Expanding the Toolkit for Genome Editing in a Disease Vector,Aedes aegypti: Transgenic Lines Expressing Cas9 and Single Guide RNA Induce Efficient Mutagenesis

Abstract

CRISPR-Cas9 mediated genome editing methods are being used for the analysis of gene function. However, it is hard to identify gene knockout mutants for genes whose knockout does not cause distinct phenotypes. To overcome this issue in the disease vector, Aedes aegypti, a transgenic Cas9/single guide RNA (sgRNA) method, was used to knock out the eye marker gene, kynurenine 3-monooxygenase (kmo), and the juvenile hormone receptor, Methoprene-tolerant (Met). PiggyBac transformation vectors were prepared to express sgRNAs targeting kmo and Met under the control of the U6 promoter. Transgenic Ae. aegypti expressing kmo-sgRNA or Met-sgRNA under the control of the U6 promoter and enhanced green fluorescent protein (eGFP) under the control of the hr5ie1 promoter were produced. The U6-sgRNA adults were mated with AAEL010097-Cas9 adults. The progeny were screened, and the insects expressing eGFP and DsRed were selected and evaluated for mutations in target genes. About 77% and 78% of the progeny that were positive for both eGFP and DsRed in kmo-sgRNA and Met-sgRNA groups, respectively, showed mutations in their target genes.

Introduction

The yellow fever mosquito, Aedes aegypti, transmits several deadly viruses, including yellow fever, Zika, dengue and chikungunya, and causes deaths all over the world every year.^1,2 The viruses are transmitted to humans through the bite of an infected female Aedes mosquito, which mainly acquires the virus while feeding on the blood of an infected person.³ RNA interference (RNAi) has been widely used as a powerful tool for in vivo gene functions analysis in insects.⁴ However, RNAi is not highly efficient in mosquito larvae due to problems associated with double-stranded RNA (dsRNA) stability and delivery to the site of action.⁵ The CRISPR-Cas9 system has been widely used as an alternative approach to study gene function.^6,7 Normally, single guide RNA (sgRNA) and Cas9 mRNA/protein are injected into embryos, and the progeny are screened for mutants.⁶ This method is both labor- and time-intensive, since it takes three to five generations to generate homozygous lines.⁸ Knocking out some target genes can induce lethality in homozygous individuals. The heterozygous individuals are maintained and crossed to obtain homozygous individuals for in vivo functional studies. For some target genes, the knockout may not produce any distinct phenotype. In this case, enzyme assays or cloning and sequencing need to be performed to identify mutations.^9,10 The fluorescent markers can be used for selection by site-specific knock-in at the target site.¹¹ In mosquitoes, the efficiency of CRISPR-Cas9-mediated knock-in is relatively low.¹² Also, this method takes a long time to generate homozygous lines,¹³ and this method is also not suitable for lethal genes.^14,15

Previous studies have used multiple sgRNAs for achieving knockout in one generation in mammals¹⁶ and insects.^17,18–21 By using the multiple sgRNAs strategies, the loss-of-function mutants could be obtained in one generation. Still, for the target genes with no detectable phenotype, the T7 endonuclease 1 (T7E1) assay or sequencing needs to be performed to identify mutations. We used single marker gene sgRNA mixed with multiple-target gene sgRNAs to identify the loss-of-function mutants in Ae. aegypti. This method increased the frequency of loss-of-function phenotypes in G0.¹⁸ A recent study has shown that the use of transgenic Ae. aegypti expressing Cas9 increased gene-editing efficiency.²² To extend the toolkit of CRISPR-Cas9 system in the mosquitoes, we produced transgenic Ae. aegypti expressing kmo-sgRNA or Met-sgRNA under the control of the U6 promoter and enhanced green fluorescent protein (eGFP) under the control of the hr5ie1 promoter. The sgRNA/eGFP-expressing mosquitoes were crossed with those expressing Cas9 and DsRed (the AAEL010097-Cas9 line²²). The DsRed and eGFP markers were used to identify progeny expressing both Cas9 and sgRNA, which contained mutations for target genes.

