Association Between Promoter Variants of Interleukin-18 and Schizophrenia in a Han Chinese Population

Abstract

An increasing amount of evidence suggests that interleukin-18 (IL-18) plays a pivotal role in the pathophysiology of schizophrenia. However, association between single nucleotide polymorphism of IL-18 and the risk of schizophrenia has not been clarified. This study examined whether two promoter polymorphisms -137 G/C (rs187238) and -607 C/A (rs1946518) of IL-18 were associated with schizophrenia and six clinical symptoms (disorder of perception, thought disorder, disturbance of emotion, disorder of behavior and volition, suicide action, and aggressive action) to provide data for screening high-risk Han Chinese individuals. Three hundred seventy-two schizophrenic patients and 353 healthy controls from a Han Chinese population were examined to assess their genotype and allele frequencies of the two promoter polymorphisms of IL-18. The genotype distributions in both patients and controls were within Hardy–Weinberg equilibrium. No significant differences were observed in the genotype or the allele frequencies of the two single-nucleotide polymorphisms between patients and controls. However, genotype frequencies of -607 C/A showed significant differences between patients and controls in the appearance of perception disorder (χ ² = 6.153, p = 0.046). A significant difference was detected in -137 G/C between patients and controls in the appearance of aggressive action (χ ² = 3.909, p = 0.048). In conclusion, IL-18 gene promoter polymorphisms may not contribute to the susceptibility of schizophrenia in a Han Chinese population, but two single-nucleotide polymorphisms, -137 G/C and -607 C/A, may play a role in the development of perception disorder and aggressive action, respectively.

Introduction

I nterleukin-18 (IL-18), produced by macrophage-like cells, is a type 1 cytokine that plays an important role in the T-cell helper type 1 (Th1) response, primarily by its ability to induce interferon-γ production in T cells and natural killer cells (Smith, 1992; Dinarello, 1999; Kalina et al., 2000). IL-18 participates in neuron growth, differentiation, and apoptosis (Smith and Maes, 1995; Dinarello, 2006), playing a role in brain development and function (Schmitz and Chew, 2008). IL-18 takes part in pathological conditions of the central nervous system (Alboni et al., 2010). Underactivation in type-1 immune response is part of the pathophysiology of schizophrenia (Müller et al., 2000; Müller and Schwarz, 2010), causing an imbalance in the activation of the enzyme indoleamine 2,3-dioxygenase and in tryptophan–kynurenine metabolism (Sperner-Unterweger et al.,1999; Grohmann et al., 2003). This mechanism results in increased production of kynurenic acid in schizophrenia, which is associated with an imbalance in the glutamatergic neurotransmission, leading to N-Methyl-D-aspartate (NMDA) antagonism. Another study showed that the circulating level and in vitro production of IL-18 were changed in schizophrenia, reflecting the potential association between IL-18–mediated inflammation and schizophrenia (Tanaka et al., 2000). Thus, IL-18 is likely related to the pathogenesis of schizophrenia (Freedman et al., 2001).

The IL-18 gene is located on chromosome 11q22.2–q22.3, close to the dopamine receptor D2 locus and its promoter region. At this area, one region with suggestive evidence of linkage has been detected with schizophrenia (Suarez et al., 2006). So IL-18 gene might be connected to schizophrenia.The IL-18 gene is composed of six exons and five introns. Five single-nucleotide polymorphic positions in the promoter region have been found: -656T/G, -607A/C, -137G/C, +113/GT, and +127T/C (Giedraitis et al., 2001). Cloning and gene expression analyses have shown that -137G/C and -607C/A have a confirmed impact on IL-18 gene activity (Kalina et al., 2000; Giedraitis et al., 2001). Recently, the two single nucleotide polymorphism (SNP) loci have been associated with immune-related diseases, including Crohn's disease, diabetes, and rheumatoid arthritis (Kretowski et al., 2002; Tamura et al., 2002; Gracie et al., 2005; Rueda et al., 2005; Szeszko et al., 2006). In addition, their impact on the progression of mental disease, such as Alzheimer's disease, has been described (Yu et al., 2009). Perhaps, they are potential susceptibility loci for schizophrenia. These data inspired us to evaluate the association between the IL-18 gene promoter polymorphisms and schizophrenia, to provide new information for further study of genetic factors involved in schizophrenia and/or its clinical symptoms, which may be useful in screening high-risk populations.

