Effect of DNA and Histone Methyl Transferase Inhibitors on Outcomes of Buffalo–Bovine Interspecies Somatic Cell Nuclear Transfer

Abstract

Somatic cell nuclear transfer (SCNT) derived embryos suffer from abnormal epigenetic reprogramming, which handicaps pre- and postimplantation development. It was hypothesized that epigenetic modifiers, including zebularine (DNA methyltransferase inhibitors) and BIX-01294 (histone methyltransferase inhibitors), could decrease the respective levels of 5-methylcytosine and H3K9me2 in reconstructed oocytes (RO). Accordingly, we investigated whether treating RO with zebularine and BIX-01294 for 16 hours after activation could improve developmental competence and quality of buffalo–bovine interspecies SCNT (iSCNT) embryos. Treatment of RO with zebularine but not BIX-01294 significantly increased two-cell formation at 16 hours postactivation. Conversely, early cleaved embryos had significantly lower rate of blastocyst formation in zebularine treated RO compared to their counterparts in control and BIX-01294 groups. Treatment of RO with zebularine and BIX-01294 did not improve blastocyst rate of buffalo–bovine iSCNT embryos compared to their control counterparts. However, these two epigenetic drugs might have some beneficial effects on buffalo–bovine iSCNT compared to bovine SCNT embryos. The quality of iSCNT blastocysts was improved due to significant expression of OCT4 and CDX2 in BIX-01294 and CDX2 in zebularine treated RO. Furthermore, treatment of RO with zebularine and BIX-01294 did not affect DNA fragmentation in derived blastocysts against control group. In conclusion, treatment with zebularine and BIX-01294 did not enhance developmental competence of iSCNT embryos, but may have some beneficial effects on epigenetic makeup and quality of derived blastocysts.

Introduction

Assisted reproductive technologies in buffaloes are regarded as important tools to improve reproductive efficiency especially after a sharp decline in population of buffaloes in many countries worldwide (Saikhun et al., 2002). Reproductive efficiency in buffaloes is low, mainly due to specific reproductive characteristics (Drost, 2007) such as seasonal breeding, delayed puberty, prolonged postpartum period, and inter-calving interval (Drost, 2007; Singh et al., 2000).

Since the first successful birth of cloned animal by somatic cell nuclear transfer (SCNT; Wilmut et al., 1997), this technique has greatly evolved over time, and today SCNT is regarded as an efficient reproductive technology (Hosseini et al., 2015). The first cloned buffalo, through SCNT, was born in 2007 (Shi et al., 2007). Production of cloned buffalo has remained very low compared to other species, partly because of limited source of buffalo oocytes and low availability of surrogate mothers (Gasparrini, 2002; Singh et al., 2000).

Accordingly, interspecies SCNT (iSCNT) could be used as an alternative approach in buffalo cloning (Kitiyanant et al., 2001; Lu et al., 2005; Saikhun et al., 2002). Because of easy access to bovine ovaries from abattoirs and sufficient knowledge about reproductive biology of this species, bovine oocytes and uterus can serve as recipients to accelerate production of cloned buffalo (Mastromonaco and King, 2007).

Success of cloning, either in SCNT or iSCNT, is highly based on proper nuclear reprogramming of donor nucleus leading to stage specific expression of genes responsible for proper embryonic development (Mastromonaco and King, 2007). Nuclear reprogramming is mainly regulated by epigenetic mechanisms, including DNA methylation and histone tail modifications. Aberrant epigenetic reprogramming is considered as the main cause of developmental failure in cloned embryos (Daniels et al., 2000; Han et al., 2003; Rideout et al., 2001; Santos and Dean, 2004).

Treatment of donor cells and/or reconstructed oocytes (RO) with epigenetic modifiers can improve quantity and/or quality of SCNT derived preimplantation embryos and increase their postimplantation development. Three important categories of epigenetic modifiers which can alter epigenetic status of biological materials are DNA methyl transferase inhibitors (DNMTis), histone deacetylase inhibitors (HDACis), and histone methyl transferase inhibitors (HMTis).

Zebularine is one of the well-known DNMTis with low toxicity and more stability compared to other DNMTis (Cheng et al., 2003). Zebularine alone or in association with HDACi could improve preimplantation development of SCNT embryos (Diao et al., 2013; Xiong et al., 2013). BIX-01294 is an HMTi, which inhibits activity of G9A and G9A-like protein (GLP). It has been shown that BIX-01294 can enhance reprogramming of somatic cells to induced pluripotent stem cells (Feng et al., 2009; Shi et al., 2008) and developmental competence of porcine SCNT embryos (Cao et al., 2017; Huang et al., 2016). Therefore, objective of this study was to investigate the effect of two epigenetic modifiers, Zebularine and BIX-01294, on development and quality of buffalo–bovine iSCNT embryos following activation of RO.

Materials and Methods

Media and reagents

Unless otherwise specified, all chemicals and media were obtained from Sigma-Aldrich Chemicals (St. Louis, MO) and Gibco (Invitrogen Corporation, Grand Island, NY), respectively. This study received an approval from Ethics Committee of Royan Institute.

Somatic donor cell preparation

To prepare bovine and buffalo somatic donor cells, a skin biopsy was taken from 3-month-old female buffalo and bovine calves. The biopsy was cut into small pieces (2–3 mm²) and cultured as an explant in Dulbecco's modified Eagle's medium F-12 (DMEM/F-12) with 10% fetal bovine serum (FBS) and antibiotic (1% penicillin-streptomycin) at 37°C under a humidified atmosphere of 5% CO₂ until 80% confluency. The fibroblast outgrowths were passaged and stored in liquid nitrogen as described previously (Hosseini et al., 2008). For both SCNT and iSCNT procedures, frozen fibroblasts were thawed and cultured in DMEM/F-12 plus 10% FBS. Synchronization of donor cells in G0 was achieved by culturing fibroblasts in DMEM/F-12 plus 0.5% FBS for 3–4 days. Only cells in passage 2–3 were used for SCNT and iSCNT experiments.

