skin as donor tissue to obtain Muse cells will be willingly accepted by patients.

Scalp-derived fibroblasts were used to sort SSEA-3-positive cells by flow cytometry, and were then cultured in MC culture medium in poly-HEMA-coated plates. The ratio of SSEA-3-positive cells in human scalp fibroblasts was 5%, which was slightly higher than the ratio previously reported. These SSEA-3-positive cells came from the dermis, the outer root sheath, the dermal papilla, and the hair bulbs of hair follicles. Thus, scalp fibroblasts would seem to be an excellent source of Muse cells. In suspension culture, M-clusters similar to embryoid bodies were obtained. The M-clusters in suspension culture at day 7 reached the maximum shape and size and then stopped growing.

However, when the M-clusters were transferred to gelatin-coated dishes, the cells began expanding and proliferating again. Such a cycle of suspension-adherent culture confirms that Muse cells have a self-renewal capacity, which is one of the characteristics of stem cells. If a suitable differentiation medium is added, the Muse cells can directly differentiate into melanocytes. This result confirms that Muse cells have the ability to differentiate, which is another property of stem cells. Therefore, Muse cells obtained from scalp tissues may be an excellent source to serve as cell transplants for treating pigmentary diseases, such as vitiligo. The findings of ALP staining, RT-PCR, and Western blot indicate that these Muse cells are pluripotent.

Muse cells have many advantages for regenerative medicine. First, Muse cells can be easily obtained from mesenchymal cells (Kuroda and Dezawa, 2014) through flow cytometry sorting. Second, Muse cells have self-renewal ability and can produce a large number of cells to meet clinical needs (Katagiri et al., 2016). The culture medium used in this process of cell proliferation is harmless. Moreover, no vectors bearing a lentivirus or a retrovirus are added to the culture. Third, Muse cells have the ability to differentiate into cells representative of all three germ layers, and the in vivo environment can also directly induce cells that are suitable for wound healing, organ regeneration, and diabetic skin ulcers (Dezawa, 2016; Kinoshita et al., 2015; Simerman et al., 2014).

In contrast, Muse cells are different from other types of stem cells in that they have a high ratio of differentiation into neuronal cells after integration with the host brain microenvironment, and can possibly reconstruct neuronal circuits to mitigate stroke symptoms (Uchida et al., 2016). At the same time, because of their low telomerase activity, Muse cells have no tumorigenic risk and thus are extraordinary candidate cells for regenerative medicine. Recently, researchers found that if Muse cells migrate in the body and target a damaged area, they can spontaneously differentiate into cells that are consistent with the target tissue, which is highly effective for tissue repair (Yamauchi et al., 2015).

Therefore, in future studies we will use Muse cells to treat dermatology-related diseases such as vitiligo, albinism, and refractory skin ulcers.

Footnotes

Acknowledgments

The authors are very grateful to Professor V.J. Hearing for help with the English language editing. The work was supported by the National Natural Science Foundation of China (Grant No. 81171516) and the Science and technology Foundation of Jiangsu, China (Grant No. BL2014036).

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

Adema

G.J.

, de Boer

A.J

, Vogel

A.M.

, Loenen

W.A.

, and Figdor

C.G.

(1994). Molecular characterization of the melanocyte lineage-specific antigen gp100. J. Biol. Chem., 269, 20126–20133.

Dezawa

(2016). Muse cells provide the pluripotency of mesenchymal stem cells: direct contribution of Muse cells to tissue regeneration. Cell Transplant. 25, 849–861.

Kapur

R.P.

, Bigler

S.A.

, Skelly

, and Gown

A.M.

(1992). Anti-melanoma monoclonal antibody HMB45 identifies an oncofetal glycoconjugate associated with immature melanosomes. J. Histochem. Cytochem., 40, 207–212.

Katagiri

, Kushida

, Nojima

, Kuroda

, Wakao

, Ishida

, Endo

, Kume

, Takahara

, Nitta

, Tsuda

, Dezawa

, and Nishizuka

S.S.

(2016). A distinct subpopulation of bone marrow mesenchymal stem cells, muse cells, directly commit to the replacement of liver components. Am. J. Transplant., 16, 468–483.

Kinoshita

, Kuno

, Ishimine

, Aoi

, Mineda

, Kato

, Doi

, Kanayama

, Feng

, Mashiko

, Kurisaki

, and Yoshimura

(2015). Therapeutic potential of adipose-derived SSEA-3-positive Muse cells for treating diabetic skin ulcers. Stem Cells Transl. Med., 4, 146–155.

Kuroda

, and Dezawa

(2014). Mesenchymal stem cells and their subpopulation, pluripotent muse cells, in basic research and regenerative medicine. Anat. Rec. (Hoboken)., 297, 98–110.

Kuroda

, Kitada

, Wakao

, Nishikawa

, Tanimura

, Makinoshima

, Goda

, Akashi

, Inutsuka

, Niwa

, Shigemoto

, Nabeshima

, Nakahata

, Nabeshima

, Fujiyoshi

, and Dezawa

(2010). Unique multipotent cells in adult human mesenchymal cell populations. Proc. Natl. Acad. Sci. U S A., 107, 8639–8643.