Methods

Plasmid construction

The Gibson Assembly (New England Biolabs, Ipswich, MA) method was used for preparing U6-sgRNA constructs. The design and synthesis of sgRNA targeting the kynurenine 3-monooxygenase (kmo) gene, which codes for an enzyme involved in eye pigmentation, was reported previously.¹⁸ To construct the U6-kmo-sgRNA vector, the sgRNA and the promoter of ubiquitous U6 snRNA (AAEL017774)²³ were cloned into piggyBac transformation (pBac-hr5ie1-egfp) vector.²⁴ A 1,001 bp region at the 5′ end and a 1,301 bp region at the 3′ end of the U6 snRNA were amplified using gene-specific primers (Table 1) and cloned into pBac-hr5ie1-egfp vector. A double-stranded sgRNA scaffold was generated using two unique oligonucleotides (Table 1), and it was cloned into the middle of U6 snRNA promoter vector. Plasmid DNA was extracted using the Plasmid Plus Midi Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. The transposase mRNA was prepared using the mMESSAGE mMACHINE T7 Transcription Kit (Thermo Fisher Scientific, Waltham, MA) with XhoI (New England Biolabs) linearized IFP2 vector as a template.²⁴

Table 1.

List of primers used in this study

Name	Sequence	Purpose
Aa-U6-5′-F	TAGAGCGGCCGCCACCGCGGCCCGTTGTTCCAACGTTGTC	Vector construction
Aa-U6-5′-R	TCGACCTCGAGGGGGGGCCCTTGCGTGGCAGATACGAAGA	Vector construction
Aa-U6-3′-F	CCATGGGCCCTTGGTGGTTGTTCATCGATTC	Vector construction
Aa-U6-3′-R	TTCGAAAGCGGCCGCTTGCGTGGCAGATACGAAGA	Vector construction
Aa-Met-U6-sgR-F	AGAGGCAAGAGTAGTGAAATGGCCACATGGGGCACCATGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGT	Vector construction
Aa-kmo-U6-sgR-F	AGAGGCAAGAGTAGTGAAATGGCCAGTGCTTTGCGGCCTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGT	Vector construction
Aa-U6-sgR-R	AATCGATGAACAACCACCAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACT	Vector construction
Met-check-F	CCTCGTTTACTGACAATCAC	Mutation analysis
Met-check-R	GGTGTTTCTCTTCTCAATAGG	Mutation analysis
Kmo-check-F	GAATGTTCGGGTACTTCTCG	Mutation analysis
Kmo-check-R	GGCTCTCTATTTGCACTCCAC	Mutation analysis

Insect rearing and microinjection

The Ae. aegypti AAEL010097-Cas9 and Liverpool IB12 (LVPIB12) strains were maintained at 27 ± 2°C with a photoperiod of 14 h light:10 h dark and 60–70% relative humidity. The mosquito larvae were fed on bovine liver powder and maintained in water at 26°C. Pupae were sexed by size and kept in separate containers. After emergence, the adults were fed on 10% sucrose solution. For egg collection, around 200 females and 200 males were transferred to a cage for mating. To induce oviposition at 4 days after mating, the females were artificially fed on defibrinated sheep blood. The mosquito embryonic microinjections were performed following the method described previously.²⁵ Briefly, the mosquito eggs were collected 20 min after oviposition, aligned on a glass slide, and then microinjected. After injection, the eggs were kept at 26°C. On the third day after injection, they were dropped into water for hatching. The hatched larvae were maintained using the same protocol described above.

U6-sgRNA strain development

The Liverpool IB12 strain was used for genetic transformation. Embryos were microinjected with a solution containing 200 ng/μL U6-sgRNA plasmid and 300 ng/μL transposase mRNA. The injected embryos were hatched on the fourth day. The G0 larvae were maintained and sexed during the pupal stage. After emergence, the adults were mated with opposite sex wild-type Liverpool IB12 strain adults. The G1 progeny were screened under eGFP fluorescent light.

RNA isolation and cDNA synthesis

Total RNA was isolated using TRIzol reagent (Thermo Fisher Scientific). The First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) was used to convert 2 μg RNA to cDNA via reverse transcription. The New England Biolabs 2 × Taq Mix and the sgRNA-specific primers (Table 1) were used to amplify the sgRNA templates.

