Rapamycin Treatment Is Beneficial for the Generation of Rabbit-Induced Pluripotent Stem-Like Cells

Abstract

Autophagy could promote the generation of induced pluripotency stem cells (iPSCs) in humans and mice. However, little was known whether it had similar effects in other species, the detailed mechanism and the features of formed iPSC colonies were also not clear. In this study, we first established the doxycycline (DOX)-inducible tetO lentiviral vector system suitable for the generation of rabbit iPSCs. Rapamycin, a mechanistic target of rapamycin (mTOR) inhibitor, was added during rabbit embryonic fibroblasts induction to improve the autophagy level. The colony formation efficiency and the expression of autophagy- and pluripotent-related genes were detected. The results showed that the established DOX-inducible tetO lentiviral system was successfully used to induce rabbit iPS-like cells. Compared with the untreated group, the number of alkaline phosphatase (AP)-positive colonies was increased 5.5-fold, when 0.5 nM rapamycin was added on days 1–3 after transduction, the colony morphology was improved and the iPS-like cells could be passaged >10 generations. The expression of autophagy-related genes (ATG), ATG5, ATG7, LC3, and ULK1 was increased with different patterns during the induction process, expression of OCT4, SOX2, and KLF4 significantly increased (p < 0.05). The mentioned results indicate that rapamycin treatment is beneficial for the generation of rabbit iPSCs by regulating autophagy and pluripotency-related gene expression.

Introduction

Since mouse-induced pluripotency stem cells (iPSCs), which exhibited properties similar to embryonic stem cells, were successfully obtained in 2006, this technology has been successfully applied to pigs, cattle, sheep, horses, and other animals, even humans (Takahashi and Yamanaka, 2006; Zhang et al., 2015). Owing to profound scientific value and wide application prospects in the fields of cell replacement therapy, gene therapy, and developmental biology, the iPSC has become one of the hotspots in stem cell biology research (Liu et al., 2020).

However, the low induction efficiency and safety have largely hindered the development and application of this technology (Chakritbudsabong et al., 2021). On one hand, to improve the safety of iPSC, nonintegrated adenoviral system, RNA interference, and microRNA methods, and using L-Myc instead of C-Myc were explored (Nakagawa et al., 2010). At the same time, by optimizing the introduced genes or compounds, including using small molecules related to the epigenetic modification, histone deacetylase inhibitors (Mohseni et al., 2015), and glycogen synthase kinase 3β (GSK-3β) inhibitors (Li et al., 2012), higher induction efficiency was obtained.

Autophagy is an important mechanism for degradation of intracellular components, its occurrence requires the involvement of autophagosomes. Autophagosome formation depends on a carefully orchestrated interplay between membrane-associated protein complexes, among them, autophagy-related genes (ATGs) play a critical role (Mizushima, 2020). Several studies found that ATG3, ATG5, and ATG7 were essential for the formation of autophagosomes (Sakoh-Nakatogawa et al., 2013). Many signal transduction pathways were involved in the regulation of autophagy, and some converge on the target of rapamycin (TOR), a highly conserved kinase that was important for autophagy regulation (Al-Bari and Xu, 2020).

By using both genetic and pharmacological approaches, autophagy was found to play a significant role in regulating reprogramming efficiency. In 2011, Chen explored the treatment time and concentration of rapamycin, they found that adding 0.3 nM rapamycin from days 1 to 3 after induction promoted the formation of iPSCs in mice, and the number of alkaline phosphatase (AP)-positive colonies could be increased approximately fivefold (Chen et al., 2011). Knockdown of Atg3, Atg5, or Atg7 blocked autophagy and inhibited iPSC formation in mice (Wang et al., 2013).

Rapamycin acted early in the reprogramming process, Sox2 bounded to the repressor region on the mechanistic TOR (mTOR) promoter, and recruited the nucleosome remodeling and deacetylase (NuRD) complex to mediate transcriptional repression, thereby enhancing the induction efficiency of mouse iPSCs (Wang et al., 2013). Silencing the NuRD complex and restoring mTOR expression affected the occurrence of autophagy as well as production of iPSCs (Luo et al., 2013). Inactivation of mTOR and activation of adenine monophosphate-activated protein kinase (AMPK) could promote autophagy induction.

