Transcript Variants,Expression,and Polymorphisms of the Pig Prosaposin Gene

Abstract

Prosaposin (PASP) is a sphingolipid hydrolysis protein that plays roles in both the nervous and reproduction systems. In this study, we cloned the pig PASP gene and studied its genomic organization, polymorphism, and expression pattern. Two PASP transcripts, TV1 (HQ245644) and TV2 (HQ245646), were identified in pig. TV1 was the complete transcript that encoded 527 amino acids, whereas TV2 was 9 bp shorter due to an exon 8 deletion. The pig PASP gene spanned over 34 kb in length on chromosome 14 (SSC14), and consisted of 15 exons and 14 introns. The pig PASP gene (TV1 and TV2) expressed predominantly in the cerebellum, lymphnode, pituitary, abdominal fat, hypothalamus, and cerebrum in both females and males. PASP TV1 expressed mainly in teh cerebrum, cerebellum, hypothalamus, pituitary, heart, subcutaneous fat, and foreleg muscle, while TV2 was expressed in the liver, spleen, lung, kidney, and lymphnode. In foreleg muscle, the predominant transcript was TV2 in males and TV1 in females. Some potential transcriptional elements were predicted in 5′ flanking region (∼3000 bp) of the PASP gene, and they were TATA boxes, RORE, Sp1, SRY, oct-1, Cdx A, and cap. Additionally, we identified 68 single-nucleotide polymorphisms and 9 indels in the pig PASP gene, and three single-nucleotide polymorphisms (C77932320T or L15F; C77928094T or P191L; A77917401G or K522R) were nonsynonymous substitutions. These results provide useful information for future functional investigations of the pig PASP gene.

Introduction

P rosaposin (PASP) is a precursor protein that comprises four small lysosomal glycoproteins of saposins A, B, C, and D (O'Brien et al., 1988), which are required for hydrolysis of sphingolipids, including cerebrosidases, ceramidases, sphingomyelinase, galactosidase, and arylsulfatase A (O'Brien and Kishimoto, 1991; Kishimoto et al., 1992). PASP is also important in the nervous system (O'Brien et al., 1994; Sano et al., 1994). Its mRNA changed significantly after central and peripheral nerve injury (Gillen et al., 1995; Calcutt et al., 1999; Yokota et al., 2001; Van Den Berghe et al., 2004). Recently, PASP was also shown to play an important role in the reproductive system. The high expression level of the PASP gene was found in both the reproductive system and nervous system in adult and embryonic stage tissues (Sprecher-Levy et al., 1993).

The male reproductive organ in PASP null (−/−) mice had reduced size and weight of the testes, epididymides, seminal vesicles, and prostates, and reduced spermiogenesis, and an involution of the prostate, seminal vesicles, and epididymis (Morales et al., 2000a). In the prostate of PASP inactivated animals, the secreted cells disappeared and only the basal epithelial cells were present; moreover, the prostatic epithelium proliferation and differentiation was reduced (Morales et al., 2000b). These findings suggested that PASP is an important gene for reproduction traits.

Located on chromosome 10q21–22, the human PASP gene consists of 15 exons and 14 introns, and encodes saposin A (exon 3–5), saposin B (exon 6–8), saposin C (exon 10–11), and saposin D (exon 12–14) (Zhao and Morales, 2000). Different PASP isoforms were identified in human (Nakano et al., 1989; Holtschmidt et al., 1991a, 1991b; Lamontagne and Potier, 1994), mice (Zhao et al., 1998; Cohen et al., 2005), rats (Hiraiwa et al., 2003), chickens, as well as zebrafish (Cohen et al., 2004). Two major isoforms of PASP differed by 9 bp (CAGGATCAG) in exon 8, which encoded three amino acid residues (Gln-Asp-Gln) of the saposin B domain (Lamontagne and Potier, 1994). Differences in expression levels were also found. Therefore, alternative splicing is an important factor to consider when studying the neurotrophic effects of PASP (Hiraiwa et al., 2003; Cohen et al., 2004). It was further reported that the longer transcript with the 9 bp insertion was preferentially secreted from cells, whereas the shorter one was mainly trafficked to the lysosome (Madar-Shapiro et al., 1999). Little is known about the pig PASP gene. In the present study, we obtained cDNA and transcript variants, and investigated the expression and polymorphisms of the pig PASP gene.

