Induction of Human Adipose-Derived Mesenchymal Stem Cells into Germ Lineage Using Retinoic Acid

Abstract

Accumulating evidence indicates that mesenchymal stem cells (MSCs) have been widely used in tissue engineering and regenerative medicine due to their multilineage differentiation potentials. Recent studies show that germ-like cells can also be derived from stem cells, such as human umbilical cord MSCs and human bone marrow MSCs in vitro. However, whether human adipose-derived MSCs (hAD-MSCs) can be induced into germ-like cells has never been reported. In this study, we isolated hAD-MSCs and confirmed that their characteristics were in accordance with that of MSCs established before. Germ cell lineage differentiation was performed by 10 μM retinoic acid (RA) treatment for 21 days. RA induction led to slender spindles and tadpole-like changes of cell morphology, and the expression of germ cell-specific markers (Oct4, Piwil2, Itgb1, SSEA-1, and Stra8) presented significant upregulation in the RA treatment group according to the polymerase chain reaction and immunofluorescence results. We first demonstrated that hAD-MSCs can differentiate into germ-like cells in vitro, which will provide theoretical and experimental basis for the clinical application of hAD-MSCs in the treatment for infertility.

Introduction

World Health Organization (WHO) has stated that infertility affects 10%–15% of couples and about half of the cases are due to male factors (Afsartala et al., 2016). It has seriously affected people's lives as well as the economic development. In recent years, several studies have shown that germ cells can be produced in vitro from stem cells, such as human bone marrow mesenchymal stem cells (hBM-MSCs), human umbilical cord MSCs (hUC-MSCs), and embryonic stem cells (ESCs) (Geijsen et al., 2004; Li et al., 2014; Nayernia et al., 2006a). However, bone marrow aspiration from a donor is invasive and the differentiation potential of BM-MSCs decreases with increasing donor age. The clinical application of ESC and hUC-MSC is restricted by its limited source and ethical issues (Hyun, 2010). Thus, many scientists are engaged in the eternal search for alternative sources of MSCs.

It has been reported that human adipose-derived MSCs (hAD-MSCs) possess pluripotent characteristics for indefinite proliferation and they can differentiate into multiple cell types, including osteoblasts, chondrocytes, neural cells, and cardiomyocytes (Witkowska-Zimny and Walenko, 2011). Different from other sources of stem cells, hAD-MSCs is abundant, easily harvested from adipose tissue, and can be expanded rapidly in vitro (Hauner, 2004). However, whether hAD-MSCs could differentiate into germ cells (GCs) by retinoic acid (RA) treatment still remains undetermined.

In this study, we isolated MSCs from adipose tissue and investigated the characteristics of hAD-MSCs. The main point of this study is that hAD-MSCs can be induced by RA to express germ cells markers, which can help to understand germ cell differentiation from stem cells and will bring benefits to infertility families.

Materials and Methods

Isolation and expansion of hAD-MSCs

Human adipose tissue from three healthy donors 24–32 years of age was obtained from liposuction surgery with an informed written consent. All the studies were approved by the Ethics Committees of the hospitals and the Institutional Review Board of Jining Medical University and carried out in accordance with their approved guidelines. hAD-MSCs were isolated as previously described (Hauner, 2004). Briefly, adipose tissues was washed in sterile phosphate-buffered saline (PBS) at least once and digested by 0.1% collagenase type I (Gibco) for 30 minutes at 37°C with agitation. After centrifugation (1000 g for 15 minutes), the liquid was separated and the cellular pellet appeared at the bottom of the liquid layer. Then the cell suspension was filtered through a nylon mesh with a pore size of 100 μm.

Pellets were washed three times in PBS and were resuspended in DMEM/F-12 (Hyclone) medium supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco). Cells were incubated at 37°C in a humidified atmosphere containing 5% CO₂. The medium was changed every 3–4 days. When cells reached 80%–90% confluences, they were harvested using 0.25% trypsin-EDTA (Gibco) and dispensed at a ratio of 1:3 into new culture flasks.