Mutant screening and analysis

To knock out the target gene, the U6-sgRNA lines were mated with the AAEL010097-Cas9 line.²² The G1 offspring were screened using GFP and red fluorescent protein fluorescent lights. Only larvae that were positive for green and red fluorescence were selected, and they were maintained in separate containers. The mutant phenotype was screened during the fourth instar larval stages. The genomic DNA isolation was performed using a DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer's instructions. The polymerase chain reaction (PCR) products were purified using a QIAquick PCR Purification Kit (Qiagen) following the manufacturer's instructions. The mutations were verified by T7 endonuclease I (T7E1) assay, and the PCR products were cloned into TA vector and sequenced as described previously.¹⁸ For T7E1 assay, 200 ng PCR products were hybridized in NEBuffer 2 (New England Biolabs) under the following conditions: 95°C for 5 min, 95–85°C at −2°C/s, 85–25°C at −1°C/s, and held at 4°C. Then, the mixtures were digested with 10 IU T7E1 enzyme (New England Biolabs) at 37°C for 15 min. Following digestion, the reaction solution was checked on 2% agarose gels containing Gel Red (Biotium, Fremont, CA). The PCR products were cloned into TOPO pCR4 vector (Thermo Fisher Scientific) and sequenced by the Sanger sequencing method.

Results and Discussion

Expression of kmo-sgRNA by injection of U6-kmo-sgRNA plasmid DNA into embryos that express Cas9 induced mosaic eye phenotype in G0

To test if kmo-sgRNA (Fig. 1A) expressed under the control of the U6 promoter (Fig. 1B) could induce mutations in the target gene, 100 AAEL010097 Cas9 embryos were injected with 200 ng/μL U6-kmo-sgRNA plasmid DNA. Of the 49 hatched larvae, seven showed the mosaic eye phenotype (Fig. 1C). The genomic DNA from the mutants was extracted and used as the template to amplify the fragment of the kmo target site and used in the T7E1 assay. As shown in Figure 1D, the target fragment was digested into two expected fragments. Furthermore, the PCR products were cloned into TA vector and sequenced. Six out of seven clones sequenced showed 3–8 bp deletions (Fig. 1E). These data suggest that the kmo sgRNA expressed under the control of the U6 promoter could induce target-specific mutations, resulting in the mosaic eye phenotype in Ae. aegypti.

FIG. 1.

Target-specific mutagenesis of kmo gene and mosaic eye phenotype induced by U6-kmo-sgRNA vector. (A) Diagram of the mosquito AAEL008897 gene. The black boxes indicate the exons. (B) U6 sgRNA vector. The sgRNA target located on exon 5 of the kmo gene (the target sequences in the gray shadow) was cloned into the piggybac vector. (C) Mosaic eye phenotype induced by U6-kmo-sgRNA and Cas9 expressed in the transgenic insect. Scale bar: 500 μm. (D) T7E1 assay was performed to identify mutations in the kmo gene. The expected bands of T7E1 digestion are indicated by black arrows. L, 1 kb plus DNA ladder; M, DNA from insects that showed mosaic eye phenotype. (E) Sequencing confirmed the mutations of kmo gene at the target site. The wild-type sequences are shown at the top with the target site marked by red letters, and the adjacent protospacer motif (PAM) sequences are underlined. The deletions in the mutant sequences are shown as dashes.

Generation of kmo mutants using the transgenic CRISPR-Cas9 system

Three eGFP-positive larvae were identified in the G1 progeny developed from 500 embryos injected with the U6-kmo-sgRNA construct and transposase mRNA. One larva was successfully maintained until the adult stage (male) and mated with 10 Liverpool females. The eggs laid were hatched and maintained until the third instar larval stage and screened under the eGFP fluorescent light. The eGFP-positive larvae (44/150) were selected and kept in separate containers. To enlarge the population, the insects were sexed during the pupal stage and mated with opposite sex Liverpool IB12 adults.

To confirm the expression of sgRNA in vivo, total RNA was isolated from four U6-kmo-sgRNA pupae. RNA (2 μg) was used to synthesize cDNA. The AAEL010097-Cas9 pupae were used as the control. As shown in Supplementary Figure S1, the kmo-sgRNA was detected in U6-kmo-sgRNA insects but not in the Cas9 strain. These data show that sgRNA was successfully expressed in U6-kmo-sgRNA transgenic insects.

The U6-kmo-sgRNA-positive G2 adults were mated with opposite sex AAEL010097-Cas9 adults. The G3 larvae were checked for the presence of eGFP and DsRed during the third instar larval stage. Only the larvae that showed eGFP and DsRed fluorescence were selected and kept in separate containers. When we crossed the AAEL010097-Cas9 line male and the U6-kmo-sgRNA female, none of the larvae developed from this cross showed the mosaic eye phenotype. (Fig. 2A). In contrast, when we crossed the AAEL010097-Cas9 female and U6-sgRNA male, the larvae that developed showed the mosaic eye phenotype (Fig. 2A). In two independent experiments, 73% (43/59) and 82% (82/100) of insects showed the mosaic eye phenotype.