Rapamycin and AICAR (Acadesine, an AMPK activator) could increase the induction efficiency of mouse iPSCs, whereas the autophagy inhibitor 3-methyladenine (3-MA) and the AMPK inhibitor dorsomorphin had the opposite effect (Ma et al., 2015). All of these studies demonstrated that autophagy was important for reprogramming, and activation of the AMPK-mTOR signaling pathway promoted the induction efficiency of mouse iPSCs.

To understand whether regulating autophagy could affect the induction efficiency of rabbit iPSCs and their mechanism, rabbit embryonic fibroblasts (REFs) were used for generating iPS-like cells by the doxycycline (DOX)-inducible lentiviral system. The effects of rapamycin on induction efficiency, iPSC-like colony characteristics, and expression of autophagy- and pluripotent-related genes were examined. Our findings may lay the foundation for further study of the role of autophagy in regulating rabbit cell reprogramming.

Materials and Methods

This study was approved and monitored by the Animal Experiments Ethical Review Committee of Guangxi University (Gxu2014-126), Nanning, China.

Cell culture and lentiviral package

REFs were obtained from the fetal skin of New Zealand white rabbits, which were purchased from the laboratory animal center of Guangxi Medical University (Guangxi, China). REFs were cultured in high-glucose Dulbecco's modified Eagle medium (DMEM) (Gibco) supplemented with 20% fetal bovine serum (Hyclone). For virus production, the FUW-M2rtTA, FUW-tetO-hOCT4, FUW-tetO-hSOX2, FUW-tetO-hKLF4, and FUW-tetO-hMYC lentiviral vectors were purchased from Addgene. The package plasmid (NRF) and envelope plasmid (VSVG) were preserved in our laboratory, and obtained from Professor Kafri, T (UNC at Chapel Hill). The DOX-inducible enhanced green fluorescent protein (EGFP) lentiviral vector was constructed by Bioengineering Co. (Shanghai, China).

The backbone of the vector was FUW-tetO-Oct4, and the EGFP was from pMD18T-EGFP. The constructed vector was verified by sequencing. Lentivirus was produced in 293T by transient transfection with target plasmid along with NRF and VSVG using liposome transfection reagent (Thermo). At 60 hours after transfection, the supernatant containing lentivirus was collected and filtered through a 0.45 μm filter. Lentivirus was concentrated by ultracentrifugation at 65,000 g for 3 hours at 4°C. Cells were transduced with the lentivirus in the presence of 8 μg/mL polybrene for at least 12 hours.

Lentivirus transduction and rabbit iPSC culture

The REFs that had been passaged three to six times were infected with lentivirus (multiplicity of infection: 40 pfu/cell). At 24 hours after transduction, the cells were passaged onto feeder-free Matrigel (BD) in mTesR™1 (STEMCELL) plus 2 μg/mL DOX (Sigma). At 8–10 days after transduction, the iPSC-like colonies were picked using a Pasteur pipette and cultured in the 96-well plate for further expansion. All rabbit iPS-like cells were cultured in DOX-containing medium.

Alkaline phosphatase (AP) and immunofluorescence staining

Rabbit iPSC-like colonies were fixed with 4% paraformaldehyde. For AP activity, colonies were washed with phosphate buffered solution three times, and stained with nitro-blue tetrazolium (NBT)/5-bromo-4-chloro-3-indolyl phosphate (BCIP) solution for 15–30 minutes. The stained cells were placed under an inverted microscope (Nikon, Tokyo, Japan) for analysis. To examine the expression of pluripotency markers, rabbit iPS-like cells were permeated with 1% Triton X-100 for 20 minutes, blocked with 1% bovine serum albumin (BSA) solution for 30 minutes, then incubated with primary antibodies OCT4 (#2750; CST, Danvers, MA), SOX2 (#4194; CST), SSEA1 (#4744; CST), STAT3(#12640; CST), and E-cadherin (#3195; CST) (dissolved in 1% BSA) overnight at 4°C.