Evaluation of cell surface markers

hAD-MSCs were harvested at passage 3. The cells were detached by trypsinization, rinsed twice with PBS, and resuspended in 100 μL PBS at a concentration of about 1 × 10⁵ cells. Collected cells were incubated with CD73-FITC (fluorescein isothiocyanate), CD34-PE (phycoerythrin), CD105-PerCP (peridinin chlorophyll protein), HLA-DR-FITC, CD90-PE, and CD45-PerCP monoclonal antibodies (BioLegend) for 15 minutes in the dark. After staining, the cells were washed with 1 mL PBS, resuspended in 300 μL PBS, and analyzed by flow cytometry (BD Biosciences). The mouse IgG1-isotype was used as a negative control.

Osteogenic and adipogenic differentiation

Osteogenic induction: The hAD-MSCs of passage 3 were plated in six-well plates at a density of 1 × 10⁵ cells/cm² and cultured with H-DMEM (Gibco) induction medium containing 10% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, 10 nM dexamethasone (Sigma), 50 mol/L ascorbic acid (Sigma), and 10 mmol/L β-glycerophosphate (Sigma). Cells cultured in complete H-DMEM medium without induction agents were taken as control. The medium was changed every 3 days.

After 21 days, the cells were washed twice with PBS, fixed with 4% paraformaldehyde for 20 minutes and stained with Alizarin Red (Sigma) to detect the presence of calcium deposition in osteocytes. Adipogenic induction. The hAD-MSCs of passage 3 were plated in six-well plates at a density of 1 × 10⁵ cells/cm² and cultured with H-DMEM (Gibco) induction medium containing 10% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, 1 μmol/L dexamethasone, 0.2 mmol/L indomethacin (Sigma), 10 g/mL insulin (Sigma), and 0.5 mmol/L 3-isobutyl-1-methylxanthine (Sigma). Cells cultured in complete H-DMEM medium without induction agents were taken as control. The medium was replaced every 3 days for 14 days. At 14 days of induction, the cells were washed twice with PBS, fixed with 4% paraformaldehyde for 20 minutes, and stained with Oil Red O (Sigma) to detect the presence of neutral lipid vacuoles in adipocytes.

Induction of germ cells from hAD-MSCs

hAD-MSCs of passage 3 were cultured in H-DMEM induction medium containing 10% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, and 10 μM RA (Sigma). The medium was replaced every 3 days. After 21 days of RA induction, cell morphology and GC-specific markers were evaluated by immunocytochemistry and polymerase chain reaction (PCR).

Reverse transcription–PCR and quantitative RT-PCR

Expression of germ cell specific genes was detected by reverse transcription (RT)–PCR. Moreover, quantitative RT-PCR (qRT-PCR) was used to verify expression changes of GC-specific markers. Total RNA was extracted from cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. For RT-PCR analysis, 1 μg of total RNA was reverse transcribed into complementary DNA (cDNA) using the RevertAid™ First-Strand cDNA Synthesis Kit (Thermo Scientific, Bremen, Germany) according to the manufacturer's instructions.

The PCR mixture contained 1 μL cDNA, 0.4 μL forward primer, and reverse primer, respectively, 10 μL 2 × Taq PCR Master Mix (Tiangen) in a total volume of 20 μL with distilled water. The PCR conditions were 5 minutes at 95°C, then 45 cycles of 95°C for 30 seconds, 60°C–65°C for 30 seconds, 72°C for 30 seconds, and a final extension for 10 minutes at 72°C. The expression of GC-specific genes was detected by qRT-PCR using an Applied Biosystems 7500 Real-time PCR System and SYBR Green Master Mix (TransGen Biotech). All the primers used in this study are listed in Table 1.

Table 1.