Materials and Methods

Animals

Two small-ear spotted pigs (one female and one male) at 120 days of age were slaughtered to collect 22 tissues: cerebrum, cerebellum, hypothalamus, pituitary, heart, foreleg muscle, back leg muscle, back muscle, spleen, lymphnode, testicle, ovary, oviduct, uterus, lung, kidney, liver, stomach, large intestine, small intestine, subcutaneous fat, and abdominal fat. Ovary tissue was used for cloning the pig PASP gene, whereas all tissues were used for real-time quantitative polymerase chain reaction (qPCR). A total of 25 genomic samples at 120 days of age were used for identification of polymorphisms across the complete coding region of the pig PASP gene. These samples included small-ear spotted pigs (5 individuals), Landrace (5), Yorkshire (5), Lantang pigs (5), and Duroc (5). Small-ear spotted pigs and Lantang pigs are both Chinese pig breeds, whereas Landrace, Yorkshire, and Duroc are all imported commercial pig breeds. These samples were provided by either the Institute of Animal Science, Guangdong Academy of Agricultural Sciences (Guangzhou, China), or Prof. Yonggang Liu (Yunnan Agricultural University, China).The animal care and use protocol was approved by the Laboratorial Animal Care and Use Committee in Jinan University, China, in accordance with Law of the People's Republic of China on Animal Protection.

Primers

P1 was designed according to the predicted PASP cDNA sequences (GenBank accession number: XM_001928494) to clone the pig PASP gene, and P2 was used for real-time qPCR analysis of PASP gene. Primer P3 was used for qPCR analysis of pig β-actin gene (DQ452569) as the internal control. P4 was designed to specifically show the length polymorphism (9 bp indel) of two PASP transcript variants (TV1 and TV2) by reverse transcription (RT)-PCR. Based on obtained sequences and the pig genome database, P5–P13 were designed and used to identify polymorphisms across the coding regions of the pig PASP gene. All primers were designed using GeneTool Lite software (www.BioTools.com/) and then synthesized by Sangong Co. Ltd (Shanghai, China). Detailed information for all primers is in Table 1.

Table 1.

Thirteen Pairs of Primers Used in this Study

Gene	Primer	Sequence (5′–3′)	Annealing temperature (°C)	Product size	Purpose
PSAP	P1	F: GCGGAGTCAGGCGGCGTCAT R: CCCCCAGACACACAAGCAGGA	58	1661	RT-PCR
	P2	F: AACGTGAAGACAGCATCCGACTR: GTGGCAGACATGTTCGGCTTG	60	212	Real-Time PCR
β-actin	P3	F: CCGTGAGAAGATGACCCAGATR: GCCAGCCAGGTCCAGACGC	60	202
	P4	F: GGCCGACATGTGCAAGAACTATR: TCCAACCAGCCCACAGATGTC	60	97 or 106	RT-PCR
	P5	F: TCCGCCCTCCGTCTTCCTR: TGCCACCCTGCCCATCTAC	61	510	E1
	P6	F: CCTCCCAGCCCTGTGACATTR: GGCTAGGGGTGAAGGCAGAG	61	594	E2
	P7	F: CCCGCCTGATCCTTCTCR: GCCCGAGTCATTTTGGAG	61	1121	E3, In3, E4
	P8	F: GGCGGTTGAGTCGGAGATGR: AGCCCTGACGTTGGAATGTG	61	927	E5, In5, E6
PASP	P9	F: AGCCACAGCAATGCAAGATCR: CAGGCCGAAAGCTACACAG	61	614	E7
	P10	F: AGCGGTTCTGTCTCATCTCCR: GGGGGTGCTGCATAGTTTAG	55	518	E9
	P11	F: TGGCCTTTGTGTCACGCTAGCR: CCGCTTCGCTGCCTGTGA	62	1430	E10, In10, E11, In11, E12, In12, E13
	P12	F: CGGATCTAATTCTTGCCTTTR: CAGGGCTGTTCAAGGAGAG	55	533	E14
	P13	F: TGCGCTCTTGCCTTATGAATCR: CCACCATGCAGGGACAGAC	61	577	E15

F and R indicate forward and reverse primer. E and In refer to exon and intron.

RT, reverse transcription; PCR, polymerase chain reaction.

RNA extraction and DNA preparation

Total RNA was extracted from fresh or frozen tissues using Trizol reagent (Invitrogen, Carlsbad, CA). A mixture of 2 μg total RNA, 1 μg oligo dT primer, and 20 nmol deoxynucleotide triphosphates was used for cDNA synthesis using M-MLV Reverse Transcriptase (Promega, Madison, WI). Genomic DNA was extracted from pig ear samples with the phenol-chloroform method (Sambrook et al., 1989).