On the second day, the cells were incubated with the secondary antibody antimouse IgG or antirabbit IgG (diluted with 1% BSA; CST) in the dark for 45 minutes. Hoechst 333342 (10 ng/mL; CST) was used for nuclear staining. Cell fluorescence was analyzed using a fluorescence microscope (Nikon).

Optimal treatment concentration of rapamycin

REFs were treated with different concentrations of rapamycin (0.1, 0.3, 0.5, 0.7, and 0.9 nM; Sigma) from days 1 to 3 after induction, AP staining was performed after the formation of colonies. The optimal treatment concentration was selected according to the number of positive colonies and colony morphology.

Real-time polymerase chain reaction and quantitative real-time polymerase chain reaction

Total RNA was extracted from REFs at different stages of induction (including untreated and rapamycin-treated groups) using TRIZOL reagent (Life Technology) and converted to cDNA using the reverse transcriptase XL (AMV) kit (Takara) according to the manufacturer's instructions. The quantitative real-time polymerase chain reaction (QRT-PCR) was performed on a 7500 real-time PCR system (ABI7500; Applied Bio-systems, Carlsbad, CA) with SYBR Premix Ex Taq (Takara).

Real-time polymerase chain reaction (RT-PCR) was performed to detect the expression of pluripotent endogenous OCT4, SOX2, KLF4, and c-MYC in REFs and rabbit iPSCs, the blank control (BC) was nuclease-free water and the positive control (PC) was a positive rabbit iPSC colony, which was obtained by the retroviral method and preserved by our laboratory. The relative expression levels of the target genes were calculated by the 2^−ΔΔCt method normalized on glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression and relative to REFs. Specific primers were designed using Oligo 6.0 software (Table 1). Three rbiPSC lines used for QRT-PCR were samples treated with 0.5 nM rapamycin, and each rbiPSC sample was repeated three times when each gene was tested.

Table 1.

Primers for Endogenous Related Genes

Primers	Primer sequence	Fragment size/bp
OCT4	F: CCTGCTCTGGGCTCCCCCAT	76
OCT4	R: TGACCTCTGCCTCCACCCCG	76
SOX2	F: TTTGTCGGAGACGGAGAAG	143
SOX2	R: CGGGCAGCGTGTACTTATC	143
KLF4	F: TCCGGCAGGTGCCCCGAATA	131
KLF4	R: CTCCGCCGCTCTCCAGGTCT	131
c-MYC	F: AGCAAACCTCCACACAGCC	209
c-MYC	R: CGCCTCTTGTCGTTCTCCT	209
GAPDH	F:GGAGCCAAACGGGTCATCATCTC	233
GAPDH	R: GAGGGGCCATCCACAGTCTTCT	233
ATG3	F: GAAGATGGGGGAAAAAAGAAT	134
ATG3	R: GTCGGCTGTGGGATGATACT	134
ATG7	F: CCCTGAAGCGTGCGTATG	194
ATG7	R: CCATCCAGGGTACTGTGCTAAG	194
LC3	F: CACCGAAGCCTTTTACCTCC	144
LC3	R: TCCAAGCAGCCAAACATCTC	144
ULK1	F: AGACCTCAGCCCCCCTCA	150
ULK1	R: GGTACGAGGGCACAGGCA	150

Statistical analysis

Each experiment was performed for at least three independent replicates. The expression of autophagy- and pluripotent-related genes at the mRNA level was analyzed by one-way analysis of variance (ANOVA). The number of positive colonies was analyzed by an independent t-test. All statistical analyses were performed using SPSS 17.0 software, and presented as the mean ± standard error of mean. p-Value <0.05 was considered statistically significant.

Results

Generation of rabbit iPS-like cells using DOX-inducible OCT4/SOX2/KLF4/c-MYC (OSKM) system

We first established the inducible expression system for rabbit iPSCs generation by transferring OSKM into REFs. It was found that the rabbit REFs took ∼8–10 days to form iPS-like cells (Fig. 1a). The infection started on day 0 and DOX was added on day 1. At 2–3 days after transduction, the infected cells began to change in morphology and proliferated rapidly. Mesenchymal epithelial transformation was completed ∼day 4, and iPSC-like colonies were observed on day 8 (Fig. 1b).