Primers Used for Reverse Transcription–Polymerase Chain Reaction and Quantitative Reverse Transcription–Polymerase Chain Reaction

Gene	Ref. seq. accession	Forward primer	Reverse primer	Fragment size (bp)
Oct4	NM_002701.5	CTGGGTTGATCCTCGGACCT	CCATCGGAGTTGCTCTCCA	243
Piwil2	NM_001135721.2	AGCAGGTGGTATCAGCAGAGA	TGTATTTTGACGAGGTTCAGTCC	225
ITGB1	NM_002211.3	CCTACTTCTGCACGATGTGATG	CCTTTGCTACGGTTGGTTACATT	128
SSEA-1	NM_002033.3	CTTCAACTGGACGCTCTCCTA	GTTGGTGGTAGTAGCGGACC	191
Stra8	NM_182489.1	ACTCTCAGTCTGATCTCATAGCC	TACCAAGGGGAGGAACCATTC	220
Actin	NM_001101.4	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT	250

Immunofluorescence staining

Coverslips were placed into a six-well plate and then hAD-MSCs were plated. After incubation and RA induction, medium was removed and the cells were washed twice with PBS and fixed with 4% paraformaldehyde for 20 minutes. Then cells were washed three times in cold PBS for 3 minutes and treated with 1% Triton X-100 for 10 minutes at room temperature, followed by incubating with 5% bovine serum albumin (BSA) in PBS for 20 minutes. Then, the cells were incubated with primary antibodies (Oct4, 1:100, Cat. No. ab1985; beta-actin, 1:100, Cat. No. 60008-1-Ig) at 4°C overnight. Then the cells were washed three times in PBS, followed by incubation with Alexa Fluor 488/FITC-conjugated goat anti-rabbit/mouse secondary antibody for 2 hours at room temperature.

Cells were then immediately rinsed four times with PBS for 5 minutes each. After slides had air dried completely, the stained cells were covered with glass slides using mounting medium, DAPI (4′, 6-diamidino-2-phenylindole) fluoromount G (SouthernBiotech). Fluorescence images were acquired with a LSM 800 confocal microscope (Zeiss) using Zeiss Confocal Software.

Statistical analysis

Data are presented as mean ± SD and results were analyzed by the student's t-test. SPSS21.0 software was used for data analysis. p < 0.05 was considered statistically significant.

Results

Isolation and characterization of hAD-MSCs

MSCs were isolated from human adipose tissue. After 3 days of primary culture, the adherent fibroblast-like cells were observed under phase-contrast microscope. The medium was changed every 3 days until the cells reached 90% confluence (about 7–8 days). Cells were passaged at a dilution of 1:3 and reached confluence again within 3–4 days. hAD-MSCs were shown as spindle-shaped cells and the morphology did not change during cell passages (Fig. 1). To determine whether the adherent cells from adipose tissue met the quantifying criteria of MSCs, we analyzed the expression of surface antigens (CD73, CD90, CD105, CD34, CD45, and HLA-DR). As shown in Figure 2, stromal cell markers (CD73, CD90, and CD105) were expressed in hAD-MSC, with a high positivity rate. However, hematopoietic cell markers (such as CD45, CD34, and HLA-DR) were not expressed. All the surface markers' expression detected in hAD-MSCs conformed to the criteria of MSCs established before (Dominici et al., 2006).

FIG. 1.

A-D: Morphology of hAD-MSCs. Primary culture of hAD-MSCs at day 3 (A), day 8 (B). Fibroblast-like hAD-MSCs at passage 3 (C), 6 (D). All the pictures were captured using the IX71 Olympus microscope under 10 × magnification. hAD-MSCs, human adipose-derived mesenchymal stem cells.

FIG. 2.