Material and Methods

Patients

We recruited 372 schizophrenic patients in a Han Chinese population (mean age: 28.74 ± 12.581; 173 men and 199 women; age of onset: 27.07 ± 10.507 and 30.19 ± 13.580, respectively, 71 with family history and 301 without family history) in the inpatient unit of the West China Hospital in Chengdu, China, from October 2009 to July 2010. The basic clinical variables of the patients are shown in Table 1. Consensus diagnosis of each patient and evaluation of the clinical symptoms were made by two psychiatrists independently in accordance with the following criteria:

1. Met the Chinese Classification of Mental Disorders, third version (CCMD-3) or the International Classification of Diseases, 10th version (ICD-10)

2. Without immune system disease

3. Without other psychoses

Table 1.

Basic Clinical Variables of Patients

Variables	Subgroups	Male (N = 173)(%)	Female (N = 199)(%)	T	χ²	p-Value
Onset, years		27.07 ± 10.507	30.19 ± 13.580	2.448	—	0.015
Age group	10–20	54 (31.21)	60 (30.15)	—	3.263	0.196
	21–35	83 (47.98)	82 (41.21)	—	—	—
	>36	36 (20.81)	57 (28.64)	—	—	—

Bold numbers indicate that p value is less than 0.05.

A total of 353 healthy subjects in a Han Chinese population (173 men and 180 women; mean age: 37.01 ± 12.570) were recruited from physical examinations. All of the controls were interviewed to exclude any history of psychiatric disorders. Informed consent was obtained for all individuals tested. Our study was approved by the Ethical Committee of West China Hospital, Sichuan University.

Genomic DNA extraction

About 3 mL peripheral vein blood from patients was drawn into a Vacutainer tube containing the anticoagulant ethylenediaminetetracetic acid. The QIAamp^® DNA Blood mini kit (Qiagen) was used to extract genomic DNA. After being assessed for purity, yield, concentration, and A₂₆₀/A₂₈₀ ratio, DNA was diluted to 10 ng/μL. Several samples of three genotypes were previously genotyped by sequencing as references for the two SNPs.

IL-18 gene polymorphism type and high-resolution melting analysis

The genotypes of samples were detected by a high-resolution melting (HRM) method. Polymerase chain reaction (PCR) amplification for -137G/C and -607C/A variants was carried out under the same conditions in the LightCycler^® 480 Real-Time PCR System (Roche Diagnostics). The -607C/A PCR primers were 5′ GCCACACGGATACCATCATTAG 3′ (forward) and 5′ TGCCCTCTTACCTGAATTTTGG 3′ (reverse). The -137G/C PCR primers were 5′ TGGCAGAGGATACGAGTAC 3′ (forward) and 5′ GGACTAAGGAGGTGCTTTC 3′ (reverse). The 20 μL PCR contained 1.0 μL purified genomic DNA (10 ng/μL), 0.5 μL forward primer (10 μmol/L), 0.5 μL reverse primer (10 μmol/L), 1.0 μL 20X EVA-GREEN, 0.5 μL dNTP (10 mM), 0.2 μL Hot Star Taq^® Plus DNA polymerase, 2 μL 10X buffer, 1 μL 50 mM MgCl₂, and 13.8 μL H₂O. Real-time PCR was performed under the following conditions: an initial denaturation at 95°C for 15 min; amplification for 50 cycles of 95°C for 10 s, 60°C for 15 s, and extension at 72°C for 25 s; and denaturation at 95°C for 1 min. Then the products were cooled to 40°C for 1 min. HRM analyses were performed by slow heating from 65°C to 95°C at a rate of 0.01°C/s. All the data were analyzed by the LightCycler 480 Gene Scanning software v1.2 (Roche Diagnostics). Samples with a late amplification could generate unreliable melting profiles (Norambuena et al., 2009). Thus, samples associated with fluorescence of less than 60% of the average were discarded (including 7 samples from patients and 10 samples from control group); we repeated the extraction of DNA or HRM reaction. Normalization by selecting linear regions before (100% fluorescence) and after (0% fluorescence) the melting transition, temperature shifting by selecting threshold, and automatic grouping by calculation were analyzed step by step in software programs.

DNA sequencing

PCR products were purified using shrimp alkaline phosphatase. Sequencing primers for -137G/C and -607C/A were the same as those used in PCR. Nucleotide sequencing was detected by BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3130 genetic analyzer (Applied Biosystems), using both the forward and the reverse primers.

