Association of Hepatic Lipase Gene Polymorphisms with Hypertriglyceridemia and Low High-Density Lipoprotein-Cholesterol Levels Among South Indian Subjects Without Diabetes

Abstract

Aim:

The aim of this study was to investigate the association of four variants of the hepatic lipase (HL [or LIPC]) gene with various lipid parameters among South Indian subjects with normal glucose tolerance (NGT).

Subjects and Methods:

In total, 747 NGT subjects were randomly selected from the Chennai Urban Rural Epidemiological Study (CURES). Serum triglycerides, serum cholesterol, and high-density lipoprotein cholesterol (HDL-C) were measured using a Hitachi-912 autoanalyzer (Roche Diagnostics GmbH, Mannheim, Germany). Genotyping of HL gene variants was done by the polymerase chain reaction–restriction fragment length polymorphism method, and 20% of samples were sequenced to validate the genotypes obtained. Haplotype analysis was also carried out.

Results:

The TT genotype of the rs1800588 C/T (C-480T) polymorphism was significantly associated with hypertriglyceridemia, with an adjusted odds ratio of 2.58 (95% confidence interval 1.38–4.85, P=0.003), whereas those with the CC genotype of the rs6074 A/C (Thr479Thr) had significantly lower HDL-C levels (41.3±9.8 mg/dL) compared with the AA genotype (43.6±10.2 mg/dL, P=0.02). Haplotype analysis showed the TGC haplotype was significantly associated with low HDL-C levels.

Conclusions:

Among South Indian subjects without diabetes, the rs1800588 C/T (C-480T) and rs6074 C/A (Thr479Thr) variants of the HL gene are associated with hypertriglyceridemia and low HDL-C, respectively. The TGC haplotype was significantly associated with low HDL-C.

Introduction

D yslipidemia is a major risk factor for coronary heart disease (CHD) and is also seen in a high proportion of subjects with type 2 diabetes (T2D). The World Health Organization estimates that dyslipidemia is associated with more than half of global cases of ischemic heart disease and more than 4 million deaths per year.¹ Dyslipidemia is a broad term that refers to several lipid disorders, including an elevated level of low-density lipoprotein (LDL) cholesterol (LDL-C), a low level of high-density lipoprotein (HDL) cholesterol (HDL-C), hypertriglyceridemia, atherogenic dyslipidemia, and mixed lipid disorders.²

The prevalence of T2D and CHD has doubled in India in the past three decades.^3,4 It is well established that Asian Indians have an increased susceptibility to T2D and premature CHD compared with Europeans. This has been explained by a higher frequency of hyperinsulinemia,⁴ insulin resistance,⁵ dyslipidemia with low levels of HDL-C,⁶ and increased visceral fat despite a lower body mass index, and this unique phenotype is referred to as the “Asian Indian phenotype.”^7,8 However, it is not clear whether the Asian Indian phenotype represents a unique genetic susceptibility or results from lifestyle-related factors. Support for genetic susceptibility comes from the observation that hyperinsulinemia was demonstrated in newborn Asian Indian children but not in their United Kingdom counterparts⁹ and for some differences in genetic association with T2D in Asian Indians.^10,11

One of the most striking features of the Asian Indian phenotype is the presence of dyslipidemia, with hypertriglyceridemia and low HDL-C being the most prominent features.⁶ Indeed, a low level of HDL-C is seen in 60–70% of adults in urban Indians¹² and even in urban adolescent children.^13,14 However, few studies have looked at the possible causes of the low level of HDL-C and hypertriglyceridemia. It is likely that lifestyle factors (e.g., high carbohydrate diet¹⁵ or physical inactivity¹⁶) contribute to the dyslipidemia in our population. However, it is also possible that genetic factors play a role in this. Association of genetic variants with low HDL levels has been studied earlier in this population, with respect to the lipoprotein lipase gene.¹⁷ Hepatic lipase (HL) is similar to lipoprotein lipase and plays a key role in the metabolism of pro-atherogenic and anti-atherogenic lipoproteins, affecting their plasma levels as well as their physicochemical properties. HL is a glycoprotein that catalyzes the hydrolysis of lipoprotein triacylglycerols and phospholipids. The majority of HL is synthesized and secreted by the liver and is bound to heparin sulfate proteoglycans on the surface of sinusoidal endothelial cells and external surfaces of microvilli of parenchymal cells in the space of Disse,¹⁸ promoting the uptake of HDL and apolipoprotein-B-containing remnant particles.¹⁹ It is estimated that 30–45% of variability in HL activity is genetically determined.²⁰ Several independent studies have documented the association of some of the prominent single nucleotide polymorphisms (SNPs) in the HL gene.^21

–25 Although there are some studies on the variants in coding regions of the HL gene in Turkish²⁶ and Japanese²⁷ population, little is known about the association of variants of the HL gene with dyslipidemia in South Asians.

The aim of the present study was to investigate the association of four variants in the HL gene—namely, rs1800588 (C-480T) (C/T), rs6074 (Thr479Thr) (C/A), rs690 (Val155Val) (G/T) and rs6083 (Ser193Asn) (G/A)—with dyslipidemia in an Asian Indian (urban South Indian) population.

Research Design and Methods

Subjects and study design

The study subjects were selected from the urban component of the Chennai Urban Rural Epidemiology Study (CURES), an epidemiology study conducted on a representative population (>20 years) of Chennai (formerly Madras), the fourth largest city in India.²⁸ In brief, 26,001 adult subjects (>20 years of age) were recruited in Phase 1 of CURES using a systematic random sampling method covering the whole of Chennai City. This identified 1,529 self-reported “diabetes subjects.” In Phase 2, all self-reported or “known diabetes subjects” were invited to our center for detailed studies, of which 1,382 responded (response rate, 90.4%). In Phase 3, every 10^th subject from Phase 1 (n=2,600), excluding those with self-reported diabetes, were invited to undergo an oral glucose tolerance test (OGTT). For the present study, 1,000 unrelated subjects with normal glucose tolerance (NGT), defined as those who had a fasting plasma glucose level of <5.6 mmol/L (100 mg/dL) and 2-h plasma glucose value of 7.8 mmol/L (140 mg/dL), were selected from Phase 3 of CURES. The ratio of males versus females in the present study was 466:534. Those who were on lipid-lowering drugs such as statins, fibrates, and niacin were excluded from the study (n=134). On the basis of the National Cholesterol Education Program Adult Treatment Panel III guidelines,²⁹ the study population was divided into those with normal HDL-C (≥45 mg/dL among males; ≥50 mg/dL among females) and low HDL-C (≤45 mg/dL among males; ≤50 mg/dL among females), normal triglycerides (≤150 mg/dL) and high triglycerides (≥150 mg/dL), normal LDL-C (≤110 mg/dL) and high LDL-C (≥110 mg/dL), and normal total cholesterol (≤200 mg/dL) and high total cholesterol (≥200 mg/dL).