FIG. 2.

Maternally inherited Cas9 induced mutations in the kmo gene of Aedes aegypti. (A) Maternally inherited Cas9 induced mutations in kmo gene and mosaic eye phenotype. a, a′ and a″ show the AAEL010097-Cas9-positive adult under visible, red fluorescent, and green fluorescent lights. b, b′ and b″ show the U6-kmo-sgRNA-positive adult the under visible, red fluorescent and green fluorescent lights. c, c′ and c″ show the adult developed from the Cas9 male and U6-kmo-sgRNA female cross under visible, red fluorescent and green fluorescent lights. d, d′ and d″ show the adult developed from the Cas9 female and U6-kmo-sgRNA male cross under visible, red fluorescent and green fluorescent lights. The blue rectangle indicates the white eye phenotype. DsRed, red fluorescent protein; eGFP, enhanced green fluorescent protein. Scale bar: 1,000 μm. (B) T7E1 assay confirmed the mutations. L, 1 kb plus DNA ladder. M1–M3, products of T7E1 assay of DNA isolated from three insects developed from Cas9 female and U6-kmo-sgRNA male cross. P1 and P2, two products of T7E1 assay of DNA isolated from three insects developed from Cas9 female and U6-kmo-sgRNA male cross. The expected bands of T7E1 digestion are indicated by black arrows. (C) The mutations were confirmed by sequencing. The wild-type sequences are shown at the top, with the target site marked by red letters and the PAM sequences underlined. The deletions in the mutant sequences are shown as dashes, and the insertions are shown as yellow lowercase letters.

To confirm mutations in the kmo gene, the genomic DNA from the progeny of both crosses was extracted, and the T7E1 assay was performed. As shown in Figure 2B, progeny from the Cas9 female and U6-kmo-sgRNA male cross showed mutations in the kmo gene. In contrast, the progeny from the Cas9 male and U6-kmo-sgRNA female cross did not show any mutations in kmo gene. The PCR fragments were cloned and sequenced. Six out of the eight clones sequenced showed mutations, including 1, 7, or 8 bp deletions and two different indels (Fig. 2C). Notably, mutations were only induced in the offspring when the Cas9 line female was mated with the U6-kmo-sgRNA male. The AAEL010097 promoter used to drive the expression of Cas9 is predominantly expressed in the ovary and early embryonic development,²² which may have contributed to the requirement of maternal Cas9 for successful mutagenesis.²⁶ However, non-Mendelian dominant maternal effects caused by CRISPR-Cas9 transgenic expression was reported in Drosophila melanogaster.²⁷ The dominant maternal effects induced by CRISPR-Cas9 warrants further investigation.

Target-specific mutagenesis of Met using the transgenic CRISPR-Cas9 system

The design of sgRNA targeting exon 4 of the juvenile hormone receptor, Methoprene tolerant (Met), was reported previously (Fig. 3A).¹⁸ The U6-Met-sgRNA transformation vector was constructed as described above for U6-kmo-sgRNA (Fig. 3B). The U6-Met-sgRNA line was generated by injecting U6-Met-sgRNA plasmid and transposase mRNA into 400 Liverpool IB12 embryos. The transgenic insects were selected, and the expression of sgRNA was checked by reverse transcription qualitative PCR using Met-specific primers. The expression of Met-sgRNA was detected in U6-Met-sgRNA transgenic insects (Supplementary Fig. S1).

FIG. 3.

The dualistic Cas9/sgRNA system induced mutations in the Met gene of Ae. aegypti. (A) Diagram of the mosquito Met (AAEL025915) gene. Black boxes indicate the exons, and gray boxes indicate the untranslated region. (B) Structure of U6-sgRNA vector. The sgRNA target is located on exon 4 of the Met gene. The target sequences in gray were cloned into the piggybac vector. (C) Maternally inherited Cas9 induced mutations in the Met gene and black larval phenotype. a, a′ and a″ show the U6-Met-sgRNA-positive larva under visible, red fluorescent, and green fluorescent lights. b, b′ and b″ show the AAEL010097-Cas9-positive larva under visible, red fluorescent, and green fluorescent lights. c, c′ and c″ show the larva developed from the Cas9 female and U6-Met-sgRNA male cross under visible, red fluorescent, and green fluorescent lights. d, d′ and d″ show the larva developed from the Cas9 male and U6-Met-sgRNA female cross under visible, red fluorescent, and green fluorescent lights. The blue rectangle indicates the black larval phenotype detected. Scale bar: 1,000 μm. (D) Mutations of the Met gene confirmed by sequencing. The wild-type sequences are shown at the top, with the target site marked by red letters and the PAM sequences underlined. The deletions in the mutant sequences are shown as dashes, and the blue letter “G” in the bottom line indicates the transversion of “C.”