Cytotoxicity assessment

Toxicity of different concentrations of zebularine and BIX-01294 on fibroblast cells was determined using 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay. In brief, 5000 buffalo cells were cultured in DMEM/F-12 containing 10% FBS in 96-well dish. After 24 hours, DMEM/F-12 + 10% FBS containing varying concentrations of zebularine (20, 30, 40, and 60 μM prepared in DMSO) or BIX-01294 (1, 2, 3, 4, and 6 μM) was added to cultured cells and incubated for 24, 48, and 72 hours. Then MTS was added to each well and incubated for 4 hours at 37°C. Absorbance ratio of various concentrations of zebularine or BIX-01294 relative to control was measured at 492 nm using multiwell spectrophotometer. All analyses were measured in three independent replications, and each replication consisted of triplicate samples.

Quantitative assessment of 5-methylcytosine and H3K9me2 in fibroblasts

The respective effects of nontoxic doses of zebularine and BIX-01294 on 5-methylcytosine and H3K9me2 of buffalo fibroblast cells were assessed using flow cytometry through measuring fluorescence intensity of the complexes between DNA/histones with primary and secondary antibodies in cells as described previously (Jafarpour et al., 2011). In brief, after treating fibroblast cells with nontoxic concentrations of zebularine (20, 30, and 40 μM) or BIX-01294 (1, 2, and 3 μM) for 24 hours, the cells were fixed with ice-cold 70% ethanol for 1 hour in 4°C for the detection of 5-methylcytosine (5mC) and with 4% paraformaldehyde (PF) for the detection of H3K9me2. Permeabilization was carried out using 1% Triton X-100 in phosphate buffer solution without calcium and magnesium (PBS⁻) for 30 minutes at room temperature (RT).

For DNA methylation, cells were treated with 4 N HCl for 30 minutes at RT to denature the DNA, and subsequently, HCl was neutralized with 100 mM Tris–HCl buffer (pH 8.0). To block nonspecific binding sites, cells were incubated in blocking solution (PBS⁻ plus 1% bovine serum albumin and 10% goat serum) for 2 hours at RT. Subsequently, cells were incubated with mouse anti-5-methyl cytosine (BI-MECY-0100, 1:400 dilution; Eurogentec, Belgium) and mouse anti-H3K9me2 (ab1220, 1:200 dilution; Abcam, UK) antibodies overnight at 4°C for assessment of DNA methylation and H3K9 dimethylation, respectively.

After extensive washing, cells were incubated with goat anti-mouse IgG-fluorescein conjugated (AP124F, 1:50 dilution; Chemicon International, CA) as a secondary antibody for 1 hour at 37°C. After washing, 10,000 cells were collected with FACS-Caliber and analyzed using CellQuest 3.1 software (Becton Dickinson).

Recovery and in vitro maturation of bovine oocytes

Bovine cumulus–oocyte complexes (COCs) were recovered from 2 to 8 mm follicles of slaughterhouse ovaries using 18 gauge needle attached to a vacuum pump. COCs were collected into HEPES-buffered tissue culture medium 199 (H-TCM199) supplemented with 10% FBS. COCs with homogenous cytoplasm and with multiple layer of cumulus cells were selected for maturation and incubated for 20 hours in TCM199 supplemented with 10% FBS, 2.5 mM sodium pyruvate, 10 μg/mL LH, 10 μg/mL FSH, 1 μg/mL estradiol–17β, 0.1 mM cysteamine, 100 ng/mL epidermal growth factor, and 100 ng/mL insulin-like growth factor at 38.5°C, 6% CO₂, and maximum humidity.

SCNT and iSCNT procedure

Procedure of SCNT and iSCNT was carried out using manual oocyte enucleation using a pulled Pasteur pipette (Hosseini et al., 2013). In brief, matured oocytes were denuded by vortexing inside H-TCM199 supplemented with 300 IU/mL hyaluronidase for 3 minutes. For removing zona pellucida, denuded oocytes were exposed to 5 mg/mL pronase for 45 seconds followed by deactivation with H-TCM199 + 20% FBS for 20 minutes. The method of manual oocyte enucleation was used as described previously (Hosseini et al., 2013). Briefly, zona free oocytes were incubated in TCM199 supplemented with 4 μg/mL demecolcine for 1 hour in 38.5°C. Then, cytoplasmic protrusion containing MII spindle was removed by handheld manual oocyte enucleation pipette.

For nuclear transfer, nucleus-free bovine oocytes that have been successfully enucleated were transferred to dishes containing droplets of H-TCM199 supplemented with 10 mg/mL phytohemagglutinin, and well-rounded bovine or buffalo fibroblast cells were attached to membrane of enucleated oocytes. Subsequently, couplets in fusion buffer free of Ca²⁺ and Mg²⁺ (290 mOsm) were electrofused using sinusoidal electric current (7 V/cm) for 10 seconds followed by two direct currents (1.75 kV/cm for 30 μseconds and 1 second delay). After 30 minutes, oocyte activation was induced by incubation of RO with 5 μM ca-ionophore for 5 minutes followed by 4 hours of incubation with 2 mM 6-dimethylaminopurine (6-DAMP).

Subsequently, activated RO were cultured primarily in modified synthetic oviductal fluid (mSOF) for 12 hours (Jafari et al., 2011). Thereafter, RO (in a group of six) were cultured inside well containing 20 μL mSOF under mineral oil without epi-drugs at 38.5°C, 5% CO₂, 5% O₂, and humidified air for 6.5 days.

Semiquantitative assessment of 5-methylcytosine and H3K9me2 in RO using immunocytochemistry

RO were washed in calcium and magnesium free PBS (PBS⁻) containing 0.1 mg/mL polyvinyl alcohol (PBS-PVA) and fixed for 20 minutes in 4% PF. Then permeabilization occurred with 1% Triton X-100 in PBS-PVA for 20 minutes at RT. For incorporation of 5-methylcytidine antibody into DNA, RO were treated with 4 N HCl for 30 minutes at RT and then neutralized for 20 minutes with Tris-HCl buffer (100 mM in pH 8.0). For blocking nonspecific binding sites, RO were incubated in blocking solution (PBS-PVA containing 1% BSA and 10% goat serum) for 2 hours at RT. Incubation of RO with primary and secondary antibodies was conducted according to the protocol explained earlier.

Finally, RO were exposed to Hoechst, and pixel intensity of pseudo-pronucleus was evaluated using ImageJ software (National Institute of Mental Health, Bethesda, MD; Jafarpour et al., 2017). Appropriate controls were included to check the autofluorescence of the first and second antibodies.

