Production of Transgenic Handmade Cloned Goat ( Capra hircus ) Embryos by Targeted Integration into Rosa 26 Locus Using Transcription Activator-like Effector Nucleases

Abstract

Transgenic goats are ideal bioreactors for the production of therapeutic proteins in their mammary glands. However, random integration of the transgene within-host genome often culminates in unstable expression and unpredictable phenotypes. Targeting desired genes to a safe locus in the goat genome using advanced targeted genome-editing tools, such as transcription activator-like effector nucleases (TALENs) might assist in overcoming these hurdles. We identified Rosa 26 locus, a safe harbor for transgene integration, on chromosome 22 in the goat genome for the first time. We further demonstrate that TALEN-mediated targeting of GFP gene cassette at Rosa 26 locus exhibited stable and ubiquitous expression of GFP gene in goat fetal fibroblasts (GFFs) and after that, transgenic cloned embryos generated by handmade cloning (HMC). The transfection of GFFs by the TALEN pair resulted in 13.30% indel frequency at the target site. Upon cotransfection with TALEN and donor vectors, four correctly targeted cell colonies were obtained and all of them showed monoallelic gene insertions. The blastocyst rate for transgenic cloned embryos (3.92% ± 1.12%) was significantly (p < 0.05) lower than cloned embryos (7.84% ± 0.68%) used as control. Concomitantly, 2 out of 15 embryos of morulae and blastocyst stage (13.30%) exhibited site-specific integration. In conclusion, the present study demonstrates TALEN-mediated transgene integration at Rosa 26 locus in caprine fetal fibroblasts and the generation of transgenic cloned embryos using HMC.

Introduction

The generation of transgenic farm animals is crucial due to their potential application as bioreactors for the cost-effective production of pharmaceutical/therapeutic proteins in their mammary gland (Mehta et al., 2017). Additionally, these animals have tremendous potential to serve as models for biomedical research and organ and tissue donors for xenotransplantation in humans. In this regard, goats are ideal candidates as bioreactors due to the high yield of purified product, short generation interval, and generation of multiple offsprings (Fernandez and Hoeffler, 1998). For instance, the recently commercialized recombinant human antithrombin III expressed in transgenic goats' milk (Shepelev et al., 2018) serves as the most convincing evidence regarding potential applications of transgenic livestock animals for human welfare.

For the past several years, researchers have made numerous efforts to generate transgenic farm animals relying upon the random insertion of the transgene within the host genome, although it resulted in its low, unstable, and unpredictable expression (Kalds et al., 2019; Lantinga-van Leeuwen et al., 2006; Papapetrou and Schambach, 2016; Smithies, 2001). However, in recent advancements, the development of gene-targeting technologies encompassing site-specific nucleases viz. zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas has played a pivotal role to overcome these barriers. These advanced methods stimulate the homologous recombination by several folds and targeting a single copy of transgene at a specified locus resulting in its highly stable and constitutive expression.

Among these novel transgenic technologies, TALENs have proven to be highly efficient genome-editing tools due to their simple and easy designing, high specificity, low cytotoxicity, and rare off-target activities (Li et al., 2020). It has been rapidly and robustly used for precise genome editing in various cell types across the species (Carlson et al., 2016; Zhang et al., 2019). TALENs consist of TALE DNA-binding domain fused with a nonspecific FokI endonuclease, which introduces a double-strand break at the target site within the genome, which is then repaired by either nonhomologous end joining, resulting in gain or loss of few base pairs leading to the gene knockout or homology-directed repair if a transgene is provided, leading to its insertion/knockin at the specific locus (Boch and Bonas, 2010).

In addition to the genome-editing tool, selecting a safe genomic site with high homologous recombination frequency and ubiquitous transcriptional activity is crucial for a successful gene-targeting study. Rosa 26 locus has remained the most preferred docking site for transgene integration in the mouse model (Friedrich and Soriano, 1991; Imayoshi et al., 2020; Zambrowicz et al., 1997). The insertion of the transgene into Rosa 26 locus allows site-specific integration of a single copy of transgene resulting in its stable and optimized expression without causing any aberrant physiological consequences (Dulauroy et al., 2012; Sadelain et al., 2012). Rosa 26 locus has also been identified and successfully targeted in rat (Kobayashi et al., 2012), rabbit (Yang et al., 2016), pig (Li et al., 2014; Xie et al., 2017), sheep (Wu et al., 2016), cattle (Wang et al., 2018), and human (Irion et al., 2007).

However, to the best of our knowledge, there is no report available on identifying and targeting Rosa 26 loci in the goat genome. Identifying Rosa 26 locus in the caprine genome is a valuable asset to the toolbox of transgenic goat research and would improve the efficiency of targeted transgene integration to generate transgenic goats. Somatic cell nuclear transfer (SCNT) is an efficient technique for generating transgenic farm animals and has been preferred over pronuclear microinjection for this purpose (Srirattana et al., 2013; Zhou et al., 2015). The use of transgenic cells harboring the desired gene as nuclear donors for SCNT ensures the transgene's presence and expression in resultant offspring (Bressan et al., 2013). Moreover, one founder animal's production this way provides an opportunity to generate a herd of transgenic animals through germline transmissions (Whitelaw et al., 2016).

With this backdrop, the present study was undertaken to identify the Rosa 26 locus in the goat genome and optimize the site-directed introduction of GFP at Rosa 26 locus in fetal fibroblasts using TALENs, followed by their use as a nuclear donor for producing transgenic handmade cloned goat embryos.

Materials and Methods

The present study was carried out at the Embryo Biotechnology Laboratory, Animal Biotechnology Center, ICAR-National Dairy Research Institute, Karnal, India. All the experiments were duly approved and performed following relevant guidelines and regulations by the Institute Bio-Safety Committee (IBSC/NDRI/Dt.29.04.2014). Goat ovaries and uterus were collected from a local abattoir following the guidelines by the Institute Animal Ethics Committee. All the chemicals and media for cell and embryo culture were procured from Sigma Chemical (St Louis, MO) unless otherwise specified. The molecular biology reagents were obtained from Thermo Fisher Scientific (Waltham, MA, USA). The fetal bovine serum (FBS) was procured from HyClone (South Logan, UT) and plastic ware from Nunc (Roskilde, Denmark).