The U6-Met-sgRNA line was mated with the AAEL010097-Cas9 line, and the progeny were evaluated for the Met mutant phenotype. As shown in Figure 3C, the black larval phenotype of Met knockout¹⁸ was detected only in the larvae developed from Cas9 female and U6-Met-sgRNA male crosses. Similar to the results from kmo mutagenesis, only the maternally inherited Cas9 induced mutations in the Met gene. In two independent experiments, 94.4% (34/36) and 63.6% (14/22) of individuals displayed a black larval phenotype during the third and fourth later larval stages. The mutations of the Met gene caused by the transgenic system were confirmed by TA cloning and sequencing. Eight clones sequenced showed six different deletions and one transmission (Fig. 3D).

In a previous study, we used the multiple sgRNAs method to knock out the Met gene in one generation.¹⁸ To increase the mutation frequency, one of the kmo sgRNA was mixed with the multiple Met sgRNAs to identify the mutants before they showed the black larval phenotype. With the method we used here, using the DsRed and eGFP fluorescent marker, we could identify the Met mutants before the onset of the black larval phenotype using the DsRed and eGFP signals. Similar approaches could be used to identify mutants of target genes without pronounced phenotype.

CRISPR-Cas9 genome editing systems have been developed for various applications in mosquitoes.^{8,12,22,23,28–36} Transgenic approaches for expression of Cas9 and sgRNA have been developed for use in D. melanogaster³⁷ and Bombyx mori.²⁸ The recent studies on Ae. aegypti employed transgenic expression of sgRNA and Cas9 for the development of gene-drive systems.^23,38 Here, we used the transgenic expression of sgRNA and Cas9 for improving this system for functional genomics studies in Ae. aegypti. The multiple sgRNA combined with a marker sgRNA method was described previously,¹⁸ and the transgenic CRISPR-Cas9 method described here adds to the CRISPR-Cas9 toolbox of Ae. aegypti and other insects, and will facilitate functional genomics studies in mosquitoes and other insects.

Footnotes

Acknowledgments

We thank Jeff Howell for help with insect rearing and reading the earlier version of the manuscript, and Robert A. Harrell II, Channa Aluvihare, and Omar S. Akbari for help with embryonic injections, Ae. aegypti rearing, and the AAEL010097-Cas9 strain.

Author Disclosure Statement

The authors declare that no competing financial interests exist for all authors of this manuscript.

Funding Statement

This work was supported by grants from the National Institutes of Health (GM070559-14) and the National Institute of Food and Agriculture, U.S. Department of Agriculture (under HATCH Project 2351177000).

Supplementary Material

References

Lwande

, Obanda

, Lindstrom

, et al. Globe-trotting Aedes aegypti and Aedes albopictus: risk factors for arbovirus pandemics. Vector Borne Zoonotic Dis, 2020; 20:71–81. DOI: 10.1089/vbz.2019.2486.

Scott

, Takken

. Feeding strategies of anthropophilic mosquitoes result in increased risk of pathogen transmission. Trends Parasitol, 2012; 28:114–121. DOI: 10.1016/j.pt.2012.01.001.

Bhatt

, Gething

, Brady

, et al. The global distribution and burden of dengue. Nature, 2013; 496:504–507. DOI: 10.1038/nature12060.

Zhu

, Palli

. Mechanisms, applications, and challenges of insect RNA interference. Annu Rev Entomol, 2020; 65:293–311. DOI: 10.1146/annurev-ento-011019-025224.

Airs

, Bartholomay

. RNA interference for mosquito and mosquito-borne disease control. Insects, 2017; 8. DOI: 10.3390/insects8010004.