Assessment of DNA fragmentation in blastocysts

TUNEL (TdT-mediated dUTP-digoxigenin nick end labeling) test was carried out for determination of DNA fragmentation of blastocysts. In Situ Cell Death Detection Kit (Promega Diagnostic Corporation, Mannheim, Germany) was used according to the manufacturer's instruction. In brief, fixed blastocysts were washed extensively in PBS⁻ and permeabilized using 0.5% (v/v) Triton X-100 for 20 minutes at RT. Blastocysts were incubated in equilibration buffer (EQ) for 10 minutes at RT. Subsequently, blastocysts were incubated in TUNEL reaction mixture (containing: EQ, nucleotide mix, and rTdT enzyme) for 1 hour in dark at 37°C.

After inhibiting the reaction with 2 × SSC buffer for 15 minutes at RT, blastocysts were counterstained for nuclei detection using propidium iodide (PI). Then blastocysts were mounted with coverslips and examined under a fluorescence microscope (Olympus, Tokyo, Japan). Total nuclei were counted by PI. Cells were considered as TUNEL positive if their nuclei showed light green fluorescence against the background of PI.

Gene expression analysis

RNA extraction was carried out using the RNeasy Micro Kit (Cat. No. 74004; QIAGEN). Reverse transcription was immediately performed using a QuantiTect Reverse Transcription (RT) Kit (QIAGEN, Cat. No. 205311). The cDNA was stored at −80°C and analyzed by quantitative RT-polymerase chain reaction (qRT-PCR) using standard conditions. Ct values used for calculating relative expression were normalized against reference gene (B-ACTIN).

Three replicates were conducted for each PCR. ΔΔCT method was used to estimate fold changes between genes of interest following RT-qPCR. The value comparative threshold cycle (CT) denotes the threshold cycle, and ΔCT was calculated as CT of the target gene−CT of reference gene. Fold change in gene expression was calculated using 2^−ΔΔCT, where ΔΔCT was calculated as ΔCT. The primer sequences and annealing temperature are listed in Table 1.

Table 1.

Primers Used for the Quantitative Reverse Transcription-Polymerase Chain Reaction

Gene	Primer sequence (5′-3′)	T_m (°C)
NANOG	F: TGGACTGGTTGGCTCTTATC	62
	R: GCTGAGTTGAAGGAGAAGG
CDX2	F: CACTACAGTCGCTACATCAC	56
	R: TTTCCTTTGCTCTACGGTTC
SOX2	F: CCAAGAGAACCCTAAGATG	54
	R: TGTGTACTTATCCTTCTTCA
OCT4	F: TAAGAAAGGAATTGGGAAC	50
	R: AGAACAAAGTGATGAGTG
TEAD4	F: AAGTGGAGACCGAGTATG	55
	R: GCTTGTGGATGAAGTTGAT
β-ACTIN	F: CCATCGGCAATGAGCGGT	58
	R: CGTGTTGGCGTAGAGGTC

F, forward; R, reverse; T_m, melting temperature.

Experimental design

The less toxic and effective amount of zebularine (20, 30, 40, and 60 μM) and BIX-01294 (1, 2, 3, 4, and 6 μM) for treatment of buffalo–bovine RO were determined using the tests for cell viability and intensity of methylation in fibroblast cells. Next, the effects of exposing RO, for 16 hours after activation, to zebularine (20 μM) and BIX-01294 (2 μM), on the respective level of 5-methylcytosine and H3K9me2, cleavage rates and blastocyst rates, and gene expression (pluripotency genes: OCT4, NANOG, SOX2, and trophectodermal genes: CDX2 and TEAD4) of derived blastocysts were investigated. Moreover, the cleavage rates and blastocyst rates of bovine SCNT RO were considered as control for iSCNT.

Moreover, the effect of zebularine (20 μM) and BIX-01294 (2 μM) on the occurrence of the cleavage at ≤16 (too early), >16–24 (early), and >24–36 (late) hours postactivation was also assessed according to classifications described previously (Dode et al., 2006).

Statistical analysis

The response variables had a discrete nature with a binomial distribution; therefore, all percentage data were subjected to ArcSin transformation. Cell viability, epigenetic level of treated fibroblasts, and developmental rates of several experimental groups were analyzed using one-way ANOVA followed by Tukey multiple comparison post hoc test in SPSS (SPSS, Version 20). Epigenetic level of RO and gene expression in two experimental groups were compared using independent sample t-test. Data were presented as mean ± SEM. p values less than 0.05 were considered as statistically significant.

Results

Effect of zebularine and BIX-01294 on cell viability

Exposure to zebularine at the concentrations of 20, 30, and 40 μM (Fig. 1A) and BIX-01294 at the concentrations of 1, 2, and 3 μM (Fig. 1B), up to 72 hours, did not affect cell viability compared to control (p > 0.05). However, cell viability decreased at 72 hour incubation of cells with zebularine, at 60 μM concentration (Fig. 1A) and at 24–72 hour incubation of cells with BIX-01294 (4 and 6 μM) compared to control (Fig. 1B; p < 0.05). There was no difference in the cell viability between DMSO and control at any time point (p > 0.05).

FIG. 1.

Cell viability of fibroblast buffalo cells exposed to different concentrations of zebularine (A) and BIX-01294 (B) over 72-hour period. ^abDifferent letters indicate significant differences between groups at any time point (p < 0.05).

Epigenetic effects of zebularine and BIX-01294 on buffalo fibroblast cells

Flow cytometry analysis of immunofluorescence staining showed that there was no difference in the level of 5-methylcytosine following exposure of cells to 20, 30, and 40 μM of zebularine compared to control (Fig. 2A; p > 0.05). The relative intensity of H3K9me2 decreased following exposure of cells to 2 and 3 μM compared to 1 μM of BIX-01294 (Fig. 2B; p < 0.05).

FIG. 2.

Relative intensity of 5-methylcytosine (A) and H3K9me2 (B) in buffalo fibroblast cells following exposure to various concentrations of zebularine and BIX-01294, respectively, for 24 hours. ^abDifferent letters indicate significant differences (p < 0.05).

Epigenetic effects of zebularine and BIX-01294 in buffalo–bovine RO

The intensity of 5-methylcytosine and H3K9me2 decreased following exposure of RO to zebularine (20 μM; Figs. 3A and 4A, B) and BIX-01294 (2 μM; Figs. 3B and 4C, D), respectively (p < 0.05).

FIG. 3.