Statistical analysis

Deviation from Hardy–Weinberg equilibrium was assessed for each group. Statistical analysis was performed by SPSS 13.0. The comparison between patients and controls in both genotype and allele frequencies was determined using Pearson χ ² analysis as well as the relationship between the genotype and allele frequencies and clinical symptoms. The calculations of odds ratio and 95% confidence interval were conducted with the risk option of Crosstabs by SPSS 13.0. In addition, the onset ages of different sex patients were analyzed using the t-test. The level of significance for all statistical tests was 0.05.

Results

In this study, we investigated the distribution of IL-18 promoter variants -137G/C and -607C/A in 372 schizophrenic patients and 353 healthy controls in a Han Chinese population. The average onset age of male patient was earlier than female patients (T = 2.448, p = 0.015; Table 1).

The genotypes of -137G/C and -607C/A were in Hardy–Weinberg equilibrium in both the patient and control groups (p > 0.05 for all analyses). The genotype and allele frequencies of the two SNPs are shown in Table 2. In the patient group, the frequencies of -607C/A genotypes CC, CA, and AA were 24.46%, 54.84%, and 20.70%, respectively. In the control group, the frequencies of genotypes CC, CA, and AA were 30.88%, 48.16%, and 20.96%, respectively. The frequencies of alleles C and A were close in both the patient (C = 51.88%, A = 48.12%) and control groups (C = 54.96%, A = 45.04%). Two genotypes, GG and GC, were found at -137G/C locus, which showed a similar distribution in the patient and control groups (81.72%, 18.28% vs. 84.70%, 15.30%). The frequencies of allele C were also similar in both the patient and control groups (9.14% vs. 7.65%). The promoter variants -607C/A and -137G/C had similar genotype and allele frequencies in both the patients and controls. We then divided the cases into two subgroups according to family history. No difference between the allele or genotype of subgroups and the controls was detected (p > 0.05). From the power calculation, we estimated that the sample had a power of 81.33% (-137G/C) and 96.93% (-607C/A), respectively.

Table 2.

Allele and Genotype Frequencies of the Two Single-Nucleotide Polymorphisms in Interleukin-18

	Genotype					Allele
	CC	CA	AA	χ²	p-Value	C	A	χ²	p-Value	OR	95% CI
IL-18 −607C/A
Patients (N = 372) (%)	91 (24.46)	204 (54.84)	77 (20.70)	4.276	0.118	386 (51.88)	358 (48.12)	1.377	0.241	0.884	0.719–1.086
Controls (N = 353) (%)	109 (30.88)	170 (48.16)	74 (20.96)	—	—	388 (54.96)	318 (45.04)	—	—	—	—
Patients with family history (N = 71) (%)	24 (33.80)	33 (46.48)	14 (19.72)	4.289	0.117	81 (57.04)	61 (42.96)	1.872	0.171	1.293	0.894–1.870
Patients without family history (N = 301) (%)	67 (22.26)	171 (56.81)	63 (20.93)	—	—	305 (50.66)	297 (49.34)	—	—	—	—

	GG	GC	CC			G	C
IL-18 −137G/C
Patients (N = 372) (%)	304 (81.72)	68 (18.28)	0 (0)	1.151	0.283	676 (90.86)	68 (9.14)	1.045	0.307	0.823	0.567–1.196
Controls (N = 353) (%)	299 (84.70)	54 (15.30)	0 (0)	—	—	652 (92.35)	54 (7.65)	—	—	—	—
Patients with family history (N = 71) (%)	56 (78.87)	15 (21.13)	0 (0)	0.476	0.490	127 (89.44)	15 (10.56)	0.428	0.513	0.817	0.446–1.497
Patients without family history (N = 301) (%)	248 (82.39)	53 (17.61)	0 (0)	—	—	549 (91.20)	53 (8.80)	—	—	—	—

OR, odds ratio; CI, confidence interval; family history, if any immediate family members (including the parents, siblings, or children of the patient) suffer from the same disease.