Cloning of the PASP gene cDNA by RT-PCR

RT-PCR was performed to amplify the cDNA of the PASP gene using primer P1 or P4. The 25 μL reaction mixtures contained 1 μL cDNA, 1.25 U ExTaq polymerase (Takara, Osaka, Japan), 12.5 pmol primers, and 200 μM dNTP (each). PCR was run in a Mastercycler gradient (Eppendorf Limited, Hamburg, Germany) with three steps: 94°C predenaturing for 3 min, followed by 35 cycles of 94°C denaturing for 30 s, 58°C or 60°C annealing for 45 s, and 72°C extension for 1 min, as well as a final extension of 5 min at 72°C. PCR products were checked by 1.0% agarose gel electrophoresis and purified with a QIAquick gel-extraction kit (Qiagen, Valencia, CA). The purified PCR products were then cloned into pGEM-T Easy Vector plasmid (Takara) and sequenced by a commercial service (Biosune Co. Ltd, Shanghai, China). The obtained sequences were assembled to obtain the full-length cDNA of the pig PASP gene.

Genomic structure and variation analysis of the pig PASP gene

The obtained cDNA by this study was used for BLAST search (http://mgc.ucsc.edu/cgi-bin/hgBlat) to reveal the genomic organization of the pig PASP gene. According to the predicted genome organization, PCR was performed with nine primer pairs (P5–P13). PCR products amplified from 25 DNA samples were directly sequenced by Sangong Co. Ltd. Forward and reverse reactions were performed in sequencing to avoid false-positives, and those sequences with discrepancy were discarded from further analysis. All sequences were then BLAST searched to identify polymorphisms or variations across the coding region of PASP.

Quantitative real-time PCR analysis of PASP mRNA expression in pig tissues

The pig β-actin gene was used as an internal control to quantify PASP mRNA by qPCR. The 20 μL mixture contained 1 μL cDNA template, 10 μM primers, and 2× Q-PCR SYBR Green Mix (Toyobo, Japan). Real-time PCR was performed at 95°C for 3 min, followed by 40 cycles of 30 s at 95°C, 30 s at 63°C, and 40 s at 72°C in an ABI7500 thermocycler (Applied Biosystems, Foster City, CA). To analyze PCR specificity, melting curve analysis was performed. In addition, the qPCR products were verified by sequencing (Biosune Co. Ltd).

In this study, each data point was repeated three times. Quantitative values were obtained from the threshold PCR cycle number (Ct) at which the increase in signal associated with an exponential growth for PCR product starts to be detected. The relative mRNA levels in each sample were normalized by β-actin. The relative expression levels of the pig PASP gene was indicated by 2^−ΔCT, for which ΔCT = Ct_target _gene - Ct_ß-actin.

Semiquantitative RT-PCR assay of TV1 and TV2 mRNA expression in adult pig tissues

P4 was used to amplify parts of TV1 and TV2 by RT-PCR, giving rise to fragments of 106 bp (TV1) and 97 bp (TV2) each. The mixture and PCR reaction program was described above. Then, the amplified fragments were separated by nondenatured polyacrylamide gel (8%, w/v) in 90 mM Tris buffer pH 8.0, 90 mM borate, and 2 mM EDTA. DNA was stained with silver nitrate. The relative expression of these two transcripts was investigated in different tissues: cerebrum, cerebellum, hypothalamus, pituitary, heart, liver, spleen, lung, kidney, abdominal fat, subcutaneous fat, foreleg muscle, back leg muscle, back muscle, small intestine, large intestine, stomach, lymphnode, testicle, ovary, oviduct, and uterus.

Bioinformatic analysis and prediction of transcription factors

The protein and CD data sets of PASP in various species were downloaded from NCBI database, and they were human (protein ID of NP_035309, CDs ID of NM_011179), mouse (NP_001035930; NM_001042465), rat (NP_001177165; NM_001190236), horse (XP_001503814; XM_00153764), dog (XP_861590; XM_856497), chicken (AAF05899; AF108656), frog (NP_571968; NM_131883), and zebrafish (NP_571968; NM_131883). Identity percentages (%) were calculated with DNASTAR software (www.dnastar.com/), and PASP alignment was preformed with the T-coffee program (www.tcoffee.org/). The 3000 bp 5′ flanking region of the PASP gene obtained from pig genome database was used to predict the potential binding sites for transcription factors by an online service (http://motif.genome.jp). All parameters were set following the website standards.

Results

The full-length cDNA of the pig PASP gene

Two transcripts of the pig PASP gene, the longer transcript (PASP TV1) and the shorter one (PASP TV2), were obtained in this study. They are available in the NCBI database with accession numbers of HQ245644 and HQ245645, respectively. The obtained PASP TV1 was 1660 bp in length containing an open reading frame of 1584 bp and encoded a protein of 527 amino acids (AA) (Fig. 1). The PASP TV2 was 9 bp shorter than TV1 due to a 9 bp deletion, and therefore it encoded a shorter protein (deletion of 3 AA) (Fig. 1). The pig PASP encoded by TV1 showed high homology to human (85.0%), mouse (62.9%), rat (62.5%), and chicken (58.0%) (Fig. 2).