Semiquantitative analysis of fluorescence intensity of 5-methycytosine (A) and H3K9me2 (B) in buffalo–bovine RO exposed to zebularine and BIX-01294 for 16 hours postactivation, respectively. ^abDifferent letters indicate significant differences (p < 0.05). RO, reconstructed oocytes.

FIG. 4.

Semiquantitative analysis of fluorescence intensity of 5-methylcytosine in buffalo–bovine RO exposed to 20 μM zebularine (A: control; B: treated), and fluorescence intensity of H3K9me2 in buffalo–bovine RO exposed to 2 μM BIX-01294 (C: control; D: treated) for 16 hours postactivation, respectively. Scale bar represents 50 μm.

Effect of zebularine and BIX-01294 on early cleavage kinetics and blastocyst rate of iSCNT embryos

Treatment of RO with zebularine and BIX-01294 did not affect the cleavage rates compared to control and bovine SCNT groups (p > 0.05, Table 2). The overall rates of development to blastocyst in zebularine (5.9% ± 1.3%) and BIX-01294 (5.5% ± 1.3%) were similar to their control counterparts (p > 0.05, Table 2). However, blastocyst rates of bovine SCNT group (11.7% ± 3.8%) was significantly higher than that in buffalo–bovine iSCNT controls (4.6% ± 0.9% and 4.3% ± 1.1%; p < 0.05), but was not different from zebularine and BIX-01294 treated embryos (p > 0.05; Table 2).

Table 2.

Development of Buffalo–Bovine Interspecies Somatic Cell Nuclear Transfer Embryos After Exposing Reconstructed Oocytes to Zebularine (20 μM) or BIX-01294 (2 μM)

Groups	RO, n	Cleaved oocytes	Blastocysts
Control-iSCNT	590	458 (86.8 ± 1.6)^a	21 (4.6 ± 0.9)^a
Zebularine-iSCNT	579	443 (86.1 ± 1.2)^a	26 (5.9 ± 1.3)^ab
Control-iSCNT	484	376 (86.2 ± 1.9)^a	16 (4.3 ± 1.1)^a
BIX-01294-iSCNT	489	379 (85.4 ± 1.3)^a	21 (5.5 ± 1.3)^ab
Bovine-SCNT	101	77 (83.5 ± 2.1)^a	9 (11.7 ± 3.8)^b

Data are presented as number (percentage ± SEM).

Different letters within each column indicate significant difference (p < 0.05).

iSCNT, interspecies somatic cell nuclear transfer; RO, reconstructed oocytes.

The incidence of cleavage at ≤16 hours postactivation (too early cleavage) was greater in RO exposed to zebularine (26.2% ± 2.1%; 22/84) compared to control (10.6% ± 3.4%, 9/85; Fig. 5A; p < 0.05). Such difference in cleavage rates was not observed between BIX-01294 treated oocytes (11.5% ± 2.1%; 9/78) and its control (19% ± 4.7%; 12/63; Fig. 5C). Too early cleaved RO exposed to zebularine did not produce any blastocyst compared to control (22.2% ± 6.3%, 2/9; p < 0.05; Fig. 5B). There was no difference in blastocyst rates between too early cleaved RO exposed to BIX-01294 (11.1% ± 1.4%; 1/9) and its control (8.3% ± 1.8%; 1/12; Fig. 5D).

FIG. 5.

Cleavage and blastocyst rates of buffalo–bovine RO that cleaved at different hours postactivation (hpa) in control, zebularine (A, B), and BIX-01294 (C, D) treated groups (<16 hpa: too early cleavage, 16–24 hpa: early cleavage, and 24–36 hpa late cleavage). ^abDifferent letters indicate significant differences (p < 0.05).

Effect of zebularine and BIX-01294 on DNA apoptosis

The percentage of TUNEL-positive cells was 7.34% ± 1.48%, 8.72% ± 1.83%, and 8.46% ± 1.39% in the control, zebularine, and BIX-01294 groups, respectively (Fig. 6). The difference between groups was not statistically significant (p > 0.05).

FIG. 6.

DNA fragmentation assessed by TUNEL Kit in different treatment groups.

Effect of zebularine and BIX-01294 on expression of pluripotent and trophectodermal genes

The expression of NANOG, SOX2, and TEAD4 genes was not affected by zebularine and BIX-01294 compared with their controls (p > 0.05; Fig. 7A, B). However, CDX2 and OCT4 expressions in BIX-01294 and CDX2 expression in zebularine group were significantly higher than that for their controls.

FIG. 7.

Real-time reverse-transcriptase polymerase chain reaction gene expression analysis in blastocysts derived from zebularine (A) and BIX-01294 (B) compared to control. ^abDifferent letters indicate significant differences (p < 0.05).

Discussion

The main objective of this study was to investigate the effect of two epigenetic modifiers, zebularine (DNMTis) and BIX-01294 (HMTi), on developmental competence of buffalo–bovine iSCNT embryos. To achieve such goal, we have initially conducted the dose–response studies on buffalo fibroblast cells to find out the less toxic and effective dose of these two epigenetic modifiers for further research on RO. Incubation of fibroblast cells with varying concentrations of zebularine (20, 30, 40, and 60 μM) revealed that zebularine at these concentrations had no adverse effect on cell viability. This wide range of nontoxicity illustrated good marginal safety of zebularine to be used as epigenetic modifier compared to other DNMTis (Cheng et al., 2003).

In addition, the effect of nontoxic doses of zebularine (20, 30, and 40 μM) on DNA methylation was investigated evaluating the intensity of 5-methylcytosine on buffalo fibroblast cells. Although there was slight decrease in DNA methylation of fibroblast treated cells using different doses of zebularine (p > 0.05), particularly at the concentration of 20 μM (12% decrease in DNA methylation compared to control), it did not differ with control (p > 0.05). Xiong et al. (2013) found a significant decrease in DNMT1 in zebularine (20 mM) treated fibroblast. Similarly, zebularine could decrease the level of genomic DNA methylation in TK6 cells (Stresemann et al., 2006).

A remarkable finding is that while 20 μM zebularine decreased level of 5-methylcytosine by 12% compared to untreated group, treated cells with 30 and 40 μM zebularine had similar level of 5-methylcytosine compared to their corresponding control. Part of such result lies on the ground that zebularine was dissolved in DMSO, and concentration of DMSO in cells treated with 30 and 40 μM was 0.75 and 1%, respectively, which was beyond the marginal safety level of DMSO. DMSO could upregulate the expression of DNMT3A and altered genome-wide DNA methylation profiles in mouse embryoid bodies (Iwatani et al., 2006).