Six related clinical symptoms (disorder of perception, thought disorder, disturbance of emotion, disorder of behavior and volitional, suicide action, and aggressive action) were analyzed in our study (Table 3). These characteristics are crucial to the clinical diagnosis of schizophrenia and easily distinguished, and all greatly influence the quality of patients' daily lives. We found that the genotype distribution of -607C/A was significantly associated with disorder of perception (χ ² = 6.153, p = 0.046). In addition, the frequency of genotype GC of -137G/C in patients with aggressive action was found to be significantly higher than in controls (χ ² = 3.909, p = 0.048).

Table 3.

Comparison Between Patients with Different Clinical Features and Controls

	Clinical features
Polymorphisms	Disorder of perception (N = 178)	Thought disorder (N = 260)	Disturbance of emotion (N = 97)	Disorder of behavior and volitional (N = 181)	Suicide action (N = 43)	Aggressive action (N = 49)
IL-18 -607C/A
Controls (N = 353)
CC (N = 109)	43	63	23	43	10	11
CA (N = 170)	106	145	58	96	24	29
AA (N = 74)	29	52	16	42	9	9
χ ²	6.153	4.113	4.125	2.980	1.200	2.221
p	0.046	0.128	0.127	0.225	0.549	0.329
Power calculation	0.7549	0.9525	0.8485	0.9115	0.9744	0.9441
C (N = 388)	192	271	104	182	44	51
A (N = 318)	164	249	90	180	42	47
χ ²	0.100	0.973	0.112	2.107	0.445	0.295
p	0.751	0.324	0.738	0.147	0.505	0.587
OR	1.042	1.121	1.056	1.207	1.165	1.124
95% CI	0.807–1.346	0.893–1.407	0.768–1.452	0.936–1.555	0.744–1.823	0.736–1.717
IL-18 -137G/C
Controls (N = 353)
GG (N = 299)	151	212	81	143	35	36
GC (N = 54)	27	48	16	38	8	13
CC (N = 0)	0	0	0	0	0	0
χ ²	0.002	1.081	0.083	2.723	0.317	3.909
p	0.969	0.299	0.773	0.099	0.573	0.048
Power calculation	0.9726	0.8186	0.9495	0.6179	0.9049	0.4960
G (N = 652)	329	472	178	324	78	85
C (N = 54)	27	48	16	38	8	13
χ ²	0.001	0.983	0.076	2.467	0.291	3.554
p	0.970	0.322	0.783	0.116	0.590	0.059
OR	0.991	1.228	1.085	1.416	1.238	1.847
95% CI	0.613–1.602	0.818–1.844	0.606–1.942	0.916–2.190	0.568–2.698	0.968–3.524

Bold numbers indicate that p value is less than 0.05.

Discussion

Schizophrenia is a heritable, complex mental disorder. Studies support that genes determine predisposition to schizophrenia to a great degree (McGuffin and Gottesman, 1999; Purcell et al., 2009; Stefansson et al., 2009). However, the contribution of each specific gene is very small. Candidate gene studies and genome-wide association studies have shown inconsistent results (Gilmore 2010). A list of schizophrenia candidate genes, including the IL-18 gene, was used to draft aschizophrenia-specific network using a multidimensional evidence-based approach (Sun et al., 2010).

The promoter region of the first exons of the IL-18 gene contains five polymorphisms, among which -607C/A and -137G/C were reported to affect the transcriptional activity of the IL-18 gene. At position -607, a change from C to A may disrupt a potential cAMP-responsive element-binding protein binding site. At position -137, a shift from G to C may change the H4TF-1 nuclear factor binding site. Cloning and gene expression analysis revealed that two SNPs of the IL-18 promoter at positions -607 and -137 may have an impact on interferon-γ production (Giedraitis et al., 2001; Khripko et al., 2008). In the present study, our results demonstrated no significant association in a Han Chinese population in genotype or allele frequencies of -137G/C and -607C/A and schizophrenia risk even after grouping by family history. We further estimated that our samples have power of 81.33% to detect -137G/C and 96.93% to detect -607C/A. Thus, the likelihood of a type II error with our sample size appears to be low. Other schizophrenia candidate genes influencing the production level of IL-18 might play a more important role than the IL-18 gene in the pathogenesis of schizophrenia, or other SNPs in IL-18 gene might be associated with schizophrenia. Further studies to explore the above hypotheses may provide strategies for approaching the genetic heterogeneity of this disease.