Identification, cloning, and sequencing of goat Rosa 26 locus

The porcine Rosa 26 sequences (>gi|347615106|ref|NW_003611693.1| Susscrofa breed mixed chromosome 13 genomic scaffold, Sscrofa10.2) were used as a template to search the goat genome (www.goatgenome.org/projects.html). Using bioinformatics tools, a highly conserved sequence located on caprine chromosome 22 was isolated as putative Rosa 26 locus. Putative goat Rosa 26 loci were also aligned with sheep Rosa 26 sequences for further confirmation (Wu et al., 2016). A 2.2 kb fragment of Rosa 26 locus was amplified from caprine genomic DNA isolated from uterine tissue using the following polymerase chain reaction (PCR) program: initial denaturation at 95°C for 3 minutes; followed by 35 cycles at 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 2.2 minutes; with a final extension at 72°C for 10 minutes. The primer sequences used for amplification of goat Rosa 26 locus are given in Table 1.

Table 1.

Polymerase Chain Reaction Primers for Goat Rosa 26 Amplification and Targeting Vector Construction

Primer sequence	Annealing temperature (°C)	Product size
(1) Primers for Rosa 26 locus amplification
Rosa F-CCTGTCAGTTACAGCCTCGG	58	2.2 kb
Rosa R-GTACAACACTTAACAAGAAGCTC	58	2.2 kb
(2) Primers for Rosa 26 targeting vector construction
(a) For amplification and ligation of 5′ Rosa 26 arm
5′Arm F-ATT ATTAAT CTGTCAGTTACAGCCTCGG (AseI)	58	864 bp
5′Arm R-AAT GCTAGC GACAACGCCCAGGATTAAGGTTAA (NheI)	58	864 bp
(b) For amplification and ligation of 3′ Rosa 26 arm
3′Arm F-ATT ACCGGT TGGATCGAGCAGGTATAAGATTTA (SalI)	60	1283 bp
3′Arm R-ATT CTTAAG GGTACAACACTTAACAAGAAGCTC (BspTI)	60	1283 bp
(c) For amplification and ligation of Kanamycin
KAN F-TT GAATTC TCGCATGATTGAACAAGATGGA (EcoRI)	60	800 bp
KAN R-TTA GGATCC AGTCCCGCTCAGAAGAACTC (BamHI)	60	800 bp
(d) For amplification and ligation of KIGS fragment
KAN2 F-TT GAATTC TCGCATGATTGAACAAGATGGA (EcoRI)	60	2.25 kb
SV406 R-ACA GTCGAC GACAAACCACAAC (SalI)	60	2.25 kb
(e) For amplification and ligation of CMV fragment
CMVFGCG GCTAGC TAGTT ATTGAT AGTAATCAATTACG (NheI; AseI modified)	67	600 bp
CMVR TA GAATTC GCGGATCTGACGGTTCACTAA (EcoRI)	67	600 bp

Bold and underscored denotes sequence of restriction enzyme sites (in parentheses) added in primers.

KIGS, Kan-IRES-GFP-SV40pA.

The PCR products were observed under ultraviolet transilluminator, excised, and purified from the gel using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific). The purified PCR product was ligated into a TA cloning vector (InsTAclone PCR Cloning Kit; Thermo Fisher Scientific) and cloned into Escherichia coli XL1-Blue MRF' host and sequenced from Merck Specialities Pvt. Ltd. The sequence obtained was verified by BLAST and Pairwise alignment in Bio-Edit.

Generation of a TALEN pair and Rosa 26 targeting vector P5′KC3′

Left (L) and Right (R) TALEN vectors (Fig. 1a) targeting Rosa 26 intron 1 region were designed and constructed from Life Technologies Corporation (Carlsbad, CA). The TALEN vectors contained TALE proteins specific for binding TAL L and TAL R sequences of Rosa 26 intron 1 region, fused with nonspecific FokI endonuclease. RVD (NN-NN-NNHD-NN-NG-NG-NN-NG-HD-HD-NG-NN-HD-NI-NN-NG-NN) was designed for 18 bp left TAL-binding sequence NGGGCGTTGTCCTGCAGTG, whereas RVD NN-NN-NNNG-NG-HD-NI-NG-HD-HD-NG-HD-NG-NI-NI-NI-NG-HD for 18 bp right TAL-binding sequence NGGGTTCATCCTCTAAATC. These left and right TALEN-binding sites were separated by a 16 bp spacer sequence GATCGAGCAGGTATAA.

FIG. 1.

(a) Left and right TALEN vectors designed against intron 1 region of goat Rosa 26 locus. (b) Diagrammatic representation of Donor vector P5′KC3′: The vector (P5′KC3′) contains 5′ Rosa 26 arm, KAN-IRES-GFP-SV40pA, CMV, and 3′ Rosa 26 arm into a pIRES2-AcGFP1 plasmid. The numbers indicate the sequential order in which the fragments were ligated into the plasmid. P5′KC3′, pIRES 5′ KIGS CMV 3′; TALEN, transcription activator-like effector nuclease.

The Rosa 26 targeting vector/donor vector P5′KC3′ (pIRES 5′ KIGS CMV 3′) was constructed by using the pIRES2-AcGFP1 (Clontech) vector as a backbone (Fig. 1b). The fragments 5′ goat Rosa 26 homology arm, Kan-IRES-GFP-SV40pA fragment, CMV promoter, and 3′ goat Rosa 26 homology arm were sequentially added into backbone vector by restriction enzyme digestion and ligation using T4 DNA ligase. The Rosa 26 homology arms 5′ (864 bp) and 3′ (1283 bp) were amplified from the goat genome and cloned into a TA cloning vector. The Rosa 26 5′ homology arm was inserted into the pIRES2-AcGFP1 (5.3 kb) vector using NheI and AseI restriction enzymes replacing CMV promoter. Kanamycin resistance gene was inserted into multiple cloning sites (MCS) of the pIRES2-AcGFP1 vector using EcoRI and BamHI, and Kan-IRES-GFP-SV40pA fragment was generated from this vector using PCR.

Kan-IRES-GFP-SV40pA (KIGS) fragment (2.25 kb) was inserted into MCS of pIRES 5′ arm vector by EcoRI and SalI restriction digestion and ligation. CMV fragment (600 bp) was amplified from pIRES2-AcGFP1 mammalian expression vector using primers having NheI and EcoRI sites into 5′ region of forward and reverse primer, respectively, and modified AseI site in forward primer and inserted into MCS of pIRES 5′ KIGS by using NheI and EcoRI enzymes. Subsequently, a 3′ Rosa 26 homology arm was inserted into MCS of pIRES 5′ KIGS CMV vector with SalI and BspTI restriction enzyme digestion and ligation. Finally, the Rosa 26 targeting vector P5′KC3′ (8.0 kb) was verified by sequencing inserts from both the ends. The primer sequences used are given in Table 1.