Kuroda

, Wakao

, Kitada

, Murakami

, Nojima

, and Dezawa

(2013). Isolation, culture and evaluation of multilineage-differentiating stress-enduring (Muse) cells. Nat. Protoc., 8, 1391–1415.

Ogura

, Wakao

, Kuroda

, Tsuchiyama

, Bagheri

, Heneidi

, Chazenbalk

, Aiba

, and Dezawa

(2014). Human adipose tissue possesses a unique population of pluripotent stem cells with nontumorigenic and low telomerase activities: potential implications in regenerative medicine. Stem Cells Dev. 23, 717–728.

10.

Saldanha

K.D.

, Machado

F.C.D.

, and Paschoal

F.M.

(2012). Action of topical mometasone on the pigmented halos of micrografting in patients with vitiligo. An. Bras. Dermatol., 87, 685–690.

11.

Sanclemente

, Garcia

J.J.

, Zuleta

J.J.

, Diehl

, Correa

, and Falabella

(2008). A double-blind, randomized trial of 0.05% betamethasone vs. topical catalase/dismutase superoxide in vitiligo. J. Eur. Acad. Dermatol. Venereol., 22, 1359–1364.

12.

Seiberg

(2001). Keratinocyte-melanocyte interactions during melanosome transfer. Pigment Cell Res. 14, 236–242.

13.

Simerman

A.A.

, Dumesic

D.A.

, and Chazenbalk

G.D.

(2014). Pluripotent muse cells derived from human adipose tissue: a new perspective on regenerative medicine and cell therapy. Clin. Transl. Med., 3, 12.

14.

Simerman

A.A.

, Perone

M.J.

, Gimeno

M.L.

, Dumesic

D.A.

, and Chazenbalk

G.D.

(2014). A mystery unraveled: nontumorigenic pluripotent stem cells in human adult tissues. Expert Opin. Biol. Ther., 14, 917–929.

15.

Sviderskaya

E.V.

, Easty

D.J.

, Lawrence

M.A.

, Sánchez

D.P.

, Negulyaev

Y.A.

, Patel

R.H.

, Anand

, Korchev

Y.E.

, and Bennett

D.C.

(2009). Functional neurons and melanocytes induced from immortal lines of postnatal neural crest-like stem cells. FASEB J. 23, 3179–3192.

16.

Tsuchiyama

, Wakao

, Kuroda

, Ogura

, Nojima

, Sawaya

, Yamasaki

, Aiba

, and Dezawa

(2013). Functional melanocytes are readily reprogrammable from multilineage-differentiating stress-enduring (muse) cells, distinct stem cells in human fibroblasts. J. Invest. Dermatol., 133, 2425–2435.

17.

Uchida

, Morita

, Niizuma

, Kushida

, Kuroda

, Wakao

, Sakata

, Matsuzaka

, Mushiake

, Tominaga

, Borlongan

C.V.

, and Dezawa

(2016). Transplantation of unique subpopulation of fibroblasts, muse cells, ameliorates experimental stroke possibly via robust neuronal differentiation. Stem Cells. 34, 160–173.

18.

Wakao

, Akashi

, Kushida

, and Dezawa

(2014). Muse cells, newly found non-tumorigenic pluripotent stem cells, reside in human mesenchymal tissues. Pathol. Int., 64, 1–9.

19.

Wakao

, Kitada

, Kuroda

, Shigemoto

, Matsuse

, Akashi

, Tanimura

, Tsuchiyama

, Kikuchi

, Goda

, Nakahata

, Fujiyoshi

, and Dezawa

(2011). Multilineage-differentiating stress-enduring (Muse) cells are a primary source of induced pluripotent stem cells in human fibroblasts. Proc. Natl. Acad. Sci. U S A, 108, 9875–9880.

20.

Whitton

M.E.

, Pinart

, Batchelor

, Leonardi-Bee

, González

, Jiyad

, Eleftheriadou

, and Ezzedine

(2015). Interventions for vitiligo. Cochrane Database Syst. Rev., 2: CD003263.

21.

Yamauchi

, Kuroda

, Morita

, Shichinohe

, Houkin

, Dezawa

, and Kuroda

(2015). Therapeutic effects of human multilineage-differentiating stress enduring (MUSE) cell transplantation into infarct brain of mice. PLoS One, 10, e0116009.

22.

Yang

, Jiang

, Kumar

S.M.

, Xu

, Wang

, Xiang

, and Xu

(2011). Generation of melanocytes from induced pluripotent stem cells. J. Invest. Dermatol., 131, 2458–2466.

23.

Yang

, Liu

, Qiu

, Liu

, Zheng

, Pang

, Quan

, and Zhang

(2013). Isolation and characterization of SSEA3(+) stem cells derived from goat skin fibroblasts. Cell Reprogram. 15, 195–205.