FIG. 1.

cDNA and deduced amino acid sequences of the pig PASP gene. Capital and italic letters show amino acids for each codon upside, whereas “*” refers to a stop codon. The boxed 9 nucleotides (CAGGATCAG, which encodes 3 amino acids, QDQ) indicate the region in exon 8 of the pig PASP gene which is present in TV1 but absent in TV2. PASP, prosaposin.

FIG. 2.

Alignment of the pig PASP with those of human, mouse, rat, and chicken. The four saposin domains are indicated by A–D.

Genomic organization of the pig PASP gene

BLAT search revealed that the pig PASP gene spanned over 34 kb at chromosome 14 (reverse strand) and consisted of 15 exons (9 to 201 bp) and 14 introns (101 to 19 368 bp) (Table 2). Exon 8 was the smallest exon, and the largest intron (19 368 bp) was intron 1. All introns identified in this study followed the GT-AG rule (Table 2). Further analysis of pig PASP showed that Saposin A, B, C, and D was encoded by exons 3–5, 6–9, 10–11, and 12–14, respectively (Fig. 3). Each saposin molecule did not start or end exactly at the beginning or end of a certain exon, due to the partial proteolytic processing of these proteins. The translation start codon (ATG) was located in exon 1 and the translation stop codon was in exon 15. Comparison of TV1 and TV2 showed that the presence or absent of exon 8 (CAGGATCAG) led to the formation of two PASP transcripts (Fig. 3).

FIG. 3.

The genomic organization of the PASP gene among human, mouse, and pig. The four saposin domains are indicated by A–D. Exons are indicated by boxes with nucleotide size indicated inside except for exon 8, which varies between the TV1 and TV2 isoforms. “-//-” indicates a genomic gap existed there according to BLAT search (http://genome.ucsc.edu/cgi-bin/hgBlat).

Table 2.

The Boundary Nucleotides Between Exons and Introns of the Pig Prosaposin Gene

Exon	3′ splice site	Exon size (bp)	Intron size (bp)
1	----------------------------------- CTGGGCGCGGgtaagccctg	>58	19,368
2	ttccttgcagCTCTCGCCAG----------GCCAACCGTGgtgagtgccc	134	2174
3	ttcctcttagAAATCCCTTC-----------TGCCACTGAGgtgagttgcc	75	562
4	cctctccagCAGGAGATCC----------AGGACAGATGgtatgtggtg	126	961
5	cctccccagAGCAAGCCCG---------CCGGCCAAAGgtaaggccgt	201	307
6	ctctctccagGCTGATGGGG---------GGCCGACATGgtgagtctcc	144	818
7	ctgtcctcagTGCAAGAAC-----------TGATGCACATGgtaggtggcc	57	2522
8	gttccaacag CAGGATCAG gtatgtgatg	9	2136
9	ctctctccagCAACCCAAGG---------GCCCATAAAGgtatgtggtgc	132	1485
10	ctacccacagAAGGACCTG----------AGGACCGAGgtaccgggctt	96	303
11	tcacgtttcagGAGGAAATC---------GTGTTGACTGgtgagcccgg	187	101
12	tctcacgcagCGCGTGTGA----------CCAGAAGCAGgtatgcgttgg	159	348
13	tccctgacagTGCGATCAG----------CGTGTGCTCGgtaagctgcgc	81	682
14	accacctagAAAATTGGA-----------CCTGTGCAACgtgagtagctc	108	998
15	ctcctgtcagGCTGTCGAG----------------------------------------	>94

The capital and bold letters indicate the boundary nucleotides of exons, and lowercase letters indicate the boundary nucleotides of introns.

PASP mRNA expression in different tissues

qPCR showed that the total PASP transcripts (TV1 plus TV2) were found in most tissues in both females and males (Fig. 4). In females, it expressed predominantly in subcutaneous fat, and then in cerebellum, hypothalamus, cerebrum, lymphnode, pituitary, liver, abdominal fat and spleen (Fig. 4). In males, it expressed predominantly in lymphnode and cerebellum, and then in back muscle, pituitary, and abdominal fat (Fig. 4).

FIG. 4.

Total PASP mRNA (TV1 plus TV2) in different pig tissues. Cer, cerebrum; Ceb, cerebellum; Hyp, hypothalamus; Pit, pituitary; Hea, Heart; Liv, liver; Spl, spleen; Lun, lung; Kid, kidney; Abf, abdominal fat; Suf, subcutaneous fat; Flm, foreleg muscle; Blm, back leg muscle; Bam, back muscle; Smi, small intestine; Lai, large intestine; Sto, stomach; Lym, lymphnode; Tes, testicle; Ova, ovary; Ovi, oviduct; Ute, uterus. NS indicates nondetectable.