Written informed consent was obtained from each study participant, and the studies were approved by the Institutional Ethics Committee of the Madras Diabetes Research Foundation.

Phenotype measurements

Anthropometric measurements including weight, height, and waist measurements were obtained using standardized techniques. The body mass index (BMI) was calculated using the formula of weight (kg)/height squared (m²). Fasting blood sample was taken for estimation of levels of plasma glucose and serum lipids. Biochemical assays were carried out using a Hitachi-912 autoanalyzer (Roche Diagnostics GmbH, Mannheim, Germany) using kits supplied by Roche Diagnostics. Glycated hemoglobin was estimated by the high-performance liquid chromatography method using the Variant™ machine (Bio-Rad, Hercules, CA). Serum insulin concentration was estimated using kits from Dako (Glostrup, Denmark).

Levels of serum cholesterol (cholesterol oxidase–peroxidase–amidopyrine method; Roche Diagnostics), serum triglycerides (glycerol phosphate oxidase–peroxidase–amidopyrine method; Roche Diagnostics), and HDL-C (direct method, polyethylene glycol–pretreated enzymes; Roche Diagnostics) were measured using the Hitachi-912 autoanalyzer. Insulin resistance was calculated using the homeostasis assessment model using the formula fasting insulin (IU/mL)×fasting glucose (mmol/L)/22.5.³⁰

Genetic analysis

EDTA-anticoagulated venous blood samples were collected from all study subjects, and the genomic DNA was isolated from whole blood by proteinase K digestion followed by phenol–chloroform extraction.³¹ The concentration and purity was estimated with a NanoDrop™ 1000 spectrophotometer (Thermo Scientific, Wilmington, DE).

We amplified the regions of the HL gene using the GeneAmp^® PCR [polymerase chain reaction] system 9700 (Applied Biosystems, Foster City, CA), using the following primers: forward 5′ GGC ATC TTT GCT TCT TCG TC 3′, reverse 5′ CTG GCT CAG GAA AGT GGT GT′; forward 5′ TTCATCCAGGCAGCTCTTCT 3′, reverse 5′ CCAATCTTGTGCGTTCCAC 3′; forward 5′ CTTTCCCATTAGGGCTGGAT 3′, reverse 5′ TCCTATGGGCTGTTTGATGC 3′; and forward 5′ TGC TGT GTT TGC TTC CTG TT 3′, reverse 5′ AAG GCA GCC ATT CCA GAT AA3′ (Sigma, Bangalore, India). Restriction fragment length polymorphism was carried out using NlaIII (rs1800588 C/T), Xmn1 (rs690 G/T), Tsp509I (rs6083 G/A), and ScrfI (rs6074 A/C) restriction enzymes (New England Biolabs, Inc., Ipswich, MA). Agarose gel electrophoresis was used to check the amplification of the PCR and the restriction enzyme–digested products. The percentage of agarose in the gel varied, depending on the expected size(s) of the fragment(s). Ethidium bromide was included in the gel matrix to enable fluorescent visualization of the DNA fragments under ultraviolet light. To ensure that the genotyping was of adequate quality, we performed random duplicates in 20% of the samples. The assays were performed by a technician who was masked to the phenotype, and there was 99% concordance in the genotyping. Furthermore, a few variants were confirmed by direct sequencing with an ABI 310 genetic analyzer (Applied Biosystems).

Statistical analysis

Statistical Package for Social Sciences (SPSS) Windows (version 15.0) (SPSS, Inc., Chicago, IL) was used for statistical analysis. Allele frequencies were estimated by gene counting. Agreement with Hardy–Weinberg expectations was tested using a χ² goodness-of-fit test. The χ² test or Fisher's exact t test as appropriate was used to compare the proportions of genotypes or alleles. One-way analysis of variance was used to compare groups for continuous variables. Logistic regression analysis was done using HDL and triglycerides (dichotomized) as the dependent variable and the genotypes (risk factor) and age, gender, and BMI (covariates adjusted in the analysis) as independent variables. Significant P values obtained were then corrected for multiple testing.

Haplotype analysis was performed using Haploview software (available at www.broad.mit.edu/mpg/haploview/).³² Haplotype frequencies were estimated using an expectation-maximization algorithm. Linkage disequilibrium (LD) and haplotype frequencies were estimated using Haploview software. A P value of <0.05 was considered as statistically significant. Significant P values obtained were then corrected for multiple testing (Bonferroni's correction), and permutation P values were calculated by comparing haplotype frequencies between cases and controls based on 10,000 replications using the functions from the Haploview program. Power was estimated using an online post hoc power computation tool PS power and sample size calculator.

Results

The clinical and biochemical characteristics of the study subjects are shown in Table 1. Among the 1,000 NGT study subjects the ratio of male:female NGT subjects in the present study was 466:534. Table 2 shows the distribution of genotype frequencies among the study subjects stratified based on serum triglyceride levels. We found the rs1800588 C-480T variant of the HL gene to be significantly associated with hypertriglyceridemia. All the genotype frequencies of the four variants in the study subjects were in Hardy–Weinberg equilibrium. The frequency of the TT genotype was 11.3% among the hypertriglyceridemic group, compared with 5% among the normotriglyceridemic group (P=0.005). The minor allele frequency of the T allele was also significantly higher among the hypertriglyceridemic group (29.2%) compared with the normotriglyceridemic group (23.0%) (P=0.02). Logistic regression analysis showed that the unadjusted odds ratio (OR) for the TT genotype was 2.51 (95% confidence interval [CI] 1.34–4.68, P=0.004). This association persisted even after adjusting for age, gender, and BMI, with an OR of 2.58 (95% CI 1.38–4.85, P=0.003). None of the other variants showed any significant difference in the distribution of genotype frequency between the two groups. We also performed the power calculation to evaluate whether our sample size had sufficient power to detect the observed difference in the proportion of the CC and CT genotypes in the two groups (controls and cases) and found that the power was 0.75.

Table 1.