FIG. 1.

Generation of rabbit iPS-like cells. All rabbit iPS-like cells were cultured in DOX-containing medium. (a) Timeline of rabbit iPS-like cells generation. (b) Cell morphology and EGFP fluorescence during iPSCs induction (Scale bar: 100 μm). (c) Rabbit iPSC-like colonies at different passages (Scale bar: 100 μm). (d) Different morphology of colonies (Scale bar: 100 μm). (e) Expression of the pluripotency genes in iPS-like cells. (f) AP staining colony (Scale bar: 200 μm). (g) IF results showing pluripotent markers expression in iPS-like cells (Scale bar: 100 μm). AP, alkaline phosphatase; DOX, doxycycline; EGFP, enhanced green fluorescent protein; IF, immunofluorescence; iPSCs, induced pluripotency stem cells.

In total, 150 iPSC-like colonies were selected to culture, only 6 colonies could maintain their morphology during passage, and could be cultured for >10 generations (Fig. 1c). The morphology of the six colonies was different. No. 2 and No. 20 colonies were flat, tightly packed, with enlarged nuclei and scant cytoplasm, similar to human embryonic stem (ES) cells. Whereas No. 128 and No. 132 colonies showed flat and loosely packed morphology (Fig. 1d). All rabbit iPSC-like colonies were positive for OCT4, SOX2, KLF4, and c-MYC expression as well as AP staining (Fig. 1e, f). Immunofluorescence (IF) staining showed that the rabbit iPS-like cells expressed pluripotent markers such as OCT4, SOX2, STAT3, and SSEA1, but not E-cadherin (Fig. 1g).

Effects of rapamycin treatment on rabbit iPS-like cells

REFs were treated with different concentrations of rapamycin from days 1 to 3 after virus infection. No AP-positive colonies were observed in the untreated group, the number of AP-positive colonies increased in all treated groups and in a dose-dependent manner up to 0.5 nM. Among them, the induction efficiency was increased 5.5-fold when 0.5 nM rapamycin was added, the formed iPSC-like colonies showed rounded and tightly packed morphology. And 0.5 nM rapamycin was selected as the optimal concentration in the following experiments (Fig. 2a–c).

FIG. 2.

Rapamycin promoted the generation of AP-positive iPSC colonies in rabbit. (a) AP staining results of iPSC colonies treated with different concentrations of rapamycin. (b) The number of colonies obtained by treating REFs with different concentrations of rapamycin. ^{a, b}Different letters on the bar indicate significant values (p < 0.05). (c) AP staining of 0.5 nM rapamycin-treated colony (Scale bar: 200 μm). (d) Effect of rapamycin treatment on rabbit iPS-like cells morphology (Scale bar: 100 μm). (e) IF staining of E-cadherin in rapamycin-treated iPS-like cells (Scale bar: 100 μm). REFs, rabbit embryonic fibroblasts.

REFs in the rapamycin-treated group began to deform at 24 hours after transduction, earlier than the untreated group. The deformed cells showed the round shape and increased in number at day 3, the formed rabbit iPSC-like colonies were larger with more round and compact features (Fig. 2d). The total induction time needed for iPSC-like colony formation had no difference between the two groups. Differently, E-cadherin was detected in rabbit iPS-like cells treated with rapamycin (Fig. 2e).

Effects of rapamycin treatment on autophagy- and pluripotent-related genes expression

We examined the expression of autophagy-related ATG5, ATG7, LC3, ULK1 and pluripotency endogenous OCT4, SOX2, and KLF4 during induction by the QRT-PCR method. The results revealed that rapamycin treatment had different effects on the expression of different genes. For the expression of ATGs, ULK1 was significantly higher in the treated group during induction; LC3 and ATG7 were significantly increased in the treated group than in the untreated group on days 1 to 3 after induction (p < 0.05), and subsequently decreased in the untreated group.

However, there was no significant difference for ATG5 expression in two groups on days 1 to 3 after induction, and which was significantly lower in the treated group than in the untreated group at 5 and 7 days (p < 0.05). For the expression of pluripotency-related genes, we found that SOX2 and KLF4 were significantly upregulated in the treated group during induction (p < 0.05); OCT4 was significantly increased in the treated group than in the untreated group on days 1 to 3 after induction (p < 0.05), and then almost same as the untreated group (Fig. 3).