Although there is no report on epigenetic effect of DMSO on somatic cells and only one report on embryo (Alsalim et al., 2019), some researchers have proposed that any remnant of DMSO in embryo preservation media may affect the epigenetic status of oocytes and embryos (Gutierrez et al., 2017; Liang et al., 2014; Matsumura et al., 2013; McEwen et al., 2013).

Therefore, 20 μM zebularine dissolved in less concentration of DMSO (0.5%) was selected in order not to disturb the epigenetic effect of zebularine. One of the shortcomings of this study was the limited access to bovine oocytes for identifying the optimum concentration of epigenetic drugs in RO. Therefore, based on the effect of these drugs on somatic donor cells and also previous studies (Fu et al., 2012; Xiong et al., 2013), the concentration was selected and used for treating RO.

In the present study, varying concentrations of BIX-01294 (1, 2, 3, 4, and 6 μM) had different effects on cell viability using MTS assay and histone dimethylation measuring H3K9me2. Exposure of fibroblast cells to 2 and 3 μM BIX-01294 did not affect cell viability and reduced the level of H3K9me2. Accordingly, BIX-01294 at the concentration of 2 μM was selected as the less toxic and effective dose for the remaining experiments. Similar effect of BIX-01294 on fibroblast cells, using different concentrations, was demonstrated in previous studies (Cao et al., 2017, 1 μM; Chen et al., 2015, 1.3 μM; Fu et al., 2012, 1 μM; Huang et al., 2016, 50 nM; Huang et al., 2017, 0.1 μM; Kubicek et al., 2007, 4.1 μM; ).

Treatment of RO for 16 hours after activation with 20 μM zebularine and with 2 μM BIX-01294 significantly decreased the level of 5-methylcytosine and H3K9me2, respectively. Following treatment with BIX-01294, there was significant decrease in the intensity of H3K9me2 in one-cell stage cloned mice embryos (Terashita et al., 2013) and two-cell porcine SCNT embryos (Cao et al., 2017; Huang et al., 2016). To the best of our knowledge, this is the first report on the effect of zebularine and BIX-01294 on decreasing methylation in RO.

Interestingly, there was a difference in the level of DNA methylation between fibroblast cells (12%; p > 0.05) and RO (46%; p < 0.05) following exposure to zebularine compared with control. Similarly, the level of histone dimethylation decreased by 32% (p > 0.05) in fibroblast cells and 48% (p < 0.05) in RO compared to control. Oocyte has many known and unknown epigenetic reprogramming factors incorporating in the new established zygote following fertilization (Beaujean et al., 2004; Morgan et al., 2005). Synergistic effects of reprogramming factors within oocytes and zebularine or BIX-01294 may explain the difference between fibroblast cells and RO.

In the present study, too early cleavage rates (≤16 postactivation) were significantly greater in zebularine, but not in BIX-01264, treated RO compared to control. However, the blastocyst rates of zebularine treated oocytes decreased significantly compared to control. Interestingly, in all experimental groups (control, zebularine, and BIX-01294), oocytes that cleaved early (between 16 to 24 hours after activation) produced more blastocysts compared to those cleaved too early. Late cleavage of RO (24 to 36 hours postactivation), regardless of experimental groups, did not produce any blastocyst.

To the best of our knowledge this is the first report on the effect of time of cleavage and blastocyst rates in iSCNT RO. Previous studies on in vitro produced embryos indicated a clear relationship between time of cleavage and developmental competence of oocyte (Dinnyes et al., 1999; Lequarre et al., 2003; Lonergan et al., 1999). Accordingly, too early and too late cleavages have lower competence for further development (Dinnyes et al., 1999). In accordance with our results, it has been reported that too early cleaved oocytes (<24-hour postinsemination) had less capability for further development compared with those oocytes which were cleaved after 24-hour postinsemination (Dode et al., 2006). They also revealed that early cleaved oocytes (24–32 hour postinsemination) had higher developmental competence compared with intermediate (32–36 hour postinsemination) and late cleaved (36–44 hour postinsemination) groups which is also consistent with our results.

In the later study, 16 genes were analyzed in early and late cleaved oocytes. Accordingly, isocitrate dehydrogenase (IDH), YY1- E4TF1/hGABP-associated factor-1 (YEAF1), and histone 2A (H2A) had significantly higher expression in early cleaved than late cleaved oocytes (Dode et al., 2006). The possibility that zebularine effect on too early cleavage of RO could be through triggering the aforementioned genes remained to be investigated.

Treatment of RO with zebularine and BIX-01294 did not lead to higher blastocyst formation compared to iSCNT controls. One possible explanation for this observation is mitochondrial heteroplasmy which may be considered as a more important obstacle than epigenetic barriers during iSCNT procedure. Heteroplasmy in mitochondrial DNA of iSCNT embryos has been reported previously (Imsoonthornruksa et al., 2012; Srirattana et al., 2011). Mitochondrial heteroplasmy may create conflict between mitochondrial and nuclear elements leading to disruption of mitochondrial biogenesis and decrease in blastocyst rates in iSCNT (Mastromonaco and King, 2007).

In the present study, the blastocyst rate of bovine SCNT reached 11.7%. Previously, this figure was reported to be 11.9% (Lu et al., 2005), 12.4% (Ding et al., 2008), 34% (Jafari et al., 2011), and 31% (Sangalli et al., 2014). Several factors affected the outcomes of the blastocyst rates in SCNT technique (Lu et al., 2011; Selokar et al., 2012). There was significant difference between buffalo–bovine iSCNT controls and bovine SCNT controls in the present study. However, following addition of epigenetic modifiers (zebularine or BIX-01294), there was slight improvement in blastocyst rates of iSCNT embryos, indicating possible benefit following the addition of epigenetic modifiers for improving developmental competence of RO. Further research is warranted to elucidate such effects.

To determine the side effects of zebularine and BIX-01294, we investigated their effects on apoptosis of derived blastocysts. Our results indicated that although some researchers reported increased DNA fragmentation in treated cells, we did not observe elevated level of apoptotic cells in treated groups compared with control group, which indicates the safe concentration of these drugs on embryos.