Differential expression of PASP TV1 and TV2 transcripts in pig tissues

Semiquantitative RT-PCR analysis showed that although TV1 and TV2 expressed in most pig tissues in both males and females, differential expression of the two transcripts was noted (Fig. 5). PASP TV1 was abundantly expressed in cerebrum, cerebellum, hypothalamus, pituitary, heart, subcutaneous fat, and foreleg muscle, but higher PASP TV2 expression was detected in liver, spleen, lung, kidney, and lymphnode. In males and females, we also found expression differences, such as in foreleg muscle: the predominant transcript in male was TV2, but it was TV1 in female. It was interesting that only TV2 was found in small intestine of females and foreleg muscle of males (Fig. 5).

FIG. 5.

Detection of the differential expression of PASP TV1 and TV2 transcripts in male (A) and female (B) pig tissues. Polymerase chain reaction products were electrophoresed in 8% polyacrylamide gel. Cer, cerebrum; Ceb, cerebellum; Hyp, hypothalamus; Pit, pituitary; Hea, Heart; Liv, liver; Spl, spleen; Lun, lung; Kid, kidney; Abf, abdominal fat; Suf, subcutaneous fat; Flm, foreleg muscle; Blm, back leg muscle; Bam, back muscle; Smi, small intestine; Lai, large intestine; Sto, stomach; Lym, lymphnode; Tes, testicle; Ova, ovary; Ovi, oviduct; Ute, uterus; M, marker (100 bp lander).

Online prediction on binding sites

Online motif prediction showed that the 3000 bp fragment (−3000 to +1, nt) 5′ of the pig PASP gene contains binding elements for transcription factors (Fig. 6). The TATA box was located at −322 bp from the translation start site. We also found putative binding elements for RORE [retinoic acid-receptor-related orphan receptor a subunit (RORa)-binding element], Sp1 (stimulating protein 1), SRY (sex-determining region Y gene product), and other positive and negative regulatory elements (oct-1, Cdx A, and cap) (Fig. 6).

FIG. 6.

Putative binding sites for transcription factors. RORE, retinoic acid-receptor-related orphan receptor a subunit (RORa)-binding element; Sp1, stimulating protein 1; SRY, sex-determining region Y gene product; Ap-1, activator protein 1; Oct-1, octamer factor 1; Cap, cap signal for transcription initiation; CdxA, CdxA.

Single-nucleotide polymorphisms of the pig PASP gene

A total of 68 single-nucleotide polymorphisms (SNPs) and 9 indels were identified in exons and introns of the pig PASP gene (Table 3). Among 17 SNPs located at the coding region, three led to substitution of amino acids, and they were C77932320T (CTC→TTC, L15F), C77928094T (CCG→CTG, P191L), and A77917401G (AAG→AGG, K522R). One SNP was located at the 3′ UTR region of the pig PASP gene. Moreover, 62 variations were located at recognize sites for restriction enzymes, and therefore could be genotyped by PCR-RFLP.

Table 3.

All 68 Single-Nucleotide Polymorphisms of the Pig PASP Gene Identified in This Study

No.	Site	Region	SNP	No.	Site	Region	SNP	No.	Site	Region	SNP
1	77951763	5′ flanking	C>T	24	77930035	In2	C>A	47	7792758	In6	C>T
2	77951725	E1	C>T	25	77930000	E3	T>C	48	77926983	In6	G>C
3	77951602	In1	G>T	26	77929893	In3	G>T	49	77926923	In6	T>C
4	77951577	In1	T>G	27	77929888	In3	C>T	50	77926633	In7	T>C
5	77951476	In1	T>C	28	77929884	In3	A>G	51	77926584	In7	T>C
6	77932435	In1	T>C	29	77929819	In3	T>C	52	77926552	In7	C>T
7	77932412	In1	T>C	30	77929730	In3	G>A	53	77926523	In7	T>G
8	77932404	In1	G>A	31	77929727	In3	A>G	54	77922144	In8	T>G
9	77932402	In1	G>C	32	77929580	In3	A>G	55	77922136	In8	G>T
10	77932387	In1	C>T	33	77929544	In3	A>G	56	77921876	In9	G>A
11	77932326	In1	G>A	34	77929297	E4	T>C	57	77919725	E12	C>T
12	77932320	E2	C>T	35	77928285	E5	G>T	58	77918470	E14	C>T
13	77932288	E2	C>T	36	77928282	E5	C>T	59	77918339	In14	T>C
14	77932234	E2	G>A	37	77928153	E5	C>T	60	77918338	In14	G>T
15	77932144	In2	G>A	38	77928094	E5	C>T	61	77918303	In14	G>T
16	77932129	In2	C>T	39	77928093	E5	G>A	62	77918286	In14	C>T
17	77932039	In2	G>T	40	77928044	In5	C>G	63	77918260	In14	T>G
18	77932012	In2	G>C	41	77927929	In5	G>T	64	77918233	In14	C>T
19	77930089	In2	C>T	42	77927907	In5	G>A	65	77918214	In14	Del>T
20	77930080	In2	G>A	43	77927852	In5	Del>G	66	77917401	E15	A>G
21	77930076	In2	T>C	44	77927799	In5	C>T	67	77917344	E15	T>C
22	77930072	In2	C>T	45	77927771	E6	C>T	68	77917321	3′ flanking	C>T
23	77930070	In2	A>G	46	77927645	E6	C>T