Clinical and Biochemical Characteristics of the Study Subjects

Parameter	Normal glucose tolerance subjects (n=1,000)
Sex (male:female)	466:534
Age (years)	45±13
BMI (kg/m²)	23.4±4.7
Waist circumference (cm)	83.5±12.1
Blood pressure (mm Hg)
Systolic	115±17
Diastolic	74±11
Fasting plasma glucose (mmol/L)	4.7±0.4
2-h post-load plasma glucose (mmol/L)	5.5±0.05
Fasting serum insulin ((IU/mL)	8.3±5.6
Glycated hemoglobin (%)	5.5±0.5
Serum cholesterol (mg/dL)	173±35
Serum triglycerides (mg/dL)
Untransformed	156±56
Log-transformed	1.99±0.20
HDL-C (mg/dL)	43±10
LDL-C (mg/dL)	107±30

Data are mean±SD values.

BMI, body mass index; HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol.

Table 2.

Association of Hepatic Lipase Gene Polymorphisms with Serum Triglyceride

			OR (95% CI), P
Single nucleotide polymorphism	Normal TG subjects	High TG subjects	Unadjusted	Adjusted ^a
rs1800588 (C-480T) (C/T) (n)	577	168
CC	341 (59.1%)	89 (53.0%)	Reference	Reference
CT	207 (35.9%)	60 (35.7%)	1.11 (0.76–1.60), 0.57	1.13 (0.77–1.63), 0.52
TT	29 (5.0%)	19 (11.3%)	2.51 (1.34–4.68), 0.004^b	2.58 (1.38–4.85), 0.003^b
MAF (T)	23.0%	29.2%	—	—
rs690 (Val155Val) (G/T) (n)	561	163
GG	176 (31.4%)	53 (32.5%)	Reference	Reference
GT	275 (49.0%)	72 (44.2%)	0.86 (0.58–1.30), 0.49	0.93 (0.61–1.40), 0.73
TT	110 (19.6%)	38 (23.3%)	1.14 (0.71–1.85), 0.57	1.22 (0.75–1.99), 0.40
MAF (T)	44.1%	45.4%	—	—
rs6083 (Ser193Asn) (G/A) (n)	519	150
GG	212 (40.8%)	68 (45.3%)	Reference	Reference
GA	233 (44.9%)	64 (42.7%)	0.85 (0.58–1.26), 0.43	0.86 (0.58–1.28), 0.47
AA	74 (14.3%)	18 (12.0%)	0.75 (0.42–1.35), 0.35	0.79 (0.44–1.43), 0.45
MAF (A)	36.7%	33.3%	—	—
rs6074 (Thr479Thr) (A/C) (n)	564	161
AA	131 (23.2%)	43 (26.7%)	Reference	Reference
AC	281 (49.8%)	68 (42.2%)	0.73 (0.47–1.13), 0.16	0.71 (0.45–1.11), 0.15
CC	152 (27.0%)	50 (31.1%)	1.00 (0.62–1.60), 0.99	0.96 (0.59–1.55), 0.87
MAF (C)	51.9%	52.1%	—	—

Adjusted for age, gender, and body mass index.

P value indicates a significant difference.

CI, confidence interval; MAF, minor allele frequency; OR, odds ratio.

Testing the association of the HL variants under various genetic models

Various genetic models were tested for the variant that was significantly associated with serum triglycerides (Table 3).

Table 3.

Association of the Hepatic Lipase Variant rs1800588 (C-480T) with Serum Triglycerides Under Various Genetic Models

	Genotype distribution		Adjusted OR (95% CI) ^a
Genotype for TGs	Normal TG subjects	High TG subjects	Additive model	Dominant model	Recessive model
CC	341 (59.1%)	89 (53.0%)	2.73 (1.44–5.18)	1.23 (0.865–1.754)	2.69 (1.446–5.02)
CT	20 (35.9%)	60 (35.7%)	P _additive=0.002^b	P _dominant=0.24	P _recessive=0.002^b
TT	29 (5%)	19 (11.3%)	—	—	—

Adjusted for age, gender, and body mass index.

P value indicates a significant difference.

CI, confidence interval; OR, odds ratio; TG, triglyceride.

The association of the rs1800588 (C-480T) variant of the HL gene with triglycerides was assessed based on the additive genetic model. We obtained an OR of 2.73 (95% CI 1.44–5.18, P=0.002) for the TT genotype, after adjusting for age, sex, and BMI. Under the dominant model, the OR was 1.23 (95% CI 0.86–1.75, P=0.24) for the CT+TT genotype. Under the recessive model, we observed an adjusted OR of 2.69 (95% CI 1.44–5.02, P=0.002) for the TT genotype. All these observations were done after adjusting for age, sex, and BMI.

Table 4 shows the distribution of genotype frequencies among the study subjects stratified based on HDL-C levels according to the modified Adult Treatment Panel III guidelines²⁹ as mentioned earlier. The rs6074 (Thr479Thr) (A/C) variant of the HL gene was significantly associated with low HDL-C levels. The logistic regression analysis showed that the unadjusted OR for the CC genotype was 1.47 (95% CI 0.97–2.21, P=0.06); after adjusting for age, sex, and BMI, the OR was 1.25 (95% CI 0.81–1.95, P=0.30). Similarly, the rs6083 (Ser193Asn) (G/A) variant of the HL gene was significantly associated with normal HDL-C levels among the NGT subjects. We observed a significantly higher GA frequency (47.5%) among the normal HDL-C group, compared with the low HDL-C group (40.7%) (P=0.05). However, the OR significance was lost after adjusting for age, gender, and BMI: OR=0.72 (95% CI 0.51–1.02, P=0.06).

Table 4.

Association of Hepatic Lipase Gene Polymorphisms with High-Density Lipoprotein

			OR (95% CI), P
Single nucleotide polymorphism	Normal HDL subjects	Low HDL subjects	Unadjusted	Adjusted ^a
rs1800588 (C-480T) (C/T) (n)	413	332
CC	235 (56.9%)	196 (59.0%)	Reference	Reference
CT	150 (36.3%)	116 (34.9%)	0.92 (0.68–1.26), 0.63	0.94 (0.68–1.30), 0.73
TT	28 (6.8%)	20 (6.0%)	0.85 (0.46–1.56), 0.61	0.83 (0.43–1.57), 0.56
MAF (T)	24.9%	23.5%	—	—
rs690 (Val155Val) (G/T) (n)	398	326
GG	134 (33.7%)	95 (29.1%)	Reference	Reference
GT	181 (45.5%)	166 (50.9%)	1.29 (0.92–1.81), 0.13	1.31 (0.91–1.87), 0.13
TT	83 (20.9%)	65 (19.9%)	1.10 (0.72–1.67), 0.64	1.02 (0.66–1.59), 0.90
MAF (T)	43.6%	45.4%	—	—
rs6083 (Ser193Asn) (G/A) (n)	356	312
GG	136 (38.2%)	144 (46.2%)	Reference	Reference
GA	169 (47.5%)	127 (40.7%)	0.71 (0.51–0.98), 0.04^b	0.72 (0.51–1.02), 0.06
AA	51 (14.3%)	41 (13.1%)	0.75 (0.47–1.21), 0.25	0.67 (0.40–1.10), 0.11
MAF (A)	38.1%	33.5%	—	—
rs6074 (Thr479Thr) (A/C) (n)	407	317
AA	102 (25.1%)	72 (22.7%)	Reference	Reference
AC	206 (50.6%)	142 (44.8%)	0.97 (0.67–1.41), 0.90	0.80 (0.54–1.20), 0.29
CC	99 (24.3%)	103 (32.5%)	1.47 (0.97–2.21), 0.06	1.25 (0.81–1.95), 0.30
MAF (C)	49.6%	55.0%	—	—