In the present study, BIX-01294 improved the expression of OCT4 but did not have any significant effect on NANOG and SOX2 in iSCNT buffalo–bovine embryos compared to control. Similar result was achieved in porcine (Huang et al., 2016) but not in mice (Huang et al., 2017) SCNT blastocyst. The pluripotency gene OCT4 is one of the most important genes in reprogramming, and its expression is essential to induce pluripotency in somatic cells (Takahashi and Yamanaka, 2006). OCT4 has great role in survival of primordial germ cells (Kehler et al., 2004), inner cell mass formation (Pesce and Scholer, 2001), and self-renewal of embryonic stem cells (Niwa et al., 2005). Previously, it was shown that OCT4 undergoes postimplantation silencing in a process mediated by G9a (Feldman et al., 2006).

The present study revealed that BIX-01294, an inhibitor of G9a, could enhance OCT4 expression. OCT4, NANOG, and SOX2 are important genes for preimplantation development of bovine (Pant and Keefer, 2009) and bubaline (Yadav et al., 2011) embryos. It is speculated that for interspecies buffalo–bovine iSCNT embryos, the presence of these genes could be essential. Therefore, further studies are required to find alternative epigenetic modifiers to enhance expression of these genes in buffalo–bovine iSCNT embryos. According to the result of the present study, there was no effect of zebularine on any pluripotent genes, including OCT4, NANOG, and SOX2. Previous study has shown positive effect of zebularine on the expression of OCT4 in yak cloned embryo (Xiong et al., 2013).

Both zebularine and BIX-01294 improved expression of trophectodermal gene CDX2. OCT-4 and CDX2 are essential for early development and gene expression involved in the differentiation of inner cell mass and trophectoderm lineages in bovine embryos (Sakurai et al., 2016). CDX2 is essential for segregation of inner cell mass and trophectoderm lineages at blastocyst stage by ensuring repression of OCT4 and NANOG in trophectoderm (Strumpf et al., 2005). CDX2 is dispensable for trophectoderm differentiation induced by OCT3/4 repression, but essential for trophectoderm cell self-renewal (Niwa et al., 2005).

In conclusion, treatment of buffalo–bovine iSCNT RO with zebularine (20 μM) and BIX-01294 (2 μM) could have some beneficial effects on epigenetic reprogramming and improving quality of derived iSCNT embryos in terms of expression of pluripotent and trophectodermal factors. Although these treatments did not improve developmental competence of RO, further studies are required to elucidate whether the improvement in the quality of derived blastocysts might also enhance postimplantation development.

Footnotes

Acknowledgments

The authors express their gratitude to the Government of Iraq, Ministry of Higher Education and Scientific Research for financial support and Royan Institute and Deputy for Research at University of Tehran for their full support.

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

Alsalim

H.A.

, Jafarpour

, Ghazvini Zadegan

, Nasr-Esfahani

M.H.

, and Niasari-Naslaji

(2019). Epigenotoxic effect of dimethyl sulfoxide on buffalo somatic cells and buffalo-bovine interspecies somatic cell nuclear transfer embryos. Cell J. 20, 544–551.

Beaujean

, Hartshorne

, Cavilla

, Taylor

, Gardner

, Wilmut

, Meehan

, and Young

(2004). Non-conservation of mammalian preimplantation methylation dynamics. Curr. Biol., 14, 266–267.

Cao

, Hong

, Ding

, Zuo

, Li

, Ding

, Li

, Huang

, and Zhang

(2017). TSA and BIX-01294 induced normal DNA and histone methylation and increased protein expression in porcine somatic cell nuclear transfer embryos. PLoS One, 12, e0169092.

Chen

, Yao

J.F.

, Huang

R.F.

, Zheng

F.F.

, Jiang

X.H.

, Chen

, Li

, Huang

H.F.

, Jiang

Y.P.

, Huang

Y.F.

, and Yang

X.Y.

(2015). Effect of BIX-01294 on H3K9me2 levels and the imprinted gene Snrpn in mouse embryonic fibroblast cells. Biosci. Rep., 35, e00257.

Cheng

J.C.

, Matsen

C.B.

, Gonzales

F.A.

, Ye

, Greer

, Marquez

V.E.

, Jones

P.A.

, and Selker

E.U.

(2003). Inhibition of DNA methylation and reactivation of silenced genes by zebularine. J. Natl. Cancer Inst., 95, 399–409.

Daniels

, Hall

, and Trounson

A.O.

(2000). Analysis of gene transcription in bovine nuclear transfer embryos reconstructed with granulosa cell nuclei. Biol. Reprod., 63, 1034–1040.

Diao

Y.F.

, Naruse

K.J.

, Han

R.X.

, Li

X.X.

, Oqani

R.K.

, Lin

, and Jin

D.I.

(2013). Treatment of fetal fibroblasts with DNA methylation inhibitors and/or histone deacetylase inhibitors improves the development of porcine nuclear transfer-derived embryos. Anim. Reprod. Sci., 141, 164–171.

Ding

, Wang

, Zhang

, Guo

, and Zhang

(2008). Increased pre-implantation development of cloned bovine embryos treated with 5-aza-2′-deoxycytidine and trichostatin A. Theriogenology, 70, 622–630.

Dinnyes

, Lonergan

, Fair

, Boland

M.P.

, and Yang

(1999). Timing of the first cleavage post-insemination affects cryosurvival of in vitro–produced bovine blastocysts. Mol. Reprod. Dev., 53, 318–324.

10.

Dode

M.A.N.

, Dufort

, Massicotte

, and Sirard

M.A.

(2006). Quantitative expression of candidate genes for developmental competence in bovine two-cell embryos. Mol. Reprod. Dev., 73, 288–297.

11.

Drost

(2007). Bubaline versus bovine reproduction. Theriogenology, 68, 447–449.

12.

Feldman

, Gerson

, Fang

, Li

, Zhang

, Shinkai

, Cedar

, and Bergman

(2006). G9a-mediated irreversible epigenetic inactivation of Oct-3/4 during early embryogenesis. Nat. Cell Biol., 8, 188–194.

13.

Feng

, Ng

J.H.

, Heng

J.C.D.

, and Ng

H.H.

(2009). Molecules that promote or enhance reprogramming of somatic cells to induced pluripotent stem cells. Cell Stem Cell, 4, 301–312.

14.

, Zhang

, Yan

F.X.

, Guan

, An

X.R.

, and Hou

(2012). Abnormal histone H3K9 dimethylation but normal dimethyltransferase EHMT2 expression in cloned sheep embryos. Theriogenology, 78, 1929–1938.

15.