The site of each SNP refers to the nucleotides in chromosome 14, according to Nov. 2009 (SGSC Sscrofa9.2/susScr2) pig BLAT search (http://genome.ucsc.edu/cgi-bin/hgBlat).

SNP, single-nucleotide polymorphisms.

Discussion

The results of cDNA cloning, expression, and homology analysis by this study proved the genomic and structural conservation of PASP among mammals. The encoded pig PASP precursor (by TV1) shared identities of 85%, 62.9%, and 62.5% with its counterparts of human, mouse, and rat, respectively. The pig PASP protein also comprised four functional domains of saposins A, B, C, and D, which are necessary for sphingolipids hydrolysis (Fig. 2). Like human and mouse, the pig PASP gene also consists of 15 exons and 14 introns, and all introns followed the GT-AG rule (Fig. 3). In addition, two isoforms of pig PASP (TV1 and TV2) were found in this study (Fig. 1). Alternative splicing for TV1 and TV2 occurred in exon 8 (CAGGATCAG), encoding for three amino acids (Gln-Asp-Gln) of the saposin B domain. These two isoforms were also reported in human (Nakano et al., 1989; Holtschmidt et al., 1991a, 1991b; Lamontagne and Potier, 1994), mice (Zhao et al., 1998; Cohen et al., 2005), rats (Hiraiwa et al., 2003), chickens, and zebrafish (Cohen et al., 2004) (Fig. 3).

The high expression of pig PASP in reproductive and nervous tissues suggested that it functions in these systems. The pig PASP gene was found to abundantly express in nerve center (cerebellum, cerebrum, hypothalamus, and pituitary), fat tissues (subcutaneous fat and abdominal fat), immune system tissues (spleen and lymphnode), and organs of reproduction (ovary and oviduct). In mouse, the PASP gene also highly expressed in the nervous and reproductive systems in both adult and embryonic stage animals (Sprecher-Levy et al., 1993). This feature was probably related to the reported important roles of PASP in reproductive system (Sprecher-Levy et al., 1993), nervous system (O'Brien et al., 1994), and during sphingolipid catabolism (O'Brien and Kishimoto, 1991; Kishimoto et al., 1992). However, in the cerebellum, cerebrum, hypothalamus, spleen, lymphnode, subcutaneous fat, and back muscle, PASP mRNA levels were different between male and female pigs; whether this sex bias was related to a different internal environment between male and female remained unclear.

TV1 and TV2 expressed differently in various tissues. PASP TV1 abundantly expressed in cerebrum, cerebellum, hypothalamus, pituitary, heart, subcutaneous fat, and foreleg muscle, but a hig level of PASP TV2 mRNA was detected in the liver, spleen, lung, kidney, and lymphnode. In adult rats, it was reported that a PASP transcript equivalent to TV1 preferentially expressed in brain, heart, and muscle, whereas a 9 bp shorter PASP transcript (equivalent to TV2) was preferentially expressed in lung, liver, and kidney tissues (Hiraiwa et al., 2003). In mouse and chicken brain, expression of PASP with 9 bp increased during development (Cohen et al., 2004). In normal brain, the ratio of two transcripts (TV1/TV2) was 85:15; however, it decreased to 5:95 after ischemic injury (Hiraiwa et al., 2003). These findings indicated that the two PASP isoforms play important roles in neuron regeneration (Chen et al., 2008). Moreover, PASP isoforms were reported to change binding specificity of saposin B presumably to adapt to the variable sphingolipid composition of tissues (Lamontagne and Potier, 1994). Another study, however, reported that mice with an exon 8 deletion were healthy and fertile, and no changes were detected in PASP secretion or in accumulation and metabolism of gangliosides, sulfatides, or neutral glycosphingolipids (Cohen et al., 2004).