Establishment and characterization of goat fetal fibroblast cells

Goat fetal fibroblasts (GFFs) were established from ear skin tissues collected from a 50-day-old fetus as described previously (Shah et al., 2009). The sex of the established GFFs was confirmed by PCR amplification of SRY and PLP genes using genomic DNA. The fetal fibroblast cultures were characterized by immunocytochemistry for the expression of fibroblast cell-specific (β-Tubulin, Vimentin) as well as nonspecific markers (Keratin 78, Cytokeratin 18) as described previously (Selokar et al., 2012). The cells were further characterized by reverse transcription/polymerase chain reaction (RT-PCR), for which RNA was isolated from GFFs using TRIzol (Invitrogen), and complementary DNA (cDNA) was synthesized using the Superscript III First-Strand Synthesis Kit (Invitrogen).

The expression of cell-specific markers, namely, VIMENTIN, TUBULIN, CYTOKERATIN-8, and CYTOKERATIN-18 was analyzed by RT-PCR under the following cycling conditions: initial denaturation at 94°C for 3 minutes; followed by 94°C for 30 seconds, X°C (annealing temperature as mentioned for each primer pair in Table 2) for 30 seconds, and 72°C for 30 seconds for 35 cycles; followed by a final extension at 72°C for 10 minutes.

Table 2.

Primers for Fibroblast Cell Characterization

Gene	Sequence	Annealing temperature (°C)	Product size (bp)	Accession ID
VIMENTIN	F-CTTCAGGAGGCTGAGGAATG	58	287	XM_006052364.2
VIMENTIN	R-TGACGAGCCATCTCTTCCTT	58	287	XM_006052364.2
TUBULIN	F-GAGGGAAATCGTGCACATCC	52	150	XM_013973992.2
TUBULIN	R-TAGTACACGGAGATGCGGTC	52	150	XM_013973992.2
CK8	F-AAGCTGGTGTCTGAGTCCTC	56	150	XM_005679931.1
CK8	R-GGTGGAGGACAGGGGTAAAA	56	150	XM_005679931.1
CK18	F-GGAGCTGGACAAGTACTGGT	53	186	XM_005680092.1
CK18	R-ACTTCCCTCAGGCTGTTCTC	53	186	XM_005680092.1
SRY	F-GCGCAAATGATCAGTGTGAAAG	58	173	XM_015465855.1
SRY	R-TCCACTCATATCCCAGCTGCTT	58	173	XM_015465855.1
PLP	F-CTCTCATCAAAAACTCCTTGGTT	60	184	AJ009913.1
PLP	R-CCACCAATTCCTGCTCTTCC	60	184	AJ009913.1

Evaluation of TALEN efficiency

To determine TALEN vectors' efficiency to bind at Rosa 26 locus and to introduce a double-strand break, GFFs were transfected with left and right TALEN vectors by nucleofection as described previously (Sharma et al., 2020). Briefly, GFFs at passage 3 were grown to 70%–80% confluency, trypsinized, and 0.5 × 10⁶ cells were resuspended in 82 μL P3 solution and 18 μL supplement 1 solution (Amaxa). Left and right TALEN vectors (1.5 μg each) were added to the resuspended cells and nucleoporated in 1 cm transfection cuvettes using EN-150 program in 4 D nucleofector (Amaxa). The transfected cells were seeded in a six-well plate containing Dulbecco's modified Eagle's medium (DMEM) +10% FBS and cultured at 37°C in a 5% CO₂ incubator.

After 72 hours, the genomic DNA was isolated from the transfected cells, and the fragment spanning the target site was amplified using primers TAL F and TAL R following PCR cycling conditions: initial denaturation at 94°C for 3 minutes; followed by 94°C for 30 seconds, 52°C for 30 seconds, and 72°C for 30 seconds for 33 cycles; and a final extension at 72°C for 10 minutes. The amplified fragment was purified and cloned into E. coli XL1-Blue MRF' host. After confirmation of the recombinant clones for insert sequence based on PCR amplification, 30 clones were sent for custom sequencing from Merck Specialities Pvt. Ltd. The sequence obtained was verified by BLAST and Pairwise alignment in BioEdit to detect indels.

TALEN-mediated targeting of circular donor vector at Rosa 26 locus

GFFs were cotransfected with left and right TALEN vectors (1.5 μg each) and circular donor vector (2.5 μg) by nucleofection as mentioned earlier, and after 72 hours, G418 (700 μg/mL) was added to select the transfected cells. G418-resistant cell colonies expressing GFP were marked by visualizing under the fluorescence microscope, and cloning rings (Sigma, St. Louis, MO) were loaded over the marked colonies. The cells were then trypsinized and seeded at low density in 96-well cell culture plates and further propagated for cryopreservation and DNA isolation for detecting mutations.

TALEN-mediated targeting of linear donor vector

Linear donor vector fragment from 5′ to 3′ arm was amplified using circular donor vector (P5′KC3′) as the template by Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) to get a blunt-end vector using PCR cycling conditions: initial denaturation at 98°C for 1 minute, followed by 35 cycles of 98°C for 10 seconds, 60°C for 30 seconds, 72°C for 2.5 minutes, and a final extension at 72°C for 10 minutes. The PCR product was purified by the Gene JET PCR Purification Kit (Thermo Fisher Scientific). The GFFs were cotransfected by left and right TALEN vectors (1.5 μg each) and linear donor vector (2.5 μg) by nucleofection, selected using G418, and seeded in 96-well cell culture plates for cryopreservation or DNA isolation as mentioned above.

Screening of correctly targeted cell colonies

To detect targeted integration of donor vector at Rosa 26 locus, DNA was isolated from the cell colonies picked using cloning rings and used as a template to perform 5′ and 3′ junction PCR. PCR analysis was performed with primers GR5′END F/CMV-R3 (5′ junction, 1679 bp product) and primers SV40 F/GR3′END R (3′ junction, 1857 bp product). Primers for 5′ and 3′ junction PCR (Table 3) were designed such that only correctly targeted cell colony gave the desired band, as shown in Figure 2a. The PCR cycling conditions were: 94°C for 3 minutes, followed by a cycling program of 94°C for 30 seconds, 54°C for 30 seconds, and 72°C for 1.5 minutes for 35 cycles. The reactions were ended with a final extension at 72°C for 10 minutes.

FIG. 2.