Kistler

, Vosshall

, Matthews

. Genome engineering with CRISPR-Cas9 in the mosquito Aedes aegypti. Cell Rep, 2015; 11:51–60. DOI: 10.1016/j.celrep.2015.03.009.

Gantz

, Jasinskiene

, Tatarenkova

, et al. Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi. Proc Natl Acad Sci U S A, 2015; 112:E6736–E6743. DOI: 10.1073/pnas.1521077112.

Vinauger

, Lahondere

, Wolff

, et al. Modulation of host learning in Aedes aegypti mosquitoes. Curr Biol, 2018; 28:333–344.e8. DOI: 10.1016/j.cub.2017.12.015.

Zhu

G-H

, Zheng

M-Y

, Sun

J-B

, et al. CRISPR/Cas9 mediated gene knockout reveals a more important role of PBP1 than PBP2 in the perception of female sex pheromone components in Spodoptera litura. Insect Biochem Mol Biol, 2019; 115:103244. DOI: 10.1016/j.ibmb.2019.103244.

10.

Taning

, Van Eynde

, Yu

, et al. CRISPR/Cas9 in insects: applications, best practices and biosafety concerns. J Insect Physiol, 2017; 98:245–257. DOI: 10.1016/j.jinsphys.2017.01.007.

11.

Xue

, Ren

, Wu

, et al. Efficient gene knock-out and knock-in with transgenic Cas9 in Drosophila. G3 (Bethesda), 2014; 4:925–929. DOI: 10.1534/g3.114.010496.

12.

Basu

, Aryan

, Overcash

, et al. Silencing of end-joining repair for efficient site-specific gene insertion after TALEN/CRISPR mutagenesis in Aedes aegypti. Proc Natl Acad Sci U S A, 2015; 112:4038–4043. DOI: 10.1073/pnas.1502370112.

13.

Xue

, Ren

, Wu

, et al. Efficient gene knock-out and knock-in with transgenic Cas9 in Drosophila. G3 (Bethesda), 2014; 4:925–929. DOI: 10.1534/g3.114.010496.

14.

Koutroumpa

, Monsempes

, Francois

, et al. Heritable genome editing with CRISPR/Cas9 induces anosmia in a crop pest moth. Sci Rep, 2016; 6:29620. DOI: 10.1038/srep29620.

15.

Sakurai

, Mitsuno

, Mikami

, et al. Targeted disruption of a single sex pheromone receptor gene completely abolishes in vivo pheromone response in the silkmoth. Sci Rep, 2015; 5:11001. DOI: 10.1038/srep11001.

16.

Zuo

, Cai

, Li

, et al. One-step generation of complete gene knockout mice and monkeys by CRISPR/Cas9-mediated gene editing with multiple sgRNAs. Cell Res, 2017; 27:933–945. DOI: 10.1038/cr.2017.81.

17.

Zhu

, Chereddy

, Howell

, et al. Genome editing in the fall armyworm, Spodoptera frugiperda: multiple sgRNA/Cas9 method for identification of knockouts in one generation. Insect Biochem Mol Biol, 2020; 122:103373. DOI: 10.1016/j.ibmb.2020.103373.

18.

Zhu

, Jiao

, Chereddy

, et al. Knockout of juvenile hormone receptor, Methoprene-tolerant, induces black larval phenotype in the yellow fever mosquito, Aedes aegypti. Proc Natl Acad Sci U S A, 2019; 116:21501–21507. DOI: 10.1073/pnas.1905729116.

19.

, Tipping

, Brodsky

, et al. Rapid screening for CRISPR-directed editing of the Drosophila genome using white coconversion. G3 (Bethesda), 2016; 6:3197–3206. DOI: 10.1534/g3.116.032557.

20.

Kane

, Vora

, Varre

, et al. Efficient screening of CRISPR/Cas9-induced events in Drosophila using a Co-CRISPR strategy. G3 (Bethesda), 2017; 7:87–93. DOI: 10.1534/g3.116.036723.

21.

Ewen-Campen

, Perrimon

. ovo(D) Co-selection: a method for enriching CRISPR/Cas9-edited alleles in Drosophila. G3 (Bethesda), 2018; 8:2749–2756. DOI: 10.1534/g3.118.200498.

22.

, Bui

, Yang

, et al. Germline Cas9 expression yields highly efficient genome engineering in a major worldwide disease vector, Aedes aegypti. Proc Natl Acad Sci U S A, 2017; 114:E10540–E10549. DOI: 10.1073/pnas.1711538114.