FIG. 3.

Expression of autophagy—pluripotent-related genes were detected by QRT-PCR. ^a,bDifferent letters on the bar indicate significant values (p < 0.05). QRT-PCR, quantitative real-time polymerase chain reaction.

Discussion

To obtain iPSCs, the exogenous reprogramming factors were usually transduced into the somatic cells using viral vectors, including retroviruses (Takahashi and Yamanaka, 2006), lentiviruses (Shao et al., 2021), adenoviruses (Fink et al., 2014), and Sendai viruses (Bhargava et al., 2019). In 2008, DOX-inducible lentiviral vectors were used to induce human and mouse fibroblasts into iPSCs (Hockemeyer et al., 2008), which were found to reduce the random integration of exogenous genes and improve the induction efficiency compared with retrovirus and lentivirus (Wernig et al., 2007). Subsequently, the system was successfully used for the induction of pig iPSCs (Ma et al., 2018).

To understand whether this system was also suitable for generation of rabbit iPSCs, in this study, DOX-inducible OSKM transcription factors were transduced into REFs and found that it took ∼8–10 days to form iPSC-like colonies, which could be passed at least 10 generations. In 2010, Honda reported that it took 8–15 days to obtain the rabbit iPSC colonies by transferring human OSKM lentiviral vectors into rabbit somatic cells (Honda et al., 2010). Osteil got the rabbit iPSC colonies 20 days after retroviral infection, and the colonies showed characteristics of naive pluripotency (Osteil et al., 2013). Our results revealed that the DOX-inducible lentiviral system could more effectively induce rabbit somatic cells into iPSCs than other methods.

Autophagy, a cellular process that degrades unwanted proteins through ATGs, is one of the regulators of cell reprogramming. Autophagy dysfunction caused by ATG3 and ATG5 deletion reduced iPSC colony formation in mice (Liu et al., 2016; Ma et al., 2015). Knockdown of two different autophagy genes, ATG5 and Beclin1, hindered embryonic body (EB) formation (Qu et al., 2007). The autophagic pathway could be activated by AMPK, but usually through inhibition of mTOR (Liu and Yamashita, 2019). Balanced autophagy and mTOR activity were essential for the generation of pluripotent stem cells (Wang et al., 2015). As an inhibitor of mTOR, rapamycin was often used to induce autophagy.

In 2011, Chen found that 0.3 nM rapamycin treatment increased the induction efficiency of mouse iPSCs by fivefold; 0.1 nM PP242 had the same effect. Other longevity-promoting compounds were associated with autophagy, such as PQ401 (an IGF1 receptor inhibitor), spermidine (an autophagy inducer), and LY294002 (an inhibitor of PI3K), which also increased reprogramming to varying degrees (Chen et al., 2011). Rapamycin also has been studied in human iPSCs. Adding 200 nM rapamycin could attenuate cell death induced by bafilomycin (an inhibitor of lysosomal degradation by blocking the final stage of autophagy), thereby improving the survival of human iPSCs, and increased human iPSCs density at 48 hours of bafilomycin treatment (Sotthibundhu et al., 2016).

As a model for human cell regeneration medicine, rabbits have advantages over other laboratory species (Phakdeedindan et al., 2019). However, the role of autophagy in the induction of rabbit iPSCs has not been reported. In this study, we found that the number of AP-positive colonies was increased by 5.5-fold in the rapamycin-treated group, and the formed iPSC colony morphology was improved; the expression of autophagy and pluripotency-related genes was altered.

Conclusion

In conclusion, the DOX-inducible lentiviral vector system is suitable for the generation of rabbit iPSCs, and regulating autophagy could enhance the induction efficiency of rabbit iPSCs.

Footnotes

Authors' Contributions

X.R. and W.L. designed the experiments, performed experiments, analyzed data, and drafted the article; S.H. conducted parts of the experiments; D.S. revised the article; X.L. drafted and revised the article.

Author Disclosure Statement

The authors declare they have no conflicting financial interests.