In 1999, Takeuchi et al. reported that overexpression of IL-18 was found in patients with some mental disorders, such as depression and panic disorder. In our study, further analysis of the relationship between the two IL-18 gene promoter polymorphisms and the existence of schizophrenia-associated clinical features showed that -607C/A genotypes might be related to the emergence of perception disorder and the GC genotype of -137G/C might contribute to the risk of aggressive action. No association was confirmed between these two SNPs and the appearance of thought disorder, disturbance of emotion, suicide action, and disorder of behavior and volitional. This finding indicated that IL-18 might be associated with some specific clinical manifestation of schizophrenia, not connected with the risk of schizophrenia. This research explored the role of IL-18 promoter polymorphism in the risk of schizophrenia and its relation to schizophrenia-associated clinical symptoms. The genotypes of samples were confirmed by HRM method. All three genotypes of -607C/A were detected, whereas only two genotypes of -137G/C were detected: GG and GC. This may be due to the low CC genotype frequency of -137G/C in the Chinese population (Liu et al., 2007). In our research, we studied only two promoter variants, and the sample size and the number of patients in each of the six subgroups with different clinical symptoms were moderate. In addition, the interaction between IL-18 SNPs and its protein level in patients with certain clinical features remains to be evaluated.

In conclusion, IL-18 gene promoter polymorphisms may not contribute to the susceptibility of schizophrenia in the Han Chinese population. However, two SNPs, -137G/C and -607C/A, may play a role in the development of perception disorder and aggressive action, respectively.

Footnotes

Acknowledgments

The authors thank Dr. Haiyan Chen (Rush University Medical Center) for critical review and editorial assistance during manuscript preparation. This study was supported by grants from National Natural Science Foundation of China (No. 30900658) and Sichuan University Young Scientist Funds (No. 2008095).

Disclosure Statement

The authors declare that they have no competing interests.

References

Alboni

, Cervia

, Sugama

, Conti

2010. Interleukin 18 in the CNS. J Neuroinflamm, 7:9.

Dinarello

C.A.

1999. IL-18: A TH1-inducing, proinflammatory cytokine and new member of the IL-1 family. J Allergy Clin Immunol, 103:11–24.

Dinarello

C.A.

2006. Interleukin 1 and interleukin 18 as mediators of inflammation and the aging process. Am J Clin Nutr, 83:447S–455S.

Freedman

, Leonard

, Olincy

, Kaufmann

C.A.

, Malaspina

, Cloninger

C.R.

, Svrakic

, Faraone

S.V.

, Tsuang

M.T.

2001. Evidence for the multigenic inheritance of schizophrenia. Am J Med Genet Neuropsychiatr Genet, 105:794–800.

Giedraitis

, He

, Huang

W.X.

, Hillert

2001. Cloning and mutation analysis of the human IL-18 promoter: a possible role of polymorphisms in expression regulation. J. Neuroimmunol, 112:146–152.

Gilmore

J.H.

2010. Understanding what causes schizophrenia: a developmental perspective. Am J Psychiatry, 167:8–10.

Gracie

J.A.

, Koyama

, Murdoch

, Field

, McGarry

, Crilly

, Schobel

, Madhok

, Pons-Kuhnemann

, McInnes

I.B.

, Moller

2005. Disease association of two distinct interleukin-18 promoter polymorphisms in Caucasian rheumatoid arthritis patients. Genes Immun, 6:211–216.

Grohmann

, Fallarino

, Puccetti

2003. Tolerance, DCs and tryptophan: much ado about IDO. Trends Immunol, 24:242–248.

Kalina

, Ballas

, Koyama

et al. 2000. Genomic organization and regulation of the human interleukin-18 gene. Scand J Immunol, 52:525–530.

10.

Khripko

O.P.

, Sennikova

N.S.

, Lopatnikova

J.A.

et al. 2008. Association of single nucleotide polymorphisms in the IL-18 gene with production of IL-18 protein by mononuclear cells from healthy donors. Mediat Inflamm, 2008:309721.

11.

Kretowski

, Mironczuk

, Karpinska

et al. 2002. Interleukin-18 promoter polymorphisms in type 1 diabetes. Diabetes, 51:3347–3349.

12.

Liu

, Lin

, Huang

, Xu

, Pang

2007. Genetic Polymorphisms of the Interleukin-18 gene and risk of prostate cancer. DNA Cell Biol, 26:613–618.

13.

McGuffin

, Gottesman

I.I.

1999. Risk factors for schizophrenia. N Engl J Med, 341:370–371; author reply 372.

14.

