Abstract
CD86 (B7-2), one of the costimulatory molecules on antigen-presenting cells, plays essential roles not only in autoimmunity and transplantation but also in tumor immunity. CD86 + 1057G/A polymorphism (rs1129055) is associated with various diseases. The objective of this study was to investigate the association between CD86 + 1057G/A polymorphism and susceptibility to osteosarcoma in a Chinese population. The CD86 + 1057G/A mutation was detected by polymerase chain reaction–restriction fragment length polymorphism in 205 osteosarcoma cases and 216 age-matched healthy controls. Frequencies of CD86 + 1057 AA genotype and +1057 A allele were significantly increased in osteosarcoma patients than in healthy controls (odds ratio = 2.18, 95% confidence interval, 1.21–3.93, p = 0.008; and odds ratio = 1.43, 95% confidence interval, 1.08–1.88, p = 0.011). Our data suggest that the +1057G/A polymorphism of the CD86 gene is associated with increased susceptibility to osteosarcoma.
Introduction
CD86 (B7-2), one of the costimulatory molecules on antigen-presenting cells, plays essential roles not only in autoimmunity and transplantation (Salomon and Bluestone, 2001), but also in tumor immunity (Seliger et al., 2008). CD86 modulates T-cell responses through the CD28/CTLA-4 pathway (Greenwald et al., 2005; Seliger et al., 2008). Tumor cells lacking B7-1 and B7-2 are not able to deliver the costimulatory signals for T-cell activation, and result in T-cell anergy and immune unresponsiveness (Seliger et al., 2008). A recent study has shown that CD86 is expressed on human tumor cells such as osteosarcoma and breast cancer, and that treatment of cells from CTLA-4-expressing osteosarcoma tumor lines with recombinant CD86 induces apoptosis with sequential activation of caspase-8 and caspase-3 (Contardi et al., 2005). All these data suggest that changes in CD86 expression or function may influence the development of osteosarcoma.
The CD86 gene, a single-copy gene, is located on chromosome 3q21 in humans. The CD86 gene consists of eight exons. Exons 7 and 8 encode the cytoplasmic tail of the CD86 molecule (Jellis et al., 1995). A polymorphism at codon 304 located in exon 8 (a G to A transition at position +1057) results in an alanine to threonine substitution (Delneste et al., 2000). Several studies have reported the association of CD86 + 1057G/A polymorphism with different human diseases, such as asthma (Corydon et al., 2007), liver transplantation (Marin et al., 2005), and colorectal cancer (Pan et al., 2010). However, the relationship between this CD86 mutation and osteosarcoma occurrence remains unknown. There have been no reports about the prevalence of this CD86 mutation in osteosarcoma. Clarification of the relationship between CD86 gene mutation and osteosarcoma may indicate a role of CD86 function in the etiology of osteosarcoma and provide clues that might help to guide treatment of this disease. To clarify this relationship, we have analyzed CD86 gene +1057G/A polymorphism in clinical cases of osteosarcoma and normal controls.
Materials and Methods
Patients and controls
The study group included 205 newly diagnosed osteosarcoma cases (aged 11–69 years) recruited from General Hospital of Jinan Military Command and Shandong Cancer Hospital and Institute from January 2001 to July 2009. All cases were diagnosed without a familial cancer syndrome. A total of 216 controls (aged 14–63 years) were recruited from healthy volunteers who visited the two hospitals from July 2001 to July 2009 for general health exams. All the control subjects were matched with the patient population in terms of age, sex, and residence area (urban or rural). All subjects were unrelated ethnic Han Chinese. Written informed consent was obtained from each participant. The study was approved by the Ethics Committees of General Hospital of Jinan Military Command and Shandong Cancer Hospital and Institute. Each study participant provided a peripheral blood sample.
DNA extraction and genotyping
Genomic DNA was extracted from 2 mL frozen whole blood using the DNA Extraction Kit (Fastagen) according to the manufacturer's protocol. The CD86 + 1057G/A polymorphism was examined by polymerase chain reaction (PCR)–restriction fragment length polymorphism and DNA sequencing analyses. The PCR primers for amplification of the CD86 + 1057G/A polymorphism were 5′ TCCATATACCTGAAAGATCTGATGCA 3′ (forward) and 5′ GAGCTGGAGTTACAGGGAGGCT 3′ (reverse). PCR was performed in a total volume of 25 μL containing 100 ng genomic DNA, 2.5 μL of 10× PCR buffer, 1.5 mM MgCl2, 0.15 mM dNTPs, 25 pM of each primer, and 1U of Taq DNA polymerase. PCR cycle conditions consisted of an initial denaturation step at 94°C for 5 min, followed by 35 cycles of 30 s at 94°C, 30 s at 60°C, 30 s at 72°C, and a final elongation at 72°C for 10 min. The PCR products were then digested with 1U BbvI restriction enzyme (New England BioLabs) at 37°C for 4 h. Restriction fragments were distinguished on 6% polyacrylamide gels and observed by silver staining to determine the genotypes. To confirm the genotyping results, 20% of PCR-amplified DNA samples were examined by DNA sequencing. Results between PCR and DNA sequencing analysis were 100% concordant.
Statistical analysis
The SPSS statistical software package ver.19.0 (SPSS Inc.) was used for statistical analysis. p-Value of mean age between the study groups was compared by Student t-test (Table 1). p-Value of gender was compared by chi-square test (Table 1). The polymorphism was tested for deviation from Hardy-Weinberg equilibrium by comparing the observed and expected genotype frequencies using the chi-square test. For single nucleotide polymorphism (SNP) analysis, genotype and allele frequencies of CD86 were compared between groups using the chi-square test (Tables 2 and 3), and odds ratios (OR) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression. p-Values <0.05 were considered significant.
p < 0.05.