Funding Information

This study was supported by the National Natural Science Funding (Grant Nos. 32060754 and 31760334) and Guangxi Natural Science Funding (Grant Nos. 2020GXNSFAA238039, 2020GXNSFDA297009, and 2019GXNSFDA185005).

References

Al-Bari

M.A.A.

, and Xu

(2020). Molecular regulation of autophagy machinery by mTOR-dependent and -independent pathways. Ann. N. Y. Acad. Sci. 1467, 3–20.

Bhargava

, Jaitly

, Goswami

S.G.

, Jain

, Chakraborty

, and Ramalingam

(2019). Generation and characterization of induced pluripotent stem cell line (IGIBi001-A) from a sickle cell anemia patient with homozygous beta-globin mutation. Stem. Cell Res. 39, 101484.

Chakritbudsabong

, Chaiwattanarungruengpaisan

, Sariya

, Pamonsupornvichit

, Ferreira

J.N.

, Sukho

, Gronsang

, Tharasanit

, Dinnyes

, and Rungarunlert

(2021). Exogenous LIN28 is required for the maintenance of self-renewal and pluripotency in presumptive porcine-induced pluripotent stem cells. Front. Cell Dev. Biol. 9, 709286.

Chen

, Shen

, Yu

, Wan

, Guo

, Chen

, Long

, Zhao

, and Pei

(2011). Rapamycin and other longevity-promoting compounds enhance the generation of mouse induced pluripotent stem cells. Aging Cell. 10, 908–911.

Fink

K.D.

, Rossignol

, Lu

, Lévêque

, Hulse

T.D.

, Crane

A.T.

, Nerriere-Daguin

, Wyse

R.D.

, Starski

P.A.

, Schloop

M.T.

, Dues

D.J.

, Witte

S.J.

, Song

, Vallier

, Nguyen

T.H.

, Naveilhan

, Anegon

, Lescaudron

, and Dunbar

G.L.

(2014). Survival and differentiation of adenovirus-generated induced pluripotent stem cells transplanted into the rat striatum. Cell Transplant. 23, 1407–1423.

Hockemeyer

, Soldner

, Cook

E.G.

, Gao

, Mitalipova

, and Jaenisch

(2008). A drug-inducible system for direct reprogramming of human somatic cells to pluripotency. Cell Stem Cell. 3, 346–353.

Honda

, Hirose

, Hatori

, Matoba

, Miyoshi

, Inoue

, and Ogura

(2010). Generation of induced pluripotent stem cells in rabbits: Potential experimental models for human regenerative medicine. J. Biol. Chem. 285, 31362–31369.

Y.C.

, Wang

M.J.

, and Gao

W.J.

(2012). Hyperdopaminergic modulation of inhibitory transmission is dependent on GSK-3beta signaling-mediated trafficking of GABAA receptors. J. Neurochem. 122, 308–320.

Liu

, David

B.T.

, Trawczynski

, and Fessler

RG.

(2020). Advances in pluripotent stem cells: History, mechanisms, technologies, and applications. Stem Cell Rev. Rep. 16, 3–32.

10.

Liu

, Zhao

, Liu

, Cao

, Gong

, Wang

, Li

, Sun

, Zhang

, Li

, Jiang

, Zhu

, Sun

, Jiao

, Hu

, Zhao

, Li

, Chen

, Zhou

, and Zhao

(2016). ATG3-dependent autophagy mediates mitochondrial homeostasis in pluripotency acquirement and maintenance. Autophagy. 12, 2000–2008.

11.

Liu

, and Yamashita

J.K.

(2019). AMPK activators contribute to maintain naive pluripotency in mouse embryonic stem cells. Biochem. Biophys. Res. Commun. 509, 24–31.

12.

Luo

, Ling

, Xie

, Sun

, Zhou

, Zhu

, Shen

, Zong

, Lyu

, Zhao

, Ye

, Gu

, Tao

, Lu

, and Grummt

(2013). NuRD blocks reprogramming of mouse somatic cells into pluripotent stem cells. Stem Cells. 31, 1278–1286.

13.