Gasparrini

(2002). In vitro embryo production in buffalo species: State of the art. Theriogenology, 57, 237–256.

16.

Gutierrez

E.J.

, Diaz

F.A.

, Foster

B.A.

, Hardin

P.T.

, and Bondioli

K.R.

(2017). Effect of dimethyl sulfoxide or glycerol-based vitrification protocols on the DNA methylation of bovine cumulus-oocyte complexes. Reprod. Fert. Dev., 29, 131.

17.

Han

Y.M.

, Kang

Y.K.

, Koo

D.B.

, and Lee

K.K.

(2003). Nuclear reprogramming of cloned embryos produced in vitro. Theriogenology, 59, 33–44.

18.

Hosseini

S.M.

, Hajian

, Moulavi

, Asgari

, Forouzanfar

, and Nasr-Esfahani

M.H.

(2013). Cloned sheep blastocysts derived from oocytes enucleated manually using a pulled pasteur pipette. Cell. Reprogram., 15, 15–23.

19.

Hosseini

S.M.

, Hajian

, Ostadhosseini

, Forouzanfar

, Abedi

, Jafarpour

, Gourabi

, Shahverdi

A.H.

, Vosough

, Ghanaie

H.R.

, and Nasr-Esfahani

M.H.

(2015). Contrasting effects of G1.2/G2.2 and SOF1/SOF2 embryo culture media on pre- and post-implantation development of non-transgenic and transgenic cloned goat embryos. Reprod. Biomed. Online., 31, 372–383.

20.

Hosseini

S.M.

, Moulavi

, Foruzanfar

, Hajian

, Abedi

, Rezazade-Valojerdi

, Parivard

, Shahverdia

A.H.

, and Nasr-Esfahani

M.H.

(2008). Effect of donor cell type and gender on the efficiency of in vitro sheep somatic cell cloning. Small Rum. Res., 78, 162–168.

21.

Huang

, Zhang

, Yao

, Qin

, Wang

, Luo

, Zheng

, Cao

, and Zhao

(2016). BIX-01294 increases pig cloning efficiency by improving epigenetic reprogramming of somatic cell nuclei. Reproduction, 151, 39–49.

22.

Huang

, Jiang

, Yu

, Huang

, Yao

, Li

, Zheng

, and Yang

(2017). Beneficial effects of diazepin-quinazolin-amine derivative (BIX-01294) on preimplantation development and molecular characteristics of cloned mouse embryos. Reprod. Fertil. Dev., 29, 1260–1269.

23.

Imsoonthornruksa

, Srirattana

, Phewsoi

, Tunwattana

, Parnpai

, and Ketudat-Cairns

(2012). Segregation of donor cell mitochondrial DNA in gaur—Bovine interspecies somatic cell nuclear transfer embryos, fetuses and an offspring. Mitochondrion, 12, 506–513.

24.

Iwatani

, Ikegami

, Kremenska

, Hattori

, Tanaka

, Yagi

, and Shiota

(2006). Dimethyl sulfoxide has an impact on epigenetic profile in mouse embryoid body. Stem Cells, 24, 2549–2556.

25.

Jafari

, Hosseini

M.S.

, Hajian

, Forouzanfar

, Jafarpour

, Abedi

, Ostadhosseini

, Abbasi

, Gourabi

, Shahverdi

A.H.

, Dizaj

A.V.

, Anjomshoaa

, Haron

, Noorshariza

, Yakub

, and Nasr-Esfahani

M.H.

(2011). Improved in vitro development of cloned bovine embryos using S-adenosylhomocysteine, a non-toxic epigenetic modifying reagent. Mol. Reprod. Dev., 78, 576–584.

26.

Jafarpour

, Hosseini

S.M.

, Hajian

, Forouzanfar

, Ostadhosseini

, Abedi

, Gholami

, Ghaedi

, Gourabi

, Shahverdi

A.H.

, Vosough

A.V.

, and Nasr-Esfahani

M.H.

(2011). Somatic cell-induced hyperacetylation, but not hypomethylation, positively and reversibly affects the efficiency of in vitro cloned blastocyst production in cattle. Cell. Reprogram., 13, 483–493.

27.

Jafarpour

, Hosseini

S.M.

, Ostadhosseini

, Abbasi

, Dalman

, and Nasr-Esfahani

M.H.

(2017). Comparative dynamics of 5-methylcytosine reprogramming and TET family expression during preimplantation mammalian development in mouse and sheep. Theriogenology, 89, 86–96.

28.

Kehler

, Tolkunova

, Koschorz

, Pesce

, Gentile

, Boiani

, Lomeli

, Nagy

, McLaughlin

K.J.

, Scholer

H.R.

, and Tomilin

(2004). Oct4 is required for primordial germ cell survival. EMBO Rep. 5, 1078–1083.

29.

Kitiyanant

, Saikhun

, Chaisalee

, White

K.L.

, and Pavasuthipaisit

(2001). Somatic cell cloning in Buffalo (Bubalus bubalis): Effects of interspecies cytoplasmic recipients and activation procedures. Cloning Stem Cells, 3, 97–104.

30.

Kubicek

, O'Sullivan

R.J.

, August

E.M.

, Hickey

E.R.

, Zhang

, Teodoro

M.L.

, Rea

, Mechtler

, Kowalski

J.A.

, Homon

C.A.

, Kelly

T.A.

, and Jenuwein

(2007). Reversal of H3K9me2 by a small-molecule inhibitor for the G9a histone methyltransferase. Mol. Cell, 25, 473–481.

31.

Lequarre

A.S.

, Marchandise

, Moreau

, Massip

, and Donnay

(2003). Cell cycle duration at the time of maternal zygotic transition for in vitro produced bovine embryos: Effect of oxygen tension and transcription inhibition. Biol. Reprod., 69, 1707–1713.

32.

Liang

, Fu

X.W.

, Li

J.J.

, Yuan

D.S.

, and Zhu

S.E.

(2014). DNA methylation pattern in mouse oocytes and their in vitro fertilized early embryos: Effect of oocyte vitrification. Zygote, 22, 138–145.

33.

Lonergan

, Khatir

, Piumi

, Rieger

, Humblot

, and Boland

M.P.

(1999). Effect of time interval from insemination to first cleavage on the developmental characteristics, sex ratio and pregnancy rate after transfer of bovine embryos. J. Reprod. Fertil., 117, 159–167.

34.