(a) Schematic overview depicting the targeting strategy of goat Rosa 26 locus: the cross depicts the double-strand break by TALEN pair in intron 1 region of Rosa 26 locus; the level arrow lines represent the primers for 5′ and 3′ junction PCR for screening targeted cell colonies. (b) Diagrammatic representation of Donor vector P5′KC3′ and confirmation of various fragments insertion in donor vector P5′KC3′: (b.a) by PCR; Lane 1: 5′ Rosa 26 arm (800 bp), Lane 2: KAN-IRES-GFP-SV40pA (2.25 kb), Lane 3: CMV (600 bp), Lane 4: 3′ Rosa 26 arm (1.2 kb); (b.b) by restriction digestion; by AseI and BspTI, yielding 5.0 kb vector fragment and 3.0 kb vector backbone; (b.c) linearization by BspTI yielding vector fragment of 8.0 kb. PCR, polymerase chain reaction.

Table 3.

Primers for 5′ and 3′ Junction Polymerase Chain Reaction

Primer sequence	Annealing temperature (°C)	Product size (bp)
(1) For 5′ Junction PCR
GR5′END F-TTTGAGAGGAGAGCAGTGAG	54	1679
CMV R3-GAACCGGTTGACGGTTCACTAAA	54	1679
(2) For 3′ Junction PCR
SV40 F-TTTCACTGCATTCTAGTTGTGG	54	1857
GR3′END R-GCCATCATATCAGCACACTACAG	54	1857

PCR, polymerase chain reaction.

Screening targeted cell colonies for mono and biallelic gene insertions

DNA from the correctly targeted cell colonies was isolated and used as the template for the amplification of fragment spanning the target site using specific primers for screening biallelic variants. The PCR was performed as follows: initial denaturation at 94°C for 3 minutes followed by a cycling program of 94°C for 30 seconds, 52°C for 30 seconds, and 72°C for 5 minutes for 33 cycles. The reactions were ended with a final extension at 72°C for 10 minutes. The primers used are given in Table 4.

Table 4.

Primers for Amplification of Fragment Spanning Target Site

Primer sequence	Annealing temperature (°C)	Product size (bp)
TAL F-CTTAACCTTAATCCTGGGCGT	52	143
TAL R-GGACTTCATTTCACTCCACC	52	143

Production of transgenic and nontransgenic embryos by handmade cloning

For handmade cloning (HMC), transgenic and nontransgenic cells were grown to full confluency for maximal synchronization in the G1 stage of the cell cycle as described previously (Selokar et al., 2012). The recipient oocytes were prepared by in vitro maturation, cumulus, and zona removal, and finally, manual enucleation as described in an earlier study (Shah et al., 2009) with slight modifications as increased duration of in vitro maturation for 24 hours, hyaluronidase treatment for 5 minutes instead of 1 minute followed by gentle pipetting for 1 minute, and finally reducing the duration of pronase treatment from 8 minutes to 6 minutes. During electrofusion, a single DC pulse (2.3 kV/cm for 8 μseconds) was applied.

The reconstructed, activated embryos were cultured in 400 μL of G1/G2 medium (Vitrolife) in a 4-well dish (10–15 reconstructed embryos per well) overlaid with mineral oil and incubated undisturbed at 38.5°C in a 5% CO₂ incubator for 7 days. The blastocyst rate recorded on day 8 of in vitro culture (IVC) was taken as a measure of the in vitro developmental competence of the embryos.

Single embryo PCR

GFP expressing embryos of morula and blastocyst stage (n = 10) were randomly picked, and each was added to a 0.2-mL tube in 2–3 μL of water and lysed by heating at 95°C followed by immediate chilling on ice to extract the DNA to be further used as the template. The PCR was carried out to detect GFP expression as follows: initial denaturation at 95°C for 3 minutes; 35 cycles of 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds; and a final extension at 72°C for 10 minutes. The primers used are given in Table 5. Single-embryo PCR for 15 embryos was also performed using primers GR5′END F/CMV-R3 (5′ junction, 1679 bp product) and primers SV40 F/GR3′END R (3′ junction, 1857 bp product) for screening the correctly targeted embryos.

Table 5.

Primers for Amplification of GFP

Primer sequence	Annealing temperature (°C)	Product size (bp)
GFP F-TTCAAGATCCGCCACAACAT	60	181
GFP R-GTCACGAAGCCGAAGTAGAT	60	181

Statistical analysis

GraphPad Prism 7 software was used for statistical analysis. The differences among means were analyzed using one-way analysis of variance to compare developmental competence of cloned embryos and by Student's t-test to compare knockin efficiencies between circular and linear donor vector. The percentage values were subjected to arcsine transformation before analysis. The differences were considered to be statistically significant at p < 0.05. Data are presented as mean ± standard error of the mean.

Results

Identification, cloning, and sequencing of goat Rosa 26 locus

Goat Rosa 26 locus was identified by aligning porcine Rosa 26 sequences with goat genome where a sequence located on chromosome 22 exhibited 86.50% similarity (Supplementary Fig. S1). The sequence was further aligned with sheep Rosa 26 sequences, where it exhibited 96% sequence conservation, which confirmed the bonafide identity of this region as goat Rosa 26 locus. The sequence containing the potential intron 1 region of Rosa 26 locus (2.2 kb) was isolated and amplified from caprine genomic DNA (Supplementary Fig. S2). The purified PCR product was cloned and sequenced and shared 99.90% similarity to the putative Rosa 26 sequence on goat chromosome 22.

Generation of a TALEN pair and Rosa 26 targeting vector P5′KC3′

A TALEN pair, that is, left and right TALEN vectors, were designed and generated from Life Technologies Corporation against the intron 1 region of Rosa 26 locus (Supplementary Fig. S3). These TALEN vectors were separated by a 16 bp spacer, where the FokI endonuclease would create a double-strand break, which would later be repaired by homology-directed repair in the presence of donor vector. The Rosa 26 targeting vector P5′KC3′ (pIRES 5′ KIGS CMV 3′) was constructed and verified by PCR and restriction digestion (Fig. 2b). The vector was designed to introduce the GFP gene cassette (CMV-KAN-IRES-GFP-SV40pA) at intron 1 of Rosa 26 locus. 5′ and 3′ goat Rosa 26 homology arms flanking GFP gene cassette were designed for efficient homologous recombination.