Flow cytometry analysis. Cells of passage three (P3) were collected and labeled with PE or FITC-conjugated antibodies. The cells were positive for CD73, CD90, and CD105 and negative for CD34, CD45, and HLA-DR. Color images available online at www.liebertpub.com/cell

Osteogenic and adipogenic differentiation of hAD-MSCs

We explored the potential of hAD-MSCs to differentiate into osteoblast and adipocytes using protocols as previously described (Han et al., 2014). After osteogenic induction for 21 days and adipogenic induction for 14 days, hAD-MSCs could differentiate into osteoblasts or adipocytes as identified by Alizarin Red staining or Oil Red O staining, respectively (Fig. 3), which validated the multilineage differentiation potentials of hAD-MSCs.

FIG. 3.

Osteogenic and adipogenic differentiation of hAD-MSCs. hAD-MSCs were incubated with or without osteogenic medium for 21 days and stained with Alizarin Red (A, B). hAD-MSCs were incubated with or without adipogenic medium for 14 days and stained with Oil Red O (C, D). All the pictures were captured using the IX71 Olympus microscope under 10 × magnification. Color images available online at www.liebertpub.com/cell

Morphological changes of hAD-MSCs after RA induction

To induce hAD-MSCs into germ cells, hAD-MSCs were treated with RA and morphological changes were observed every day under a phase-contrast microscope. The morphology of hAD-MSCs under RA induction gradually changed from fibroblast to slender spindles and formed a tadpole-like shape within 7 days, which did not change significantly in the subsequent induction (Fig. 4).

FIG. 4.

Morphological changes of hAD-MSCs with and without RA induction for 7, 14, and 21 days. All the pictures were captured using the IX71 Olympus microscope under 10 × magnification. RA, retinoic acid. Arrows indicate the successfully induced germ cells.

RA-induced expression of germ cell-specific gene in hAD-MSCs

After 21 days of RA induction, RT-PCR was first performed to detect the expression of germ cell-specific genes, Oct4, Piwil2, Itgb1, SSEA-1, and Stra8. RA induction at day 21 significantly increased the expression of germ cell-specific genes compared with that at day 0 (Fig. 5A). Next, the results were further validated by quantitative real-time PCR (Fig. 5B), which together demonstrated that RA, to some degree, could induce hAD-MSC to differentiate into germ-like cells.

FIG. 5.

Expression of germ cell-specific genes in hAD-MSCs with and without RA treatment. (A) RT-PCR analysis and (B) qRT-PCR analysis of the genes after RA treatment for 21 days. qRT-PCR, quantitative reverse transcription–polymerase chain reaction.

Oct4 is recognized as a marker of pluripotency and its expression could also be used to evaluate germ cell differentiation. In this study, Oct4 immunostaining at day 0 and 21 of RA induction were performed to further confirm the differentiation of hAD-MSC to germ-like cells. Beta-actin immunostaining was used to reflect the morphology changes of hAD-MSC before and after RA induction. As shown in Figure 6, more slender spindle-like cells after RA induction were observed according to beta-actin immunostaining result, and RA induction significantly induced Oct4 expression, which is in agreement with PCR results (Fig. 5).

FIG. 6.

Immunofluorescence staining of hAD-MSCs with and without RA treatment for 21 days. (A) Oct4 immunostaining. (B) Beta-Actin immunostaining. Fluorescence images were captured using a LSM 800 confocal microscope (Zeiss). Color images available online at www.liebertpub.com/cell

Discussion

MSCs have the multidirectional differentiation capacity and self-update, which can differentiate into a variety of cell types, such as osteoblasts, chondrocytes, and adipocytes (Dominici et al., 2006; Pittenger et al., 1999). MSCs can also be induced to differentiate into germ-like cells after appropriate induction in vitro (Hua et al., 2009a; Liu et al., 2014), which makes it a promising choice for the treatment of infertility. Adipose tissue is one of the richest sources of adult stem cells, which can be easily obtained through liposuction. The isolation of MSCs from adipose tissue is much easier and has no risk for the donors without any ethical issues.