Müller

, Riedel

, Ackenheil

, Schwarz

M.J.

2000. Cellular and humoral immune system in schizophrenia: a conceptual re-evaluation. World J Biol Psychiatry, 1:173–179.

15.

Müller

, Schwarz

M.J.

2010. Immune system and schizophrenia. Curr Immunol Rev, 6:213–220.

16.

Murray

R.M.

, O'Callaghan

, Castle

D.J.

et al. 1992. A neurodevelopmental approach to the classification of schizophrenia. Schizophr Bull, 18:319.

17.

Norambuena

P.A.

, Copeland

J.A.

, Krenkova

, Stambergova

, Macek

Jr.

2009. Diagnostic method validation: high resolution melting (HRM) of small amplicons genotyping for the most common variants in the MTHFR gene. Clin Biochem, 42:1308–1316.

18.

Purcell

S.M.

, Wray

N.R.

, Stone

J.L.

, Visscher

P.M.

, O'Donovan

M.C.

et al. 2009. Common polygenic variation contributes to risk of schizophrenia and bipolar disorder. Nature, 460:748–752.

19.

Rueda

, Gonzalez-Gay

M.A.

, Mataran

, Lopez-Nevot

M.A.

, Martin

2005. Interleukin-18-promoter polymorphisms are not relevant in rheumatoid arthritis. Tissue Antigens, 65:544–548.

20.

Schmitz

, Chew

L.J.

2008. Cytokines and myelination in the central nervous system. ScientificWorldJournal, 8:1119–1147.

21.

Smith

R.S.

1992. A comprehensive macrophage-T-lymphocyte theory of schizophrenia. Med Hypotheses, 39:248–257.

22.

Smith

R.S.

, Maes

1995. The macrophage-T-lymphocyte theory of schizophrenia:additional evidence. Med Hypotheses, 45:135–141.

23.

Sperner-Unterweger

, Miller

, Holzner

, Widner

, Fleischhacker

W.W.

, Fuchs

1999. Measurement of neopterin, kynurenine and tryptophan in sera of schizophrenic patients. Psychiatry, Psychoimmunology, and Viruses. Muller

Springer: New York, 115–119.

24.

Stefansson

, Ophoff

R.A.

, Steinberg

, Andreassen

O.A.

, Cichon

et al. 2009. Common variants conferring risk of schizophrenia. Nature, 460:744–747.

25.

Suarez

B.K.

, Duan

, Sanders

A.R.

et al. 2006. Genomewide linkage scan of 409 European-ancestry and African American families with schizophrenia: suggestive evidence of linkage at 8p23.3-p21.2 and 11p13.1-q14.1 in the combined sample. Am J Hum Gene, 78:315–333.

26.

Sun

, Jia

, Fanous

A.H.

, van den Oord

, Chen

, Riley

B.P.

, Amdur

R.L.

, Kendler

K.S.

, Zhao

2010. Schizophrenia gene networks and pathways and their applications for novel candidate gene selection. PLoS One, 5:e11351.

27.

Szeszko

J.S.

, Howson

J.M.

, Cooper

J.D.

, Walker

N.M.

, Twells

R.C.

, Stevens

H.E.

, Nutland

S.L.

, Todd

J.A.

2006. Analysis of polymorphisms of the interleukin-18 gene in type 1 diabetes and Hardy-Weinberg equilibrium testing. Diabetes, 55:559–562.

28.

Takeuchi

, Okura

, Mori

, Akita

, Ohta

, Ikeda

, Ikegami

, Kurimoto

1999. Intracellular production of interleukin-18 in human epithelial-like cell lines is enhanced by hyperosmotic stress in vitro. Cell Tissue Res, 297:467–473.

29.

Tamura

, Fukuda

, Sashio

et al. 2002. IL18 polymorphism is associated with an increased risk of Crohn's disease. J Gastroenterol, 37:111–116.

30.

Tanaka

K.F.

, Shintani

, Fujii

, Yagi

, Asai

2000. Serum interleukin-18 levels are elevated in schizophrenia. Psychiatry Res, 96:75–80.

31.

J.T.

, Tan

, Song

J.H.

, Sun

Y.P.

, Chen

, Miao

, Tian

2009. Interleukin-18 promoter polymorphisms and risk of late onset Alzheimer's disease. Brain Res, 1253:169–175.