Online prediction of potential motifs was useful for investigation of regulatory elements of the pig PASP gene. In 5′ flanking region (3000 bp) of the pig PASP gene, we predicted binding sites for RORE, Sp1, SRY, and other positive and negative regulatory elements (oct-1, Cdx A, and cap) (Fig. 6). We also found a TATA box at −322 bp. Studies in vitro indicated that the mouse PASP promoter lost its TATA box but had positive and negative regulatory elements at −2400 bp (Sun et al., 1997). An important region at −310 bp might modulate the expression of PASP in mice (Jin et al., 1998). In transgenic mice created by deletion of the 5′-flanking region of PASP, it was reported that the modifiers (ROR alpha- and Sp1-binding sites) residing within 310 bp of the 5′-flanking region mediated the spatio-temporal and differential expression of PASP in the central nervous system and eye (Sun et al., 2000, 2003). As in other species, the identified SNPs of the PASP gene have potential effects on pig production traits. In humans, the deletion of valine (11Val) in saposin A protein caused the abnormal galactosylceramide metabolism in infants (Spiegel et al., 2005), and the N215K substitution in saposin B led to the loss of the single N-glycosylation site in a patient with metachromatic leukodystrophy (Regis et al., 1999). A single bp deletion (c.803delG) in the saposin B domain led to a complete deficiency of PASP and saposins, and was associated with a complex sphingolipidosis dominated by lactosylceramide accumulation (Hulková et al., 2001). Saposin D (−/−) mice generated by C509S mutation developed progressive polyuria at around 2 months and ataxia at around 4 months (Matsuda et al., 2004). Other variations of this gene were related to Gaucher disease (Horowitz and Zimran, 1994). All these SNPs identified by this study provided candidate markers for further functional investigation of the pig PASP gene.

Conclusion

We identified two transcripts (TV1 and TV2) of the pig PASP gene and found that they expressed differently among various tissues and between males and females. The genomic organization of the pig PASP gene was described, and a total of 68 SNPs found by this study.

Footnotes

Acknowledgments

This study was supported by the National Major Special Projects on New Varieties Cultivation for Transgenic Organisms (2008ZX08006–005 and 2009ZX08009–145B) and the Important Projects in Key Fields in Guangdong and Hongkong, 2008 (2008A02).

Disclosure Statement

No competing financial interests exist.

References

Calcutt

N.A.

, Campana

W.M.

, Eskeland

N.L.

, Mohiuddin

, Dines

K.C.

, Mizisin

A.P.

, O'Brien

J.S.

1999. Prosaposin gene expression and the efficacy of a prosaposin-derived peptide in preventing structural and functional disorders of peripheral nerve in diabetic rats. J Neuropathol Exp Neurol, 58:628–636.

Chen

, Saito

, Kobayashi

, Sato

, Terashita

, Shimokawa

, Mominoki

, Miyawaki

, Sano

, Matsuda

2008. Expression patterns in alternative splicing forms of prosaposin mRNA in the rat facial nerve nucleus after facial nerve transection. Neurosci Res, 60:82–94.

Cohen

, Auerbach

, Ravid

, Bodennec

, Fein

, Futerman

A.H.

, Joyner

A.L.

, Horowitz

2005. The exon 8-containing prosaposin gene splice variant is dispensable for mouse development, lysosomal function, and secretion. Mol Cell Biol, 25:2431–2440.

Cohen

, Ravid

, Altman

, Madar-Shapiro

, Fein

, Weil

, Horowitz

2004. Conservation of expression and alternative splicing in the prosaposin gene. Brain Res Mol Brain Res, 129:8–19.

Gillen

, Gleichmann

, Spreyer

, Müller

H.W.

1995. Differentially expressed genes after peripheral nerve injury. J Neurosci Res, 42:159–171.

Hiraiwa

, Liu

, Lu

A.G.

, Wang

C.Y.

, Misasi

, Yamauchi

, Hozumi

, Inuzuka

, O'Brien

J.S.

2003. Regulation of gene expression in response to brain injury: enhanced expression and alternative splicing of rat prosaposin (SGP-1) mRNA in injured brain. J Neurotrauma, 8:755–765.

Holtschmidt

, Sandhoff

, Fürst

, Kwon

H.Y.

, Schnabel

, Suzuki

1991a. The organization of the gene for the human cerebroside sulfate activator protein. FEBS Lett, 280:267–270.

Holtschmidt

, Sandhoff

, Kwon

H.Y.

, Harzer

, Nakano

, Suzuki

1991b. Sulfatide activator protein. Alternative splicing that generates three mRNAs and a newly found mutation responsible for a clinical disease. J Biol Chem, 266:7556–7560.

Horowitz

, Zimran

1994. Mutations causing Gaucher disease. Hum Mutat, 3:1–11.

10.

Hulková

, Cervenková

, Ledvinová

, Tochácková

, Hrebícek

, Poupetová

, Befekadu

, Berná

, Paton

B.C.

, Harzer

, Böör

, Smíd

, Elleder

2001. A novel mutation in the coding region of the prosaposin gene leads to a complete deficiency of prosaposin and saposins, and is associated with a complex sphingolipidosis dominated by lactosylceramide accumulation. Hum Mol Genet, 10:927–940.

11.