In this study, we isolated MSCs from human adipose tissue and the morphology and cell surface markers are all in accordance with that of MSCs identified before (Jiang et al., 2013; Meligy et al., 2012). Moreover, we also demonstrated the differentiation potentials of hAD-MSCs into osteocytes and adipocytes, which are also similar to the previously reported literature (Ghasemzadeh-Hasankolaei et al., 2015).

In 2006, Nayernia and his team first reported that mouse BM-MSCs can be induced into male GCs using 1 and 10 μM RA (Nayernia et al., 2006b). After that, various reports showed that MSCs derived from hBM, lung, and umbilical cord Wharton's jelly can also differentiate into germ-like cells using different induction regimens, such as RA, RA with testicular cell-conditioned medium, BMP4 and BMP8, and transforming growth factor beta 1 (TGFb1) (Drusenheimer et al., 2007; Hua et al., 2009a, 2009b) (Drusenheimer et al., 2007; Ghasemzadeh-Hasankolaei et al., 2015; Mazaheri et al., 2011; Shirazi et al., 2012).

RA, an active derivative of vitamin A, is produced in both sexes in mesonephros (Bowles et al., 2006; Bowles and Koopman 2007). RA has been reported to influence the differentiation of stem cells into GCs and stimulate mitosis and meiosis of both female and male germ cells (Chen et al., 2012; Geijsen et al., 2004; Hua et al., 2009a; Koubova et al., 2006; Nayernia et al., 2006a).

In this study, we successfully induced hAD-MSCs into germ-like cells using 10 μM RA alone for the first time. We confirmed the differentiation of hAD-MSCs into germ-like cells through observing the cell morphological changes and detecting the expression of GC-specific markers at the mRNA (Oct4, Piwil2, Itgb1, SSEA-1, and Stra8) and protein (Oct4) levels. Our results were similar to the reports mentioned above.

Oct4 belongs to the POU (Pit-Oct-Unc) transcription factor family (Drusenheimer et al., 2007). It is a marker of pluripotency that plays an important role in embryonic development. Oct4 can also be detected in both pluripotent cells and early germ cells (Allegrucci et al., 2005; Nagano, 2007). Piwil2 is a GC marker that has an important role in the self-renewal of SSC and spermatogenesis. Moreover, it is necessary for the repair of DNA damage (Lee et al., 2006; Yin et al., 2011). Itgb1 is a marker of SSCs and spermatogonia. It is closely related to metastasis and homing of PGCs and normal germline development (Lacham-Kaplan, 2004; Shinohara et al., 1999).

It has been reported that SSEA-1 is a marker of early PGCs, whose increased expression can be used to evaluate germ-like cell differentiation of MSCs (Li et al., 2014). Stra8 is considered to be a GC-specific gene, which is highly expressed at prophase of meiosis and absent in male embryonic GCs (Aflatoonian and Moore, 2006; Lacham-Kaplan, 2004; Zhou et al., 2008). In this study, Oct4, Piwil2, Itgb1, SSEA-1, and Stra8 were chosen as GC-specific markers and their expressions were detected before and after RA induction to evaluate the GCs differentiation from hAD-MSCs. Our results showed that all the selected markers displayed increased expression after RA treatment for 21 days with statistical significance, which altogether demonstrated the successful germ-like cell induction from hAD-MSCs by 10 μM RA treatment.

In summary, we first demonstrated that hAD-MSCs can differentiate into germ-like cells in vitro, which will provide theoretical and experimental basis for the clinical application of hAD-MSCs in the treatment for infertility.

Footnotes

Acknowledgments

This study was supported by the Youth Foundation of Jining Medical University (grant No. JYQ14KJ30), the Natural Science Foundation of Shandong Province (No. ZR2017LH029), the Science and Technology Program of Jining City, China (No. 2016-56-104), and the PhD start-up funds from the Affiliated Hospital of Jining Medical University (No. 2016-BS-001, 2016-BS-003).