Establishment and characterization of GFFs

GFFs were successfully established from fetal ear tissue explants. The cells started originating from explants after 3–4 days of culture and formed a confluent layer within 8–9 days. The cells appeared spindle shaped and expressed fibroblast-specific markers, tubulin and vimentin, as determined by immunocytochemistry (Fig. 3), whereas the expression of epithelial cell-specific markers keratin 78 and cytokeratin-18 was not observed in these cells. Furthermore, verification was done by RT-PCR, where the cells were positive for VIMENTIN and TUBULIN expression and negative for CYTOKERATIN-8 and CYTOKERATIN-18 (Fig. 4). PCR amplification from genomic DNA showed the presence of X chromosome-specific PLP gene and absence of Y chromosome-specific SRY gene, which confirmed that the cell used in the present study was from the female fetus in origin (Fig. 4).

FIG. 3.

Characterization of GFF cells by immunocytochemistry: cells under bright light, UV light for visualization of nucleus stained using Hoechst 33342, fluorescent light for observing cells stained with FITC-conjugated 2⁰ Ab and merged images of 2⁰ Ab and Hoechst (magnification: 100 × ). GFF, goat fetal fibroblast; UV, ultraviolet.

FIG. 4.

Characterization of GFFs and sex confirmation: (a) by PCR amplification of fibroblast-specific markers: Lane 1: VIMENTIN (287 bp), Lane 2: CYTOKERATIN-8 (181 bp), Lane 3: CYTOKERATIN-18 (156 bp), Lane 4: β TUBULIN (150 bp), and M: DNA ladder 100 bp; (b) sex confirmation by PCR amplification of SRY gene from genomic DNA: Lane 1: DNA from male source, Lane 2: DNA from GFF, Lane 3: negative enzyme, Lane 4: no template control [(NTC) (DNA not added to this tube)], M: DNA ladder 100 bp; (c) sex confirmation by PCR amplification of PLP gene: Lane 1: DNA from male source, Lane 2: DNA from GFF, Lane 3: negative enzyme, Lane 4: NTC, M: DNA ladder 100 bp.

Evaluation of the efficiency of TALENs

To evaluate the efficiency of TALENs, GFFs were transfected by TALEN pair, and genomic DNA was isolated from transfected cells after 72 hours of culture. Fragment spanning the target site was amplified using specific primers (TAL F and TAL R), and a 143 bp band was observed. The amplified fragment was cloned, and the sequence analysis of 30 recombinant clones showed 4 variants having indels in the spacer sequence (Fig. 5). A 13.30% indel frequency was observed, which confirmed the TALEN pair's efficient binding at the Rosa 26 locus.

FIG. 5.

Evaluation of TALEN efficiency: (a) PCR amplification of fragment spanning target site using extracted DNA from TALEN-transfected cells; (b) plasmid PCR for verification of recombinant clones having fragment spanning target sites; (c) sequencing results depicting insertions and deletions at target site.

TALEN-mediated targeting of donor vector at Rosa 26 locus

Transfected cell colonies were screened for specific integration by 3′ and 5′ junction PCR. 3′ Junction PCR using primer SV40 F from endogenous vector and GR3′END R from exogenous DNA from right hand junction gave the desired band of 1857 bp in only 1 out of 24 colonies screened-in circular vector (Fig. 6), whereas 3/24 positive colonies were obtained in cells transfected with linear vector fragment (Fig. 7). The integration of the donor vector at Rosa 26 locus was further confirmed by obtaining the desired band of 1679 bp in 5′ junction PCR using CMV R3 and GR5′END F primers from the left junction region. Linear donor vector fragment (12.85% ± 1.43%) showed nonsignificantly (p = 0.08) higher frequency of homologous recombination when compared with the circular donor vector (3.70% ± 3.70%) (Supplementary Table S1).

FIG. 6.

Cotransfection of TALEN and circular donor vector into GFF by nucleofection: (a) under bright light, (b) under fluorescence (magnification: 200 × ); (c) 3′ junction PCR: Lane 1–24: transfected cell colonies, Lane 7: +ve colony for 3′ junction PCR, Lane 25: nontransfected cells, Lane 26: transfected cells without TALEN, Lane 27: negative enzyme, Lane 28: NTC, M: DNA ladder 5 kb; (d) 5′ junction PCR: Lane 1: positive colony for 5′ junction PCR, Lane 2: nontransfected cells, Lane 3: transfected cells without TALEN, Lane 4: negative enzyme, Lane 5: NTC, M: DNA ladder 5 kb.

FIG. 7.

Cotransfection of TALEN and linear donor vector into GFF by nucleofection: (a) under bright light, (b) under fluorescence (200 × ); (c) 3′ junction PCR; (d) 5′ junction PCR, Lane 1–24: transfected cell colonies, Lane 5, 12 and 22: +ve colony for 3′and 5′ junction PCR, Lane 25: nontransfected cells, Lane 26: transfected cells without TALEN, Lane 27: negative enzyme, Lane 28: NTC, M: DNA ladder 5 kb.

Screening targeted cell colonies for mono and biallelic gene insertions

When the four positive colonies were analyzed for the presence of unmodified allele using primers spanning the target site, the presence of 5 kb band and the endogenous 143 bp band in all demonstrated that they had monoallelic gene insertions (Fig. 8). Biallelic modifications were not observed in any of the correctly targeted cell colonies.

FIG. 8.

Screening monoallelic and biallelic gene insertions: Lane 1–4: positive cell colonies for 3′ and 5′ junction PCR, Lane 5: nontransfected cells, Lane 6: negative enzyme, Lane 7: NTC, M: DNA ladder 5 kb.

Production of transgenic goat embryos by HMC

Transgenic cells having specific integration were used as nuclear donors to generate cloned transgenic embryos expressing GFP. The blastocyst rate was significantly lower (p < 0.05) for transgenic cloned embryos than control (3.92% ± 1.12% vs.7.84% ± 0.68%; Table 6), although there was no significant difference between these two groups for the earlier stages of embryonic development.

Table 6.

In Vitro Developmental Competence of Cloned Embryos Produced from Transgenic and Nontransgenic Fetal Fibroblast Cells

Donor cell type	Reconstructed embryos	Cleaved embryos n (%)	4-Cell stage embryos, n (%)	8- to 16-Cell stage embryos, n (%)	Morulae, n (%)	Blastocyst, n (%)
Transgenic fetal fibroblast	153	117 (76.47 ± 1.83)	97 (63.39 ± 1.79)	72 (47.05 ± 1.94)	25 (16.34 ± 2.32)	6 (3.92 ± 1.12)^b
Non-transfected fetal fibroblast (Control)	102	82 (80.39 ± 1.54)	69 (67.64 ± 1.89)	53 (51.96 ± 2.84)	21 (20.58 ± 2.46)	8 (7.84 ± 0.68)^a

Values are mean ± SEM. Values with different superscript within the same column differ significantly (p < 0.05).