Adjusted for age, gender, and body mass index.

P value indicates a significant difference.

CI, confidence interval; MAF, minor allele frequency; OR, odds ratio.

Because HDL-C cut points are different in males and females, separate analysis was done in males and females. Table 5 shows that among the males, the GA genotype of the rs6083 (Ser193Asn) (G/A) variant was also significantly associated with normal HDL-C levels. The frequency of the GA genotype was significantly associated with normal HDL-C levels (54.1%) compared with low HDL-C levels (38.3%) (P=0.05). However, the significance was lost after adjusting for age and BMI. There was no significant association of HL gene variants with HDL-C among females. Table 6 shows that among males, none of the four HL variants showed any significant association with serum triglycerides; however, in the case of female NGT subjects, in the variant C-514T, the frequency of the TT genotype was significantly higher among the high triglyceride group (11.9%) compared with the normal triglyceride group (4.1%) (P=0.001). The minor allele frequency of the T allele was also significantly higher among the high triglyceride group (39.7%) compared with the normal triglyceride group (23.3%) (P<0.001).

Table 5.

Association of Hepatic Lipase Gene Polymorphisms with High-Density Lipoprotein Based on Gender

Single nucleotide polymorphism	Normal HDL subjects	Low HDL subjects	P value
Male subjects
rs6083 (Ser193Asn) (G/A) (n)	61	214
GG	21 (34.4%)	100 (46.7%)	0.05 (GG vs. GA)^a
GA	33 (54.1%)	82 (38.3%)	0.26 (GA vs. AA)
AA	7 (11.5%)	32 (15.0%)	0.87 (GG vs. AA)
MAF (A)	38.5%	34.1%	0.42
rs6074 (Thr479Thr) (A/C) (n)	79	226
AA	16 (20.3%)	51 (22.6%)	0.58 (AA vs. AC)
AC	43 (54.4%)	108 (47.8%)	0.44 (AC vs. CC)
CC	20 (25.3%)	67 (29.6%)	0.95(AA vs. CC)
MAF (C)	52.5%	53.5%	0.89
Female subjects
rs6083 (Ser193Asn) (G/A) (n)	109	284
GG	40 (36.7%)	119 (41.9%)	0.53 (GG vs. GA)
GA	52 (47.7%)	129 (45.4%)	0.76 (GA vs. AA)
AA	17 (15.6%)	36 (12.7%)	0.42 (GG vs. AA)
MAF (A)	39.4%	35.3%	0.32
rs6074 (Thr479Thr) (A/C) (n)	118	301
AA	32 (27.1%)	75 (24.9%)	0.95 (AA vs. AC)
AC	61 (51.7%)	136 (45.2%)	0.10 (AC vs. CC)
CC	25 (21.2%)	90 (29.9%)	0.21(AA vs. CC)
MAF (C)	47.0%	52.4%	0.17

P value indicates a significant difference.

HDL, high-density lipoprotein; MAF, minor allele frequency.

Table 6.

Association of Hepatic Lipase Gene Polymorphisms with Serum Triglycerides Among Male and Female Normal Glucose Tolerance Subjects

Single nucleotide polymorphisms	Normal TG subjects	High TG subjects	P value
Male subjects
rs6083 (Ser193Asn) (G/A) (n)	201	73
GG	85 (42.3%)	36 (48.6%)	0.27 (GG vs. GA)^a
GA	89 (44.3%)	26 (35.1%)	0.41 (GA vs. AA)
AA	27 (13.4%)	12 (16.2%)	0.93 (GG vs. AA)
MAF (A)	35.6%	33.8%	0.77
rs6074 (Thr479Thr) (A/C) (n)	263	85
AA	62 (23.6%)	25 (29.4%)	0.30 (AA vs. AC)
AC	121 (46%)	34 (40%)	0.38 (AC vs. CC)
CC	45 (17.1%)	18 (21.2%)	0.87 (AA vs. CC)
MAF (C)	46.3%	45.5%	0.93
rs1800588 (C-514T) (C/T) (n)	263	85
CC	140 (53.2%)	46 (54.1%)	0.75(CC vs. CT)
CT	78 (29.7%)	29 (34.1%)	0.65 (CT vs. TT)
TT	13 (4.9%)	7 (8.9%)	0.46 (CC vs. TT)
MAF (T)	22.5%	26.2%	0.39
rs690 (Val155Val) (G/T) (n)	273	73
GG	82 (35.7%)	19 (26%)	0.27 (GG vs. GT)
GT	101 (43.9%)	35 (47.9%)	0.77 (GT vs. TT)
TT	47 (20.4%)	19 (26%)	0.18 (GG vs. TT)
MAF (T)	42.4%	50.0%	0.12
Female subjects
rs6083 (Ser193Asn) (G/A) (n)	318	76
GG	127 (39.9%)	32 (42.1%)	0.97 (GG vs. GA)^a
GA	144 (44.3%)	38 (35.1%)	0.17 (GA vs. AA)
AA	47 (14.8%)	6 (7.9%)	0.21 (GG vs. AA)
MAF (A)	37.4%	32.9%	0.34
rs6074 (Thr479Thr) (A/C) (n)	386	101
AA	90 (23.3%)	25 (24.8%)	0.50 (AA vs. AC)
AC	164 (42.5%)	36 (35.6%)	0.43 (AC vs. CC)
CC	82 (21.2%)	23 (22.8%)	0.89 (AA vs. CC)
MAF (C)	48.8%	43.5%	0.93
rs1800588 (C-514T (C/T) (n)	386	101
CC	201 (52.1%)	43 (42.6%)	0.75 (CC vs. CT)
CT	129 (33.4%)	31 (30.7%)	0.001 (CT vs. TT)^a
TT	16 (4.1%)	12 (11.9%)	0.001 (CC vs. TT)^a
MAF (T)	23.3%	39.7%	<0.0001^a
rs690 (Val155Val) (G/T) (n)	331	90
GG	94 (28.4%)	34 (37.8%)	0.06 (GG vs. GT)
GT	174 (52.6%)	37 (41.1%)	0.34 (GT vs. TT)
TT	63 (19.0%)	19 (21.1%)	0.69 (GG vs. TT)
MAF (T)	45.3%	41.7%	0.43

P value indicates a significant difference.