, Li

, Xu

, Yu

, Xu

, Wang

, Liu

, Cao

, Nie

, Zhu

, Xu

, Li

, Wei

, Wu

, Guan

, and Ding

(2015). Atg5-independent autophagy regulates mitochondrial clearance and is essential for iPSC reprogramming. Nat. Cell Biol. 17, 1379–1387.

14.

, Yu

, Cai

, and Wang

(2018). Preserving self-renewal of porcine pluripotent stem cells in serum-free 3i culture condition and independent of LIF and b-FGF cytokines. Cell Death Discov. 4, 21.

15.

Mizushima

(2020). The ATG conjugation systems in autophagy. Curr. Opin Cell Biol. 63, 1–10.

16.

Mohseni

, Shoae-Hassani

, and Verdi

(2015). Reprogramming of endometrial adult stromal cells in the presence of a ROCK inhibitor, thiazovivin, could obtain more efficient iPSCs. Cell Biol. Int. 39, 515–518.

17.

Nakagawa

, Takizawa

, Narita

, Ichisaka

, and Yamanaka

(2010). Promotion of direct reprogramming by transformation-deficient Myc. Proc. Natl. Acad. Sci. U. S. A. 107, 14152–14157.

18.

Osteil

, Tapponnier

, Markossian

, Godet

, Schmaltz-Panneau

, Jouneau

, Cabau

, Joly

, Blachere

, Gocza

, Bernat

, Yerle

, Acloque

, Hidot

, Bosze

, Duranthon

, Savatier

, and Afanassieff

(2013). Induced pluripotent stem cells derived from rabbits exhibit some characteristics of naive pluripotency. Biol. Open. 2, 613–628.

19.

Phakdeedindan

, Setthawong

P. T

, iptanavattana

, Rungarunlert

, Lngrungruanglert

, Lsrasena

, Techakumphu

, and Tharasanit

(2019). Rabbit induced pluripotent stem cells retain capability of in vitro cardiac differentiation. Exp. Anim. 68, 35–47.

20.

, Zou

, Sun

, Luby-Phelps

, Cheng

, Hogan

R.N.

, Gilpin

, and Levine

(2007). Autophagy gene-dependent clearance of apoptotic cells during embryonic development. Cell. 128, 931–946.

21.

Sakoh-Nakatogawa

, Matoba

, Asai

, Kirisako

, Ishii

, Noda

N.N.

, Lnagaki

, Nakatogawa

, and Ohsumi

(2013). Atg12-Atg5 conjugate enhances E2 activity of Atg3 by rearranging its catalytic site. Nat. Struct. Mol. Biol. 20, 433–439.

22.

Shao

, Cevallos

R.R.

, and Hu

(2021). Reprogramming human fibroblasts to induced pluripotent stem cells using the GFP-marked lentiviral vectors in the chemically defined medium. Methods Mol. Biol. 2239, 101–116.

23.

Sotthibundhu

, McDonagh

, von Kriegsheim

, Garcia-Munoz

, Klawiter

, Thompson

, Chauhan

K.D.

, Krawczyk

, Mclnerney

, Dockery

, Devine

M J.

, Kunath

, Barry

, O'Brien

, and Shen

(2016). Rapamycin regulates autophagy and cell adhesion in induced pluripotent stem cells. Stem Cell Res. Ther. 7, 166.

24.

Takahashi

, and Yamanaka

(2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663–676.

25.

Wang

, Xia

, Rehm

, and Fan

(2015). Autophagy and cell reprogramming. Cell Mol. Life Sci. 72, 1699–1713.

26.

Wang

, Xia

, Ye

, Huang

, Liu

, and Fan

(2013). Transient activation of autophagy via Sox2-mediated suppression of mTOR is an important early step in reprogramming to pluripotency. Cell Stem Cell. 13, 617–625.

27.

Wernig

, Meissner

, Foreman

, Brambrink

, Ku

, Hochedlinger

, Bernstein

B.E.

, and Jaenisch

(2007). In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, 318–324.

28.

Zhang

, Guo

, Cui

, Liu

, Yu

, and Wang

(2015). Generation of intermediate porcine iPS cells under culture condition favorable for mesenchymal-to-epithelial transition. Stem Cell Rev. Rep. 11, 24–38.