23.

, Yang

, Kandul

, et al. Development of a confinable gene drive system in the human disease vector Aedes aegypti. Elife, 2020; 9. DOI: 10.7554/eLife.51701.

24.

Tan

, Tanaka

, Tamura

, et al. Precocious metamorphosis in transgenic silkworms overexpressing juvenile hormone esterase. Proc Natl Acad Sci U S A, 2005; 102:11751–11756. DOI: 10.1073/pnas.0500954102.

25.

Aryan

, Myles

, Adelman

. Targeted genome editing in Aedes aegypti using TALENs. Methods, 2014; 69:38–45. DOI: 10.1016/j.ymeth.2014.02.008.

26.

Lopez Del Amo

, Bishop

, Sanchez

, et al. A transcomplementing gene drive provides a flexible platform for laboratory investigation and potential field deployment. Nat Commun, 2020; 11:352. DOI: 10.1038/s41467-019-13977-7.

27.

Lin

, Potter

. Non-Mendelian dominant maternal effects caused by CRISPR/Cas9 transgenic components in Drosophila melanogaster. G3 (Bethesda), 2016; 6:3685–3691. DOI: 10.1534/g3.116.034884.

28.

Dong

, Hu

, Qin

, et al. CRISPR/Cas9-mediated disruption of the immediate early-0 and 2 as a therapeutic approach to Bombyx mori nucleopolyhedrovirus in transgenic silkworm. Insect Mol Biol, 2019; 28:112–122. DOI: 10.1111/imb.12529.

29.

Hegde

, Nilyanimit

, Kozlova

, et al. CRISPR/Cas9-mediated gene deletion of the ompA gene in symbiotic Cedecea neteri impairs biofilm formation and reduces gut colonization of Aedes aegypti mosquitoes. PLoS Negl Trop Dis, 2019; 13:e0007883. DOI: 10.1371/journal.pntd.0007883.

30.

Macias

, McKeand

, Chaverra-Rodriguez

, et al. Cas9-mediated gene-editing in the malaria mosquito Anopheles stephensi by ReMOT control. G3 (Bethesda), 2020; 10:1353–1360. DOI: 10.1534/g3.120.401133.

31.

Dong

, Lin

, Held

, et al. Heritable CRISPR/Cas9-mediated genome editing in the yellow fever mosquito, Aedes aegypti. PLoS One, 2015; 10:e0122353. DOI: 10.1371/journal.pone.0122353.

32.

Hall

, Basu

, Jiang

, et al. SEX DETERMINATION. A male-determining factor in the mosquito Aedes aegypti. Science, 2015; 348:1268–1270. DOI: 10.1126/science.aaa2850.

33.

Ling

, Kokoza

, Zhang

, et al. MicroRNA-277 targets insulin-like peptides 7 and 8 to control lipid metabolism and reproduction in Aedes aegypti mosquitoes. Proc Natl Acad Sci U S A, 2017; 114:E8017–E8024. DOI: 10.1073/pnas.1710970114.

34.

Zhang

, Zhao

, Roy

, et al. MicroRNA-309 targets the Homeobox gene SIX4 and controls ovarian development in the mosquito Aedes aegypti. Proc Natl Acad Sci U S A, 2016; 113:E4828–4836. DOI: 10.1073/pnas.1609792113.

35.

Ling

, Raikhel

. Serotonin signaling regulates insulin-like peptides for growth, reproduction, and metabolism in the disease vector Aedes aegypti. Proc Natl Acad Sci U S A, 2018; 115:E9822–E9831. DOI: 10.1073/pnas.1808243115.

36.

Duvall

, Basrur

, Molina

, et al. A peptide signaling system that rapidly enforces paternity in the Aedes aegypti mosquito. Curr Biol, 2017; 27:3734–3742.e5. DOI: 10.1016/j.cub.2017.10.074.

37.

Chen

, Marques

, Sugino

, et al. CAMIO: a transgenic CRISPR pipeline to create diverse targeted genome deletions in Drosophila. Nucleic Acids Res, 2020; 48:4344–4356. DOI: 10.1093/nar/gkaa177.

38.

Sanchez

, Bennett

, Wu

, et al. Modeling confinement and reversibility of threshold-dependent gene drive systems in spatially-explicit Aedes aegypti populations. BMC Biol, 2020; 18:50. DOI: 10.1186/s12915-020-0759-9.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.38 MB