L1, long tubular bones; A2, axial skeleton.
Results
The CD86 + 1057G/A polymorphism in osteosarcoma cases and healthy controls
A total of 205 osteosarcoma cases and 216 controls were recruited for the present study. All subjects were ethnic Chinese. Demographic and other selected characteristics of the cases and controls are presented in Table 1. Cases and controls did not show statistically significant differences with regard to age, sex, tumor location, and presence of metastasis.
We analyzed the association of the CD86 + 1057G/A polymorphism in 205 osteosarcoma patients and 216 healthy controls (Table 2). The alleles genotyped were in HWE (p > 0.05). CD86 + 1057 AA genotype frequency was significantly higher in patients than in controls (OR = 2.18, 95% CI 1.21–3.93, p = 0.008) and the CD86 + 1057 A allele carrier frequency was also significantly higher in patients than in controls (OR = 1.43, 95% CI 1.08–1.88, p = 0.011). These data suggested that the CD86 + 1057 AA genotype and +1057 A allele were associated with increased susceptibility of osteosarcoma in Chinese population.
CD86 + 1057G/A polymorphism and clinical-pathological characteristics in osteosarcoma patients
We further evaluated the association between CD86 +1057G/A polymorphism and clinical-pathological factors in osteosarcoma patients. The stratification analysis including age, gender, tumor location, and metastasis were shown (Table 3). None of these differences were statistically significant. The +1057G/A mutation was not associated with clinical-pathological factors such as age, gender, tumor location, and metastasis in osteosarcoma patients.
Discussion
Osteosarcoma is the most common primary bone malignancy (Dorfman and Czerniak, 1995). Although there have been many studies on its genetics, biology pathology, and clinical aspects, the etiology of osteosarcoma is not well understood. The current study reported that polymorphism in the CD86 gene could be a risk factor in the development of osteosarcoma.
CD86, one of the key costimulatory molecules on antigen-presenting cells, is involved in the initiation of T-cell immunity (Salomon and Bluestone, 2001). CD86 can induce T-cell activation, proliferation, and differentiation and promote secretion of inflammatory factors by binding to CD28 (Roitt et al., 2001). CD86 negatively regulates T-cell proliferation and suppresses ongoing T-cell responses by binding to CTLA4 (Krummel and Allison, 1995; Waterhouse et al., 1995). CTLA4, a homolog of CD28, has higher affinity for CD86 than CD28 molecules and is mainly expressed on activated T cells (Salomon and Bluestone, 2001; Corydon et al., 2007). Although the role of CD86 in the pathogenesis of cancer remains uncertain, growing evidence indicates that CD86 might be important in tumor immunity (Hodge et al., 1994; Allison et al., 1995; Pizzoferrato, 2004). For example, Kronfeld et al. (2005) reported that both CD80 and CD86 induced T-cell proliferation equally efficient in a human leukocyte antigen (HLA) class I-matched situation of renal carcinoma cells. Moreover, CD86 was more effective in the induction of interferon-gamma and granulocyte-macrophage colony-stimulating factor secretion than CD80 in both HLA class I-matched and mismatched situations of renal carcinoma cells. Loser et al. (2005) also reported that CD86 played a crucial role in protection against skin tumors. In addition, a study showed that CD86 was expressed on human tumor cells such as osteosarcoma and breast cancer, and treatment of cells from CTLA-4-expressing osteosarcoma tumor lines with recombinant CD86 induced apoptosis associated with sequential activation of caspase-8 and caspase-3 (Contardi et al., 2005). Thus, changes in CD86 expression or function may influence the development of osteosarcoma.
Two SNPs in the CD86 gene (+1057G/A and +2379G/C) have been identified in the Chinese population. Of these polymorphisms, the +1057G/A mutation has been widely researched. The +1057 A allele, which causes an amino acid change (from alanine to threonine) in exon 8, may alter the level of tyrosine kinase phosphorylation (Nunes et al., 1996; Slavik et al., 1999; Delneste et al., 2000) and then affect expression of cytokines such as IL-2 and IL-4 (Ueda et al., 1995; Stremmel et al., 1999). Those cytokines are important in activating specific immune cell populations, including B cells, eosinophils, mast cells, and macrophages. Several studies have shown the relationship between CD86 + 1057G/A polymorphism and different human diseases, such as asthma (Corydon et al., 2007), liver transplantation (Marin et al., 2005), and colorectal cancer (Pan et al., 2010). Although some other studies reported that CD86 + 1057G/A polymorphism was not associated with rheumatoid arthritis, systemic lupus erythematosus (Matsushita et al., 2000), and sarcoidosis in Japanese patients (Handa et al., 2005), it is reasonable to hypothesize that CD86 + 1057G/A polymorphism may be related to the risk of osteosarcoma. The other CD86 gene polymorphism identified in the Chinese population, +2379G/C, lies in the 3′ UTR. The function of the mutation is not fully understood. Liu et al. reported that frequency of CD86 + 2379 CC genotype was extremely low and this polymorphism was not associated with chronic obstructive pulmonary disease in Chinese population (Liu et al., 2010). In this study, we focused on the CD86 + 1057G/A polymorphism and found that the +1057 AA genotype and +1057 A allele of CD86 were associated with a significantly increased risk of developing osteosarcoma. It would be interesting and important to conduct independent studies in other ethnic populations for comparison.
In summary, the current study demonstrated that the CD86 gene +1057 AA genotype and +1057 A allele are associated with the development of osteosarcoma in Chinese populations. Our results raise the possibility that a function shift caused by genetic variants in immune system genes could have important consequences for the pathogenesis of osteosarcoma.
Footnotes
Acknowledgment
We thank all patients and normal individuals for participating in this study.
Disclosure Statement
No competing financial interests exist.