MAF, minor allele frequency; TG, triglyceride.

In Table 7, a linear regression analysis was done to estimate the effect size β (B) of the four HL gene variants with various quantitative traits among subjects without diabetes. In the case of the −514 C/T variant, we observed a significant effect size (B) of 0.06 with an SE of 0.21 (P=0.003). Also, in the case of the rs6074 (Thr479Thr) variant, a significant B of 0.79 was observed (P=0.01). The other variants did not show any significant association with any of the quantitative traits among the NGT subjects.

Table 7.

Estimation of Effect Size for Quantitative Traits Among the Hepatic Lipase Gene Variants Among Normal Glucose Tolerance Subjects

Polymorphism	B (β)	SE	P value ^a
C-514T
Fasting plasma glucose (mg/dL)	1.92	2.49	0.43
Serum cholesterol (mg/dL)	1.82	1.55	0.24
HDL-C (mg/dL)	0.42	0.36	0.24
Log TG (mg/dL)	0.06^b	0.21^b	0.003^b
LDL-C (mg/dL)	1.05	1.39	0.45
rs690 (Val155Val)
Fasting plasma glucose (mg/dL)	−0.86	2.18	0.69
Serum cholesterol (mg/dL)	−0.81	1.38	0.55
HDL-C (mg/dL)	−0.14	0.32	0.64
Log TG (mg/dL)	−0.006	0.18	0.76
LDL-C (mg/dL)	−0.36	1.22	0.76
rs6083 (Ser193Asn)
Fasting plasma glucose (mg/dL)	1.13	2.33	0.62
Serum cholesterol (mg/dL)	−0.88	1.44	0.53
HDL-C (mg/dL)	0.32	0.34	0.33
Log TG (mg/dL)	−0.20	0.20	0.31
LDL-C (mg/dL)	−0.59	1.31	0.64
rs6074 (Thr479Thr)
Fasting plasma glucose (mg/dL)	0.54	2.21	0.80
Serum cholesterol (mg/dL)	1.42	1.35	0.29
HDL-C (mg/dL)	0.79	0.32	0.01
Log TG (mg/dL)	0.01	0.08	0.52
LDL-C (mg/dL)	−0.56	1.21	0.64

Adjusted for age, sex, and body mass index.

P value indicates a significant difference.

HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol; TG, triglyceride.

Table 8 shows the association between clinical and biochemical parameters with the four variants of the HL gene. In the case of the C-480T variant, the TT genotype was significantly associated with higher triglyceride levels compared with the other genotypes (P=0.002). In the case of the rs6074 (Thr479Thr) (A/C) variant, the CC genotype was significantly associated with lower HDL-C levels (41.3±9.8 mg/dL), compared with the AA genotype (43.6±10.2 mg/dL) (P=0.02). None of the parameters showed any significant association with rs690 (Val155Val) (G/T) variants in the HL gene among the study subjects. The significant associations observed were validated by performing multiple testing.

Table 8.

Association Between Hepatic Lipase Single Nucleotide Polymorphisms and Biochemical Parameters Stratified Based on the Genotypes

Clinical parameter, genotype ^a	rs1800588 (C-480T)	P^b	rs690 (Val155Val)	P^b	rs6083 (Ser193Asn)	P^b	rs6074 (Thr479Thr)	P^b
Fasting plasma glucose (mg/dL)
0	84.0±7.8		84.4±8.0		84.2±8.3		85±8.2
1	85.2±8.5	0.09	84.4±8.5	0.96	84.6±7.8	0.64	84±8.3	0.29
2	82.9±8.8		84.2±7.5		83.7±7.5		84.5±7.8
Serum cholesterol (mg/dL)
0	176.2±33.9		181.5±37.4		177.2±33.8		181±37
1	180.6±37.3	0.27	175.0±34.1	0.09	177.4±35.8	0.32	177±33.8	0.16
2	178.9±34.4		176.9±33.0		171.5±30.2		174±36
HDL-C (mg/dL)
0	42.6±10.0		43.4±10.4		41.5±9.2		43.4±9.7
1	43.2±9.9	0.68	42.3±9.7	0.40	43.3±10.2	0.10	43.6±10.2	0.02^c
2	43.0±10.2		42.4±9.4		42.9±10.2		41.3±9.8
Serum triglycerides (mg/dL)
0	112.1±64		119±74		121±65.4		122±80.1
1	121.0±65	0.002^c	114±58.7	0.73	116±65	0.56	112.6±58.5	0.58
2	145.2±91.1		120.6±7		113±98		121±80.2
LDL-C (mg/dL)
0	111.3±29.7		114.2±32.7		111.5±28.6		113±31
1	113.0±31.6	0.40	109.9±29.0	0.22	110.9±30.9	0.29	110±29.2	0.33
2	106.9±26.5		110.4±28.6		106.0±28.9		108.6±31

Data are mean±SD values.

0 is the homozygous normal genotype, 1 is heterozygous, and 2 is the homozygous variant genotype.

P adjusted for age and sex.

P value indicates a significant difference.

HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol.

Association of the haplotype with HDL-C and serum triglyceride levels

Figure 1 shows the LD pattern observed in the HL gene with respect to the four variants studied among NGT subjects. The LD value between rs690 (G/T) and rs6074 (A/C) was weak with r ²=0.02, the LD between rs1800588 (C-482T) and rs690 (G/T) was very weak with r ²=0.00, and the LD value between rs6083 (G/A) and rs6074 (A/C) was moderate with r ²=0.13.

FIG. 1.

Linkage disequilibrium pattern of the hepatic lipase gene (four loci). Pairwise linkage disequilibrium coefficients D′×100 are shown in each cell.