SEM, standard error of the mean.

Screening of correctly targeted embryos at Rosa 26 locus

The fluorescence microscope-based evaluation confirmed that all the transgenic cloned embryos expressed GFP, which was further validated by the presence of a 181 bp band of GFP gene in single-embryo PCR (Fig. 9). Furthermore, the presence of consistent size bands in 2 out of 15 (13.30%) embryos (morulae and blastocysts) in single-embryo 5′ and 3′ junction PCR confirmed the successful integration and expression of donor vector at Rosa 26 locus (Fig. 10).

FIG. 9.

Production of goat transgenic embryos using targeted fibroblasts: (a) embryos observed under bright field; (b) embryos expressing GFP (magnification: 200 × ); (c) single embryo PCR for GFP detection: Lanes 1–9: transgenic cloned goat embryos with GFP integrated into genome, Lane 10: positive control (GFP from vector P5′KC3′), Lane 11: nontransgenic cloned goat embryos, Lane 12: negative control, Lane 13: NTC, M: DNA ladder 100 bp.

FIG. 10.

Screening of goat transgenic embryos for targeted modification: (a) By 3′ junction PCR; (b) by 5′ junction PCR: Lane 1–15: transgenic embryos, Lanes 2 and 9: positive embryos for 3′ and 5′ junction PCR, Lane 16: nontransgenic embryos, Lane 17: positive control from transfected cells, Lane 18: negative enzyme, Lane 19: NTC, M: DNA ladder 5 kb.

Discussion

In the present study, we identified the Rosa 26 locus in the goat genome and generated transgenic handmade cloned embryos following TALEN-mediated targeting of GFFs with a donor vector containing a GFP gene cassette. The identified caprine Rosa 26 locus exhibited very high homology with the porcine and ovine Rosa 26 sequences, which confirmed its bonafide identity. After that, we targeted the intron 1 region of the Rosa 26 loci for knockin of the GFP gene cassette considering the porcine Rosa 26 target site (Kong et al., 2014). The Rosa 26 locus supported stable and ubiquitous expression of the GFP gene in the donor GFFs and transgenic cloned embryos.

Numerous earlier studies have demonstrated the pre-eminence of TALENs over other genome-editing tools because of their greater targeting efficiency, higher specificity, and lower cytotoxicity (Kasparek et al., 2014; Mussolino et al., 2014; Shi et al., 2017; Zhu, 2015). Therefore, we chose TALENs for site-directed transgene integration at the Rosa 26 locus and generated a Rosa 26 targeted expression vector (donor vector- P5′KC3′) containing the GFP gene, which any desired transgene could further replace. The GFP gene cassette in the vector was flanked by 864 bp 5′ and 1283 bp 3′ homology arms to facilitate efficient homology-directed repair as the use of longer homology arms results in a higher frequency of homologous recombination (Cui et al., 2015).

In the current study, fetal fibroblast cells were chosen as they grow rapidly and serve as an efficient nuclear donor for SCNT (Liu et al., 2013; Mehta et al., 2018, 2019). Several studies have demonstrated that nucleofection, an improved version of electroporation, exhibit very high transfection efficiency and less cytotoxic effects for various cell types, including fetal and adult fibroblasts, embryonic stem cells, and spermatogonial stem cells (George et al., 2011; Mehta et al., 2018; Sharma et al., 2020). Therefore, we chose nucleofection to deliver the constructed donor vector along with TALEN vectors in GFFs. The transfection of GFFs by TALEN vectors resulted in 13.30% indel frequency at Rosa 26 locus, which confirmed the functionality of TALENs and was subsequently used for cotransfection with Rosa 26 targeting vector.

The frequency of homologous recombination for integrating the GFP gene cassette at Rosa 26 locus was higher for the linear donor vector fragment than the complete circular construct. It could be due to the larger construct size of the circular vector than the linear vector fragment, as reported by Kasparek et al. (2014). Contrastingly, some previous studies have shown no difference in integration between circular and linearized vectors (Cui et al., 2011; Hermann et al., 2012; Meyer et al., 2010).

We found only monoallelic modifications in all the correctly targeted colonies. Since it is challenging to control the mono- and biallelic targeting ratio, the only viable option is to screen the maximum number of colonies. However, improvement in certain factors, such as transfectability, the efficacy of nucleases, and the quality of donor vector, might yield a higher efficiency of homology-directed repair, ultimately resulting in higher biallelic modifications (Luo et al., 2014).

The lower blastocyst rate for the transgenic cloned embryos than the cloned embryos used as control suggests that the presence of transgene or G418 selection might have an adverse effect on their developmental competence. These results agree with several earlier studies (Gui et al., 2012; Jura et al., 2013; Mehta et al., 2019; Xiong et al., 2011). Two out of 15 embryos (13.30%) showed the desired genome editing. The genome-editing efficiency may be further improved by developing a better strategy to select the culture of cells with targeted integration (Luo et al., 2014). After that, using these cells to generate transgenic handmade cloned embryos could culminate in the production of 100% correctly targeted embryos. Finally, based on our results, it can be inferred that the identified goat Rosa 26 locus is amenable to TALEN-mediated gene knockin, and it supported the stable expression of the GFP gene in donor GFFs and transgenic cloned embryos.

The present study was confined to identify a safe locus in the goat genome and optimize TALEN-mediated GFP gene targeting in GFFs and embryos. However, the strategies for targeted cell colony selection and embryo production need to be further improved. In this context, the seeding of transfected cells at a low density before G418 selection could offer better results than the cloning ring method used to obtain single cell-derived colonies. The generation of single cell-derived knockin colonies would ensure that all the transgenic cloned embryos generated using these cells would have the same genotype. Future studies should focus on improving the developmental competence of transgenic handmade cloned goat embryos and generating transgenic animals followed by their transfer to surrogate females.

In conclusion, we identified Rosa 26 locus in the goat genome and demonstrated the transgene insertion in GFFs through TALEN-mediated homologous recombination. The GFP gene incorporated at Rosa 26 locus was expressed ubiquitously in both GFFs and transgenic handmade cloned embryos. Hence, this study provides headway for targeted integration of medicinally/pharmaceutically important genes to generate transgenic goats.

Footnotes

Author Disclosure Statement

The authors declare they have no financial conflicts of interest.

Funding Information

The present work was funded by NFBSFARA, ICAR, New Delhi Grant to M.S.C. (BS-3016).