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

Aflatoonian

, and Moore

(2006). Germ cells from mouse and human embryonic stem cells. Reproduction, 132, 699–707.

Afsartala

, Rezvanfar

M.A.

, Hodjat

, Tanha

, Assadollahi

, Bijangi

, Abdollahi

, and Ghasemzadeh-Hasankolaei

(2016). Amniotic membrane mesenchymal stem cells can differentiate into germ cells in vitro. In Vitro Cell. Dev. Biol. Anim., 52, 1060–1071.

Allegrucci

, Thurston

, Lucas

, and Young

(2005). Epigenetics and the germline. Reproduction, 129, 137–149.

Bowles

, Knight

, Smith

, Wilhelm

, Richman

, Mamiya

, Yashiro

, Chawengsaksophak

, Wilson

M.J.

, Rossant

, et al. (2006). Retinoid signaling determines germ cell fate in mice. Science, 312, 596–600.

Bowles

, and Koopman

(2007). Retinoic acid, meiosis and germ cell fate in mammals. Development, 134, 3401–3411.

Chen

, Jia

, Wang

, Zhou

, Leng

, Duan

, and Kang

(2012). Retinoic acid regulates germ cell differentiation in mouse embryonic stem cells through a Smad-dependent pathway. Biochem. Biophys. Res. Commun., 418, 571–577.

Dominici

, Le Blanc

, Mueller

, Slaper-Cortenbach

, Marini

, Krause

, Deans

, Keating

, Prockop

, and Horwitz

(2006). Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy, 8, 315–317.

Drusenheimer

, Wulf

, Nolte

, Lee

J.H.

, Dev

, Dressel

, Gromoll

, Schmidtke

, Engel

, and Nayernia

(2007). Putative human male germ cells from bone marrow stem cells. Soc. Reprod. Fertil. Suppl., 63, 69–76.

Geijsen

, Horoschak

, Kim

, Gribnau

, Eggan

, and Daley

G.Q.

(2004). Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature, 427, 148–154.

10.

Ghasemzadeh-Hasankolaei

, Eslaminejad

M.B.

, and Batavani

(2015). Male and female rat bone marrow-derived mesenchymal stem cells are different in terms of the expression of germ cell specific genes. Anat. Sci. Int., 90, 187–196.

11.

Han

, Zhang

, Song

, Liu

, Zou

, Piao

, and Liu

(2014). Human adipose-derived mesenchymal stem cells: A better cell source for nervous system regeneration. Chin. Med. J. (Engl), 127, 329–337.

12.

Hauner

(2004). The new concept of adipose tissue function. Physiol. Behav., 83, 653–658.

13.

Hua

, Pan

, Yang

, Dong

, Dou

, and Sidhu

K.S.

(2009a). Derivation of male germ cell-like lineage from human fetal bone marrow stem cells. Reprod. Biomed. Online, 19, 99–105.

14.

Hua

, Yu

, Dong

, Yang

, Gao

, Lei

, Sun

, Pan

, Wu

, and Dou

(2009b). Characterization of mesenchymal stem cells (MSCs) from human fetal lung: Potential differentiation of germ cells. Tissue Cell, 41, 448–455.

15.

Hyun

(2010). The bioethics of stem cell research and therapy. J. Clin. Invest., 120, 71–75.

16.

Jiang

, Qi

, Walker

N.G.

, Sindrilaru

, Hainzl

, Wlaschek

, MacNeil

, and Scharffetter-Kochanek

(2013). The effect of adipose tissue derived MSCs delivered by a chemically defined carrier on full-thickness cutaneous wound healing. Biomaterials, 34, 2501–2515.

17.

Koubova

, Menke

D.B.

, Zhou

, Capel

, Griswold

M.D.

, and Page

D.C.

(2006). Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proc. Natl. Acad. Sci. U. S. A., 103, 2474–2479.

18.