Table 9 shows the haplotypes obtained with Haploview version 4.2 software. The haplotypes associated were tested for multiple correction (α/number of possible haplotypes), where α=0.05. Owing to lower LD values (r ²=0.00) between the rs1800588 (C/T) (−C514T) variant and other variants, the rs1800588 (C/T) (−C514T) variant was not included in the haplotype block. So the other three SNPs were included in the haplotype block. Therefore, in combination with three SNPs, rs6074 (Thr479Thr) (C/A), rs690 (Val155Val) (G/T), and rs6083 (Ser193Asn) (G/A) in the coding region of the HL gene, eight haplotype combinations were obtained, of which the GAA and TGC haplotypes were taken for further analysis with various disease phenotypes. Because eight tests were performed corresponding to the eight haplotypes satisfying the selection criterion, a multiple correction was done using Bonferroni's correction. The true association of the haplotype was tested using permutation analysis in Haploview software, wherein 10,000 permutations were computed, to obtain the differences in haplotype frequencies between cases and controls. We observed that the difference in the proportion in the haplotypes GAA and TGC between the cases and controls was truly significant.

Table 9.

Haplotype Frequencies of the Three Single Nucleotide Polymorphisms of the Hepatic Lipase Gene Phenotype: High-Density Lipoprotein Levels

Haplotype Block 1	Haplotype frequency	Case, control frequencies	P value ^a	Permutation P value ^b
GGA	0.263^c	0.257, 0.268^c	0.006^c	0.005^c
TAC	0.161	0.150, 0.170	0.3142	NS
GGC	0.138	0.149, 0.130	0.2985	NS
TGA	0.136	0.125, 0.145	0.2862	NS
TGC	0.12^c	0.150, 0.096^c	0.0021^c	0.002^c
GAC	0.108	0.105, 0.110	0.7416	NS
GAA	0.038	0.033, 0.041	0.4115	NS
TAA	0.036	0.031, 0.039	0.4017	NS

P value after multiple corrections (P value × number of tests/number of haplotypes).

Permutation P values were calculated based on 10,000 permutation replications.

P value indicates a significant difference.

Case, low high-density lipoprotein level; control, normal high-density lipoprotein level; NS, not significant.

For HDL-C levels, the frequency of the GAA haplotype was significantly higher among the normal HDL group (0.268) compared with the low HDL group (0.257) (P=0.006). The frequency of the TGC haplotype was observed to be significantly higher among the low HDL group (0.150) compared with the normal HDL group (0.096) (P=0.002).

In the case of serum triglycerides, the haplotype frequencies were not significantly different between the cases and controls (data not shown).

Association of TGC haplotype with quantitative traits among the subjects without diabetes

Table 10 shows the association of the TGC haplotype with various biochemical parameters. The TGC haplotype was significantly associated with hypertriglyceridemia: the subjects with the TGC haplotype showed significantly higher serum triglyceride levels (2.03±0.22 mg/dL) compared with the other haplotypes (1.99±0.2 mg/dL) (P=0.05). We also observed significantly lower HDL-C levels among the TGC carriers (41.4±9.8 mg/dL) compared with the other haplotypes (43.7±10.0 mg/dL) (P=0.003).

Table 10.

Association of the TGC Haplotype with the Quantitative Traits

	Haplotype combination
Quantitative trait	TGC	Other haplotypes	P value ^a
HDL-C (mg/dL)	41.4±9.8	43.7±10.0	0.003^b
Log-transformed serum triglycerides (mg/dL)	2.03±0.22	1.99±0.2	0.05^b
Fasting plasma glucose (mg/dL)	85±7.8	84.0±8.2	0.30
Serum cholesterol (mg/dL)	214±50.1	200±38.9	0.26
LDL-C (mg/dL)	112.4±29.7	108±34.0	0.08
Glycated hemoglobin (%)	5.9±0.47	5.6±0.48	0.47

Data are mean±SD values.

P value after multiple corrections (P value × number of tests/number of haplotypes).

P value indicates a significant difference.

HDL-C, high-density lipoprotein; LDL, low-density lipoprotein.

Discussion

In this case-control study, we aimed to investigate the association of the HL gene with dyslipidemia. We genotyped four common variants: rs1800588 (C/T) (also denominated as −480 C/T or −514 C/T) located in the promoter region; rs6083 (Ser193Asn) (G/A) variant located in exon 4; rs690 (Val155Val), located in exon 3; and rs6074 (Thr479Thr) (A/C) variant, located in exon 9 of the HL gene.

We found that the T allele of the variant −480 C/T located in the promoter region of the HL gene was associated with higher triglyceride levels. Also, the TGC haplotype was significantly associated with low HDL-C levels among the study subjects. Studies among a Finnish population³³ also found the −480 C/T polymorphism to be associated with insulin resistance and high triglyceride levels. In our study the TT genotype was found to confer a 2.5 times higher risk of hypertriglyceridemia.

The proximal promoter region of the HL gene is an important binding site for upstream stimulatory factor-1, and the −480 C/T substitution might induce changes in the E-box motif from CACGTG to CATGTG. This disruption in the binding site is probably responsible for lowering the HL gene activity.³⁴ Because HL catalyzes the hydrolysis of TG from intermediate-density lipoprotein and LDL,³⁵ such defects in the HL gene due to the promoter variant −480 C/T may lead to hypertriglyceridemia. Studies on an interactive effect between HL (also known as LIPC [lipase, hepatic]) gene variants and apolipoprotein E2 and that included C-514T,G-250A variants showed strong association of the TT genotype of the −514 C/T variant with hypertriglyceridemia among healthy Canadian adults³⁶ and similar association with serum triglycerides among an Iranian population,³⁷ strengthening the finding among NGT subjects in the present study. Although a few studies have shown quite a significant association with HDL-C in other ethnic populations,^38
–40 the present study did not find any association with HDL-C.

The rs6074 (Thr479Thr) (A/C) variant located in exon 9 of the HL gene was significantly associated with low HDL-C levels among the study subjects; however, correction for age, gender, and BMI abolished the association. Moreover, the CC genotype was observed to be significantly associated with low HDL-C levels (41.3±9.8 mg/dL) even after correcting for age and sex. An earlier study on two white populations failed to show an association with HDL-C.⁴¹ HL probably has anti-atherogenic functions involving the uptake of HDL-C by the liver as part of the reverse cholesterol transport pathway.⁴² Although a synonymous variation, this might facilitate biophysical change in the conformation and energetic aspects of the gene, resulting in enhancement of the gene function. High HL activity is associated with an increase in small dense LDL particles and increased risk of vascular events.⁴³

With reference to the rs6083 (Ser193Asn) (G/A) variant, located in exon 4 of the HL gene, we observed significantly lower serum triglycerides levels among the subjects with the AA genotype compared with the GG genotype. Exon 4 of the HL gene is the region that binds to the lipoprotein substrate.⁴⁴ This points to the potential role played by this variant in enhancing the activity of the HL enzyme in the hydrolysis of the triglycerides of intermediate-density lipoproteins. Studies conducted among white populations^41,45 showed no significant association of this variant with HDL-C levels.