Supplementary Material

References

Boch

, and Bonas

(2010). Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annu. Rev. Phytopathol. 48, 419–436.

Bressan

F.F.

, Miranda

M.S.

, Bajgelman

M.C.

, Perecin

, Mesquita

L.G.

, Fantinato-Neto

, Merighe

G.F.

, Strauss

B.E.

, and Meirelles

F.V.

(2013). Effects of long-term in vitro culturing of transgenic bovine donor fibroblasts on cell viability and in vitro developmental potential after nuclear transfer. In Vitro Cell. Dev. Biol. Animal, 49, 250–259.

Carlson

D.F.

, Lancto

C.A.

, Zang

, Kim

E.S.

, Walton

, Oldeschulte

, Seabury

, Sonstegard

T.S.

, and Fahrenkrug

S.C.

(2016). Production of hornless dairy cattle from genome-edited cell lines. Nat. Biotechnol. 34, 479–481.

Cui

, Song

, Liu

, Ge

, Li

, Huang

, Hu

, Zhu

, Jin

, and Zhang

(2015). Gene targeting by TALEN-induced homologous recombination in goats directs production of β-lactoglobulin-free, high-human lactoferrin milk. Sci. Rep. 5, 10482.

Cui

, Ji

, Fisher

D.A.

, Wu

, Briner

D.M.

, and Weinstein

E.J.

(2011). Targeted integration in rat and mouse embryos with zinc-finger nucleases. Nat. Biotechnol. 29, 64.

Dulauroy

, Di Carlo

S.E.

, Langa

, Eberl

, and Peduto

(2012). Lineage tracing and genetic ablation of ADAM12+ perivascular cells identify a major source of profibrotic cells during acute tissue injury. Nat. Med. 18, 1262.

Fernandez

J.M.

, and Hoeffler

J.P.

, eds. (1998). Gene Expression Systems: Using Nature for the Art of Expression. Academic Press, San Diego, CA, USA.

Friedrich

, and Soriano

(1991). Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes Dev. 5, 1513–1523.

George

, Sharma

, Singh

K.P.

, Panda

S.K.

, Singla

S.K.

, Palta

, Manik

R.S.

, and Chauhan

M.S.

(2011). Production of cloned and transgenic embryos using buffalo (Bubalus bubalis) embryonic stem cell-like cells isolated from in vitro fertilized and cloned blastocysts. Cell. Reprogram. 13, 263–272.

10.

Gui

, Zhang

, Chen

, Zhang

, Zhou

, Zhang

, Tao

, Sui

, Li

, Liu

, and Zhang

(2012). In vitro evaluation of a mammary gland specific expression vector encoding recombinant human lysozyme for development of transgenic dairy goat embryos. Biotechnol. Lett. 34, 1445–1452.

11.

Hermann

, Maeder

M.L.

, Rector

, Ruiz

, Becher

, Bürki

, Khayter

, Aguzzi

, Joung

J.K.

, Buch

, and Pelczar

(2012). Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos. PLoS One 7, e41796.

12.

Imayoshi

, Tabuchi

, Matsumoto

, Kitano

, Miyachi

, Kageyama

, and Yamanaka

(2020). Light-induced silencing of neural activity in Rosa26 knock-in and BAC transgenic mice conditionally expressing the microbial halorhodopsin eNpHR3. Sci. Rep. 10, 1–9.

13.

Irion

, Luche

, Gadue

, Fehling

H.J.

, Kennedy

, and Keller

(2007). Identification and targeting of the ROSA26 locus in human embryonic stem cells. Nat. Biotechnol. 25, 1477–1482.

14.

Jura

, Smorąg

, Gajda

, Lipiński

, and Słomski

(2013). Potencjał Rozwojowy CMV-Fut Transgenicznych I Nietransgenicznych Zarodków Świni Hodowanych In Vitro [Developmental competence of CMV-Fut transgenic and non-transgenic pig embryos cultured in vitro]. Ann. Anim. Sci. 13, 765–769.

15.

Kalds

, Zhou

, Cai

, Liu

, Wang

, Petersen

, Sonstegard

, Wang

, and Chen

(2019). Sheep and goat genome engineering: from random transgenesis to the CRISPR era. Front. Genet. 10, 750.

16.

Kasparek

, Krausova

, Haneckova

, Kriz

, Zbodakova

, Korinek

, and Sedlacek

(2014). Efficient gene targeting of the Rosa26 locus in mouse zygotes using TALE nucleases. FEBS Lett. 588, 3982–3988.

17.

Kobayashi

, Kato-Itoh

, Yamaguchi

, Tamura

, Sanbo

, Hirabayashi

, and Nakauchi

(2012). Identification of rat Rosa26 locus enables generation of knock-in rat lines ubiquitously expressing tdTomato. Stem Cells Dev. 21, 2981–2986.

18.

Kong

, Hai

, Ma

, Huang

, Jiang

, Xie

, Wu

, Wang

, Song

, Wang

, and He

(2014). Rosa26 locus supports tissue-specific promoter driving transgene expression specifically in pig. PLoS One 9, e107945.

19.

Lantinga-van Leeuwen

I.S.

, Leonhard

W.N.

, van de Wal

, Breuning

M.H.

, Verbeek

, de Heer

, and Peters

D.J.

(2006). Transgenic mice expressing tamoxifen-inducible Cre for somatic gene modification in renal epithelial cells. Genesis, 44, 225–232.

20.

, Yang

, Hong

W. H

, uang

, Wu

, and Zhao

(2020). Applications of genome editing technology in the targeted therapy of human diseases: mechanisms, advances and prospects. Signal Transduct. Target Ther. 5, 1.

21.

, Yang

, Bu

, Guo

, Tang

, Song

, Fan

, Zhao

, Ouyang

, Liu

, and Zhao

(2014). Rosa26-targeted swine models for stable gene over-expression and Cre-mediated lineage tracing. Cell Res. 24, 501–504.

22.

Liu

, Wang

, Guo

, Chang

, Liu

, Guo

, Quan

, and Zhang

(2013). Zinc-finger nickase-mediated insertion of the lysostaphin gene into the beta-casein locus in cloned cows. Nat. Commun. 4, 1–11.

23.

Luo

, Rao

, and Zou

(2014). Generation of GFP reporter human induced pluripotent stem cells using aavs1 safe harbor transcription activator-like effector nuclease. Curr. Protoc. Stem Cell Biol. 29, 5A-7.

24.

Mehta

, Kaushik

, Singh

K.P.

, Sharma

, Singh

M.K.