Lacham-Kaplan

(2004). In vivo and in vitro differentiation of male germ cells in the mouse. Reproduction, 128, 147–152.

19.

Lee

J.H.

, Engel

, and Nayernia

(2006). Stem cell protein Piwil2 modulates expression of murine spermatogonial stem cell expressed genes. Mol. Reprod. Dev., 73, 173–179.

20.

, Pan

, Zhu

, Mu

, Liu

, and Hua

(2014). BMP4 promotes SSEA-1(+) hUC-MSC differentiation into male germ-like cells in vitro. Cell Prolif. 47, 299–309.

21.

Liu

, Ma

, Xu

, Hou

, Hu

, Yu

, Liu

, Chen

, and Lu

(2014). Activation of the germ-cell potential of human bone marrow-derived cells by a chemical carcinogen. Sci. Rep., 4, 5564.

22.

Mazaheri

, Movahedin

, Rahbarizadeh

, and Amanpour

(2011). Different doses of bone morphogenetic protein 4 promote the expression of early germ cell-specific gene in bone marrow mesenchymal stem cells. In Vitro Cell. Dev. Biol. Anim., 47, 521–525.

23.

Meligy

F.Y.

, Shigemura

, Behnsawy

H.M.

, Fujisawa

, Kawabata

, and Shirakawa

(2012). The efficiency of in vitro isolation and myogenic differentiation of MSCs derived from adipose connective tissue, bone marrow, and skeletal muscle tissue. In Vitro Cell. Dev. Biol. Anim., 48, 203–215.

24.

Nagano

M.C.

(2007). In vitro gamete derivation from pluripotent stem cells: Progress and perspective. Biol. Reprod., 76, 546–551.

25.

Nayernia

, Lee

J.H.

, Drusenheimer

, Nolte

, Wulf

, Dressel

, Gromoll

, and Engel

(2006a). Derivation of male germ cells from bone marrow stem cells. Lab. Invest., 86, 654–663.

26.

Nayernia

, Nolte

, Michelmann

H.W.

, Lee

J.H.

, Rathsack

, Drusenheimer

, Dev

, Wulf

, Ehrmann

I.E.

, Elliott

D.J.

et al. (2006b). In vitro-differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Dev. Cell., 11, 125–132.

27.

Pittenger

M.F.

, Mackay

A.M.

, Beck

S.C.

, Jaiswal

R.K.

, Douglas

, Mosca

J.D.

, Moorman

M.A.

, Simonetti

D.W.

, Craig

, and Marshak

D.R.

(1999). Multilineage potential of adult human mesenchymal stem cells. Science, 284, 143–147.

28.

Shinohara

, Avarbock

M.R.

, and Brinster

R.L.

(1999). beta1- and alpha6-integrin are surface markers on mouse spermatogonial stem cells. Proc. Natl. Acad. Sci. U. S. A., 96, 5504–5509.

29.

Shirazi

, Zarnani

A.H.

, Soleimani

, Abdolvahabi

M.A.

, Nayernia

, and Ragerdi Kashani

(2012). BMP4 can generate primordial germ cells from bone-marrow-derived pluripotent stem cells. Cell Biol. Int., 36, 1185–1193.

30.

Witkowska-Zimny

, and Walenko

(2011). Stem cells from adipose tissue. Cell. Mol. Biol. Lett., 16, 236–257.

31.

Yin

D.T.

, Wang

, Chen

, Liu

M.Y.

, Han

, Yan

, Shen

, He

, Duan

, Li

J.J.

et al. (2011). Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin. PLoS One, 6, e27154.

32.

Zhou

, Li

, Nie

, Friel

, Mitchell

, Evanoff

R.M.

, Pouchnik

, Banasik

, McCarrey

J.R.

, Small

, et al. (2008). Expression of stimulated by retinoic acid gene 8 (Stra8) and maturation of murine gonocytes and spermatogonia induced by retinoic acid in vitro. Biol. Reprod., 78, 537–545.