The haplotype analysis representing three variants in the HL gene showed the GAA haplotype as a protective haplotype, conferring lower risk toward low HDL-C levels among the study subjects, and the TGC haplotype proved to be a high-risk haplotype, conferring high risk toward low HDL-C level. The benefit of a haplotype-based analysis is that it captures all of the variation across a region, which aids in improving the ability to detect an association. Hence we can delineate the association of the HL gene variants with major dyslipidemic phenotypes among our study subjects without diabetes. Apart from the −480 C/T variant, there are not many studies that support the association of rs690 (Val155Val) (G/T), rs6083 (Ser193Asn) (G/A), and rs6074 (Thr479Thr) (C/A) variants with HDL-C and triglycerides. By identifying whole chromosomal regions, haplotypes have improved power and reproducibility in elucidation of disease–gene associations.

To circumvent the problem of population stratification, we performed a case-control study at six unlinked marker loci believed to be unrelated to the disease under study, but known to have allelic diversity among different populations.⁴⁶ The allele frequency difference was not statistically significant at any of the loci, indicating that the findings in this study were unlikely to be an artifact of population substructuring.

To our knowledge this is the first study of the association of four variants of the HL gene with HDL-C and serum triglycerides in Asian Indians. We conclude that in this ethnic group, the rs1800588 (C/T) (C-480T) variant is associated with hypertriglyceridemia, that the rs6074 (Thr479Thr) (A/C) variant is associated with low HDL-C levels, and that the haplotype TGC confers susceptibility to low HDL-C levels.

Footnotes

Acknowledgments

K.A.A. was supported by the Council of Scientific and Industrial Research. The Chennai Wellingdon Corporate Foundation supported the CURES field studies. This is the 109^th publication from the CURES (CURES-109).

Author Disclosure Statement

No competing financial interests exist.

References

World Health Organization:. Quantifying selected major risks to health. The World Health Report 2002—Reducing Risks, Promoting Healthy Life. Geneva: World Health Organization, 2002; 47–97.

Eaton

. Hyperlipidemia. Prim Care Clin Office Pract, 2005; 32:1027–1055.

Mather

, Keen

. The Southall Diabetes Survey: prevalence of known diabetes in Asians and Europeans. BMJ, 1985; 291:1081–1084.

McKeigue

. Coronary heart disease in Indians, Pakistanis and Bangladeshis: etiology and possibilities for prevention. Br Heart J, 1992; 67:341–342.

Mohan

, Sharp

, Cloke

, Burrin

, Schumer

, Kohner

. Serum immunoreactive insulin responses to a glucose load in Asian Indian and European type 2 (non-insulin dependent) diabetic patients and control subjects. Diabetologia, 1986; 29:235–237.

Mohan

, Deepa

. Risk factors for coronary artery disease in Indians. J Assoc Physicians India, 2004; 52:95–97.

Joshi

. Metabolic syndrome—emerging clusters of the Indian phenotype. J Assoc Physicians India, 2003; 51:445–446.

Mohan

, Sandeep

, Deepa

, Shah

, Varghese

. Epidemiology of type 2 diabetes: Indian scenario. Indian J Med Res, 2007; 125:217–230.

Yajnik

, Fall

, Vaidya

, Pandit

, Bavdekar

, Bhat

, Osmond

, Hales

, Barker

. Fetal growth and glucose and insulin metabolism in four-year old Indian children. Diabet Med, 1995; 12:330–336.

10.

Vimaleswaran

, Radha

, Ghosh

, Majumder

, Deepa

, Babu

, Rao

, Mohan

. Peroxisome proliferator-activated receptor-gamma co-activator-1alpha (PGC-1alpha) gene polymorphisms and their relationship to Type 2 diabetes in Asian Indians. Diabet Med, 2005; 22:1516–1521.

11.

Vimaleswaran

, Radha

, Ramya

, Babu

, Savitha

, Roopa

, Monalisa

, Deepa

, Ghosh

, Majumder

, Rao

, Mohan

. A novel association of a polymorphism in the first intron of adiponectin gene with type 2 diabetes, obesity and hypoadiponectinemia in Asian Indians. Hum Genet, 2008; 123:599–605.

12.

Mohan

, Venkatraman

, Pradeepa

. Epidemiology of cardiovascular disease in type 2 diabetes: the Indian scenario. J Diabetes Sci Technol, 2010; 4:158–170.

13.

Gupta

, Guptha

, Agrawal

, Kaul

, Gaur

, Gupta

. Secular trends in cholesterol lipoproteins and triglycerides and prevalence of dyslipidemias in an urban Indian population. Lipids Health Dis, 2008; 7:40.

14.

Ramachandran

, Snehalatha

, Yamuna

, Murugesan

, Narayan

. Insulin resistance and clustering of cardiometabolic risk factors in urban teenagers in southern India. Diabetes Care, 2007; 30:1828–1833.

15.

Radhika

, Ganesan

, Sathya

, Sudha

, Mohan

. Dietary carbohydrates, glycemic load and serum high-density lipoprotein cholesterol concentrations among South Indian adults. Eur J Clin Nutr, 2009; 63:413–420.

16.

Pradeepa

, Deepa

, Rani

, Premalatha

, Saroja

, Mohan

. Socioeconomic status and dyslipidaemia in a South Indian population: the Chennai Urban Population Study (CUPS 11) Natl Med J India, 2003; 16:73–78.

17.

Radha

, Mohan

, Vidya

, Ashok

, Deepa

, Mathias

. Association of lipoprotein lipase Hind III and Ser 447 Ter polymorphisms with dyslipidemia in Asian Indians. Am J Cardiol, 2006; 97:1337–1342.

18.

Perret

, Mabile

, Martinez

, Tercé

, Barbaras

, Collet

. Hepatic lipase: structure/function relationship, synthesis, and regulation. J Lipid Res, 2002; 43:1163–1169.

19.

Deeb

, Zambon

, Carr

, Ayyobi

, Brunzell

. Hepatic lipase and dyslipidemia: interactions among genetic variants, obesity, gender, and diet. J Lipid Res, 2003; 44:1279–1286.

20.