, Jiang

, Li

, Zhang

, Sun

, Luo

, Wei

, and Shi

(2011). Effects of recipient oocyte age and interval from fusion to activation on development of buffalo (Bubalus bubalis) nuclear transfer embryos derived from fetal fibroblasts. Theriogenology, 76, 967–974.

35.

, Shi

, Wei

, Yang

, and Wei

(2005). Development of embryos reconstructed by interspecies nuclear transfer of adult fibroblasts between buffalo (Bubalus bubalis) and cattle (Bos indicus). Theriogenology, 64, 1309–1319.

36.

Mastromonaco

G.F.

, and King

W.A.

(2007). Cloning in companion animal, non-domestic and endangered species: Can the technology become a practical reality?. Reprod. Fert. Dev., 19, 748–761.

37.

Matsumura

, Hayashi

, Nagashima

, and Hyon

S.H.

(2013). Long-term cryopreservation of human mesenchymal stem cells using carboxylated poly-l-lysine without the addition of proteins or dimethyl sulfoxide. J. Biomater. Sci. Polym. Ed., 24, 1484–1497.

38.

McEwen

K.R.

, Leitch

H.G.

, Amouroux

, and Hajkova

(2013). The impact of culture on epigenetic properties of pluripotent stem cells and pre-implantation embryos. Biochem. Soc. Trans., 41, 711–719.

39.

Morgan

H.D.

, Santos

, Green

, Dean

, and Reik

(2005). Epigenetic reprogramming in mammals. Hum. Mol. Genet., 14, 47–58.

40.

Niwa

, Toyooka

, Shimosato

, Strumpf

, Takahashi

, Yagi

, and Rossant

(2005). Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell, 123, 917–929.

41.

Pant

, and Keefer

C.L.

(2009). Expression of pluripotency-related genes during bovine inner cell mass explant culture. Cloning Stem cells, 11, 355–365.

42.

Pesce

, and Scholer

H.R.

(2001). Oct-4: Gatekeeper in the beginnings of mammalian development. Stem Cells, 19, 271–278.

43.

Rideout

W.M.

, Eggan

, and Jaenisch

(2001). Nuclear cloning and epigenetic reprogramming of the genome. Science, 29, 1093–1098.

44.

Saikhun

, Pavasuthipaisit

, Jaruansuwan

, and Kitiyanant

(2002). Xenonuclear transplantation of buffalo (Bubalus bubalis) fetal and adult somatic cell nuclei into bovine (Bos indicus) oocyte cytoplasm and their subsequent development. Theriogenology, 57, 1829–1837.

45.

Sakurai

, Takahashi

, Emura

, Fujii

, Hirayama

, Kageyama

, Hashizume

, and Sawai

(2016). The necessity of OCT-4 and CDX2 for early development and gene expression involved in differentiation of inner cell mass and trophectoderm lineages in bovine embryos. Cell. Reprogram., 18, 309–318.

46.

Sangalli

J.R.

, Chiaratti

M.R.

, De Bem

T.H.C.

, de Araujo

R.R.

, Bressan

F.F.

, Sampaio

R.V.

, Perecin

, Smith

L.C.

, King

W.A.

, and Meirelles

F.V.

(2014). Development to term of cloned cattle derived from donor cells treated with valproic acid. PLoS One, 9, e101022.

47.

Santos

, and Dean

(2004). Epigenetic reprogramming during early development in mammals. Reproduction, 127, 643–651.

48.

Selokar

N.L.

, Shah

R.A.

, Saha

A.P.

, Muzaffar

, Saini

, Chauhan

M.S.

, Manik

R.S.

, Palta

, and Singla

S.K.

(2012). Effect of post-fusion holding time, orientation and position of somatic cell-cytoplasts during electrofusion on the development of handmade cloned embryos in buffalo (Bubalus bubalis). Theriogenology, 78, 930–936.

49.

Shi

, Lu

, Wei

, Cui

, Yang

, Wei

, and Liu

(2007). Buffalos (Bubalus bubalis) cloned by nuclear transfer of somatic cells. Biol. Reprod., 77, 285–291.

50.

Shi

, Desponts

, Do

J.T.

, Hahm

H.S.

, Schöler

H.R.

, and Ding

(2008). Induction of pluripotent stem cells from mouse embryonic fibroblasts by OCT4 and Klf4 with small-molecule compounds. Cell Stem Cell, 3, 568–574.

51.

Singh

, Nanda

A.S.

, and Adams

G.P.

(2000). The reproductive pattern and efficiency of female buffaloes. Anim. Reprod. Sci., 60, 593–604.

52.

Srirattana

, Matsukawa

, Akagi

, Tasai

, Tagami

, Nirasawa

, Nagai

, Kanai

, Parnpai

, and Takeda

(2011). Constant transmission of mitochondrial DNA in intergeneric cloned embryos reconstructed from swamp buffalo fibroblasts and bovine ooplasm. Anim. Sci. J., 82, 236–243.

53.

Stresemann

, Brueckner

, Musch

, Stopper

, and Lyko

(2006). Functional diversity of DNA methyltransferase inhibitors in human cancer cell lines. Cancer Res. 66, 2794–2800.

54.

Strumpf

, Mao

C.A.

, Yamanaka

, Ralston

, Chawengsaksophak

, Beck

, and Rossant

(2005). Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development, 132, 2093–2102.

55.

Takahashi

, and Yamanaka

(2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126, 663–676.

56.

Terashita

, Yamagata

, Tokoro

, Itoi

, Wakayama

, Li

, Tanemura

, and Wakayama

(2013). Latrunculin A treatment prevents abnormal chromosome segregation for successful development of cloned embryos. PLoS One, 8, e78380.

57.

Wilmut

, Schnieke

A.E.

, McWhir

, Kind

A.J.

, and Campbell

K.H.

(1997). Viable offspring derived from fetal and adult mammalian cells. Nature, 385, 810–813.

58.

Xiong

, Lan

, Li

, Zhong

, Zi

, Ma

, and Wang

(2013). Zebularine and scriptaid significantly improve epigenetic reprogramming of yak fibroblasts and cloning efficiency. Cell. Reprogram., 15, 293–300.

59.

Yadav

P.S.

, Mann

, Singh

, Yashveer

, Sharma

R.K.

, and Singh

(2011). Expression of pluripotency genes in buffalo (Bubalus bubalis) amniotic fluid cells. Reprod. Domest. Anim., 46, 705–711.