, Chauhan

M.S.

, Palta

, Singla

S.K.

, and Manik

R.S.

(2018). Establishment, growth, proliferation, and gene expression of buffalo (Bubalus bubalis) transgenic fetal fibroblasts containing human insulin gene, and production of embryos by handmade cloning using these cells. Cell. Reprogram. 20, 135–143.

25.

Mehta

, Kaushik

, Singh

K.P.

, Sharma

, Singh

M.K.

, Chauhan

M.S.

, Palta

, Singla

S.K.

, and Manik

R.S.

(2019). Comparative analysis of buffalo (Bubalus bubalis) non-transgenic and transgenic embryos containing human insulin gene, produced by SCNT. Theriogenology, 135, 25–32.

26.

Mehta

, Sharma

, and Kaushik

(2017). Transgenesis in farm animals-a review. Agric. Rev. 38, 129–136.

27.

Meyer

, de Angelis

M.H.

, Wurst

, and Kühn

(2010). Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases. Proc. Natl. Acad. Sci. U. S. A. 107, 15022–15026.

28.

Mussolino

, Alzubi

, Fine

E. J.

, Morbitzer

, Cradick

T. J.

, Lahaye

, Bao

, and Cathomen

(2014). TALENs facilitate targeted genome editing in human cells with high specificity and low cytotoxicity. Nucleic Acids Res. 42, 6762–6773.

29.

Papapetrou

E.P.

, and Schambach

(2016). Gene insertion into genomic safe harbors for human gene therapy. Mol. Ther. 24, 678–684.

30.

Sadelain

, Papapetrou

E.P.

, and Bushman

F.D.

(2012). Safe harbours for the integration of new DNA in the human genome. Nat. Rev. Cancer, 12, 51–58.

31.

Selokar

N.L.

, Saini

, Muzaffer

, Krishnakanth

, Saha

A.P.

, Chauhan

M.S.

, Manik

R.S.

, Palta

, Madan

, and Singla

S.K.

(2012). Roscovitine treatment improves synchronization of donor cell cycle in G0/G1 stage and in vitro development of handmade cloned buffalo (Bubalus bubalis) embryos. Cell. Reprogram. 14, 146–154.

32.

Shah

R.A.

, George

, Singh

M.K.

, Kumar

, Anand

, Chauhan

M.S.

, Manik

R.S.

, Palta

, and Singla

S.K.

(2009). Pregnancies established from handmade cloned blastocysts reconstructed using skin fibroblasts in buffalo (Bubalus bubalis). Theriogenology, 71, 1215–1219.

33.

Sharma

, Kumaresan

, Mehta

, Nala

, Singh

M.K.

, Palta

, Singla

S.K.

, Manik

R.S.

, and Chauhan

M.S.

(2020). Successful transplantation of transfected enriched buffalo (Bubalus bubalis) spermatogonial stem cells to homologous recipients. Theriogenology, 142, 441–449.

34.

Shepelev

M.V.

, Kalinichenko

S.V.

, Deykin

A.V.

, and Korobko

I.V.

(2018). Production of recombinant proteins in the milk of transgenic animals: current state and prospects. Acta Naturae, 10, 40–47.

35.

Shi

, Li

, Shi

, Jia

, Wen

, Hu

, Zhuang

, Xi

, and Zhang

(2017). TALEN-mediated knockout of CCR5 confers protection against infection of human immunodeficiency virus. J. Acquir. Immune Defic. Syndr. 74, 229–241.

36.

Smithies

(2001). Forty years with homologous recombination. Nat. Med. 7, 1083–1086.

37.

Srirattana

, Sripunya

, Sangmalee

, Imsoonthornruksa

, Liang

, Ketudat-Cairns

, and Parnpai

(2013). Developmental potential of vitrified goat oocytes following somatic cell nuclear transfer and parthenogenetic activation. Small Rumin. Res. 112, 141–146.

38.

Wang

, Sun

, Zou

, Ding

, Li

, Wang

, Zhao

, Li

, and Dai

(2018). Efficient targeted integration into the bovine Rosa26 locus using TALENs. Sci. Rep. 8, 1–10.

39.

Whitelaw

C.B.A.

, Sheets

T.P.

, Lillico

, and Telugu

B.P.

(2016). Engineering large animal models of human disease. J. Pathol. 238, 247–256.

40.

, Wei

, Lian

, Liu

, Zhu

, Wang

, Cao

, Shen

, Zhao

, Zhang

, and Mu

(2016). Rosa26-targeted sheep gene knock-in via CRISPR-Cas9 system. Sci. Rep. 6, 1–7.

41.

Xie

, Pang

, Wang

, Li

, Guo

, Yuan

, Li

, Zou

, Jiao

, Ouyang

, and Li

(2017). Optimization of a CRISPR/Cas9-mediated knock-in strategy at the porcine Rosa26 locus in porcine foetal fibroblasts. Sci. Rep. 7, 3036.

42.

Xiong

, Li

, Wang

, Su

, Hua

, and Zhang

(2011). Human lysozyme gene (hLYZ) transgenic bovine embryos produced by somatic cell nuclear transfer. J. Agric. Biotech. 19, 294–301.

43.

Yang

, Song

, Zhang

, Xu

, Zhu

, Wang

, Lai

, and Chen

Y.E.

(2016). Identification and characterization of rabbit ROSA26 for gene knock-in and stable reporter gene expression. Sci. Rep. 6, 25161.

44.

Zambrowicz

B.P.

, Imamoto

, Fiering

, Herzenberg

L.A.

, Kerr

W.G.

, and Soriano

(1997). Disruption of overlapping transcripts in the ROSA βgeo 26 gene trap strain leads to widespread expression of β-galactosidase in mouse embryos and hematopoietic cells. Proc. Natl. Acad. Sci. U. S. A. 94, 3789–3794.

45.

Zhang

, Liu

, Yang

, Cui

, Dai

, Dong

, Yang

, Zhang

, Liu

, Liang

, and Cang

(2019). Comparison of gene editing efficiencies of CRISPR/Cas9 and TALEN for generation of MSTN knockout cashmere goats. Theriogenology, 132, 1–11.

46.

Zhou

, Sun

, Chen

, Fei

, and Lu

(2015). Myostatin gene mutated mice induced with tale nucleases. Anim. Biotechnol. 26, 169–179.

47.

Zhu

L.J.

(2015). Overview of guide RNA design tools for CRISPR-Cas9 genome editing technology. Front. Biol. 10, 289–296.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.01 MB

0.35 MB

0.27 MB