Brunzell

, Deeb

. Familial lipoprotein lipase deficiency, apo CII deficiency, and hepatic lipase deficiency. Scriver

, Beaudet

, Sly

, Vale

. The Metabolic and Molecular Basis of Inherited Disease. New York: McGraw-Hill, 2001; 2789–2816.

21.

Jansen

, Verhoeven

, Weeks

, Kastelein

, Halley

, van den Ouweland

, Jukema

, Seidell

, Birkenhäger

. Common C-to-T substitution at position 7480 of the hepatic lipase promoter associated with a lowered lipase activity in coronary artery disease patients. Arterioscler Thromb Vasc Biol, 1997; 17:2837–2842.

22.

Hegele

, Tu

, Connelly

. Human hepatic lipase mutations and polymorphisms. Hum Mutat, 1992; 1:320–324.

23.

Zambon

, Deeb

, Hokanson

, Brown

, Brunzell

. Common variants in the promoter of the hepatic lipase gene are associated with lower levels of hepatic lipase activity, buoyant LDL and higher HDL2 cholesterol. Arterioscler Thromb Vasc Biol, 1998; 18:1723–1729.

24.

Juo

, Han

, Smith

, Colangelo

, Liu

. Promoter polymorphisms of hepatic lipase gene influence HDL₂ but not HDL₃ in African American men: CARDIA study. J Lipid Res, 2011; 42:258–264.

25.

Deeb

, Peng

. The C-514T polymorphism in the human hepatic lipase gene promoter diminishes its activity. J Lipid Res, 2000; 41:155–158.

26.

Hodoglugil

, Williamson

, Mahley

. Polymorphisms in the hepatic lipase gene affect plasma HDL-cholesterol levels in a Turkish population. J Lipid Res, 2010; 51:422–430.

27.

Arai

, Yamamoto

, Matsuzawa

, Saito

, Yamada

, Oikawa

, Mabuchi

, Teramoto

, Sasaki

. Polymorphisms in four genes related to triglyceride and HDL-cholesterol levels in the general Japanese population in 2000. J Atheroscler Thromb, 2005; 12:240–250.

28.

Deepa

, Pradeepa

, Rema

, Anjana

, Deepa

, Shanthirani

, Mohan

. The Chennai Urban Rural Epidemiology Study (CURES)—study design and methodology (Urban Component) (CURES–1) J Assoc Physicians India, 2003; 51:863–870.

29.

Grundy

, Cleeman

, Merz

CNB

Jr , Brewer

, Clark

, Hunninghake

, Pasternak

, Smith

Jr , Stone

. National Heart, Lung, and Blood Institute, American College of Cardiology Foundation, American Heart Association: Implications of recent clinical trials for the National Cholesterol Education Program Adult Treatment Panel III guidelines. Circulation, 2004; 110:227–239.

30.

Matthews

, Hosker

, Rudenski

, Naylor

, Treacher

, Turner

. Homeostasis model assessment: insulin resistance and cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia, 1985; 28:412–419.

31.

Maniatis

, Fritsch

, Sambrook

. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982; 149–151.

32.

Barrett

, Fry

, Maller

, Daly

. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics, 2005; 21:263–265.

33.

Fan

Y-M

, Raitakari

, Kähönen

, Hutri-Kähönen

, Juonala

, Marniemi

, Viikari

, Lehtimäki

. Hepatic lipase promoter C-480T polymorphism is associated with serum lipids levels, but not subclinical atherosclerosis: the Cardiovascular Risk in Young Finns Study. Clin Genet, 2009; 76:46–53.

34.

Botma

, Verhoeven

, Jansen

. Hepatic lipase promoter activity is reduced by the C-480T and G-216A substitutions present in the common HL gene variant, and is increased by upstream stimulatory factor. Atherosclerosis, 2001; 154:625–632.

35.

Pihlajamaki

, Karjalainen

, Karhapaa

. G-250A substitution in promoter of hepatic lipase gene is associated with dyslipidemia and insulin resistance in healthy control subjects and in members of families with familial combined hyperlipidemia. Arterioscler Thromb Vasc Biol, 2000; 20:1789–1795.

36.

Wood

, Fullerton

, El-Sohemy

, Bakovic

. Interactions between hepatic lipase and apolipoprotein E gene polymorphisms affect serum lipid profiles of healthy Canadian adults. Appl Physiol Nutr Metab, 2008; 33:761–768.

37.

Kashani Farid

, Azizi

, Hedayati

, Daneshpour

, Shamshiri

, Siassi

. Association between CETP Taq1B and LIPC –514C/T polymorphisms with the serum lipid levels in a group of Tehran's population: a cross sectional study. Lipids Health Dis, 2010; 9:96.

38.

Pollex

, Hegele

. Genetic determinants of plasma lipoproteins. Nat Clin Pract Cardiovasc Med, 2007; 4:600–609.

39.

Park

, Choi

, Chae

, Cho

, Oh

, Kim

, Lee

, Park

, Choi

. Hepatic lipase C514T polymorphism and its relationship with plasma HDL-C levels and coronary artery disease in Koreans. J Biochem Mol Biol, 2003; 36:237–242.

40.

Shohet

, Vega

, Anwar

, Cigarroa

, Grundy

, Cohen

. Hepatic lipase (LIPC) promoter polymorphism in men with coronary artery disease.Allele frequency and effects on hepatic lipase activity and plasma HDL-C concentrations. Arterioscler Thromb Vasc Biol, 1999; 19:1975–1978.

41.

Bauerfeind

, Knoblauch

, Costanza

, Luganskaja

, Toliat

, Nürnberg

, Luft

, Reich

, Morabia

. Concordant association of lipid gene variation with a combined HDL/LDL-cholesterol phenotype in two European populations. Hum Hered, 2006; 61:123–131.

42.

Jansen

, Verhoeven

AJM

, Sijbrands

. Hepatic lipase: a pro- or antiatherogenic protein? J Lipid Res, 2002; 43:1352–1362.

43.

Rader

. Lipid disorders. Topol

. Textbook of Cardiovascular Medicine. Philadelphia: Lippincott-Raven, 1998; 59–90.

44.

Cai

, Wong

, Chen

, Chan

. Structure of the human hepatic triglyceride lipase gene. Biochemistry, 1989; 28:8966–8971.

45.

van Hoek

, Dallinga-Thie

, Steyerberg

, Sijbrands

. Diagnostic value of post-heparin lipase testing in detecting common genetic variants in the LPL and HL genes. Eur J Hum Genet, 2009; 17:1386–1393.

46.

Devlin

, Roeder

, Wasserman

. Genomic control, a new approach to genetic based association studies. Theor Popul Biol, 2001; 60:155–166.