Jin

, Sun

, Grabowski

G.A.

1998. Role of Sp proteins and RORalpha in transcription regulation of murine prosaposin. J Biol Chem, 273:13208–13216.

12.

Kishimoto

, Hiraiwa

, O'Brien

J.S.

1992. Saposins: structure, function, distribution, and molecular genetics. J Lipid Res, 33:1255–1267.

13.

Lamontagne

, Potier

1994. Modulation of human saposin B sphingolipid-binding specificity by alternative splicing. A study with saposin B-derived synthetic peptides. J Biol Chem, 269:20528–20232.

14.

Madar-Shapiro

, Pasmanik-Chor

, Vaccaro

A.M.

, Dinur

, Dagan

, Gatt

, Horowitz

1999. Importance of splicing for prosaposin sorting. Biochem J, 337:433–443.

15.

Matsuda

, Kido

, Tadano-Aritomi

, Ishizuka

, Tominaga

, Toida

, Takeda

, Suzuki

, Kuroda

2004. Mutation in saposin D domain of sphingolipid activator protein gene causes urinary system defects and cerebellar Purkinje cell degeneration with accumulation of hydroxy fatty acid-containing ceramide in mouse. Hum Mol Genet, 13:2709–2723.

16.

Morales

C.R.

, Zhao

, El-Alfy

, Suzuki

2000b. Targeted disruption of the mouse prosaposin gene affects the development of the prostate gland and other male reproductive organs. J Androl, 21:765–775.

17.

Morales

C.R.

, Zhao

, Lefrancois

, Ham

2000a. Role of prosaposin in the male reproductive system: effect of prosaposin inactivation on the testis, epididymis, prostate, and seminal vesicles. Arch Androl, 44:173–186.

18.

Nakano

, Sandhoff

, Stümper

, Christomanou

, Suzuki

1989. Structure of full-length cDNA coding for sulfatide activator, a Co-beta-glucosidase and two other homologous proteins: two alternate forms of the sulfatide activator. J Biochem, 105:152–154.

19.

O'Brien

J.S.

, Carson

G.S.

, Seo

H.C.

, Hiraiwa

, Kishimoto

1994. Identification of prosaposin as a neurotrophic factor. Proc Natl Acad Sci USA, 91:9593–9596.

20.

O'Brien

J.S.

, Kishimoto

1991. Saposin proteins: structure, function, and role in human lysosomal storage disorders. FASEB J, 5:301–308.

21.

O'Brien

J.S.

, Kretz

K.A.

, Dewji

, Wenger

D.A.

, Esch

, Fluharty

A.L.

1988. Coding of two sphingolipid activator proteins (SAP-1 and SAP-2) by same genetic locus. Science, 241:1098–1101.

22.

Regis

, Filocamo

, Corsolini

, Caroli

, Keulemans

J.L.

, van Diggelen

O.P.

, Gatti

1999. An Asn>Lys substitution in saposin B involving a conserved amino acidic residue and leading to the loss of the single N-glycosylation site in a patient with metachromatic leukodystrophy and normal arylsulphatase A activity. Eur J Hum Genet, 7:125–130.

23.

Sambrook

, Fritsch

E.F.

, Maniatis

1989. Molecular Cloning: A Laboratory Manual, 2nd. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY.

24.

Sano

, Matsuda

, Wen

T.C.

, Kotani

, Kondoh

, Ueno

, Kakimoto

, Yoshimura

, Sakanaka

1994. Protection by prosaposin against ischemia-induced learning disability and neuronal loss. Biochem Biophys Res Commun, 204:994–1000.

25.

Spiegel

, Bach

, Sury

, Mengistu

, Meidan

, Shalev

, Shneor

, Mandel

, Zeigler

2005. A mutation in the saposin A coding region of the prosaposin gene in an infant presenting as Krabbe disease: first report of saposin A deficiency in humans. Mol Genet Metab, 84:160–166.

26.

Sprecher-Levy

, Orr-Urtreger

, Lonai

, Horowitz

1993. Murine prosaposin: expression in the reproductive system of a gene implicated in human genetic diseases. Cell Mol Biol (Noisy-le-grand), 39:287–299.

27.

Sun

, Jin

, Grabowski

G.A.

1997. The mouse prosaposin locus: promoter organization. DNA Cell Biol, 16:23–34.

28.

Sun

, Jin

, Witte

D.P.

, Grabowski

G.A.

2000. Prosaposin: promoter analysis and central-nervous-system-preferential elements for expression in vivo. Biochem J, 352:549–556.

29.

Sun

, Witte

D.P.

, Jin

, Grabowski

G.A.

2003. Analyses of temporal regulatory elements of the prosaposin gene in transgenic mice. Biochem J, 370:557–566.

30.

Van Den Berghe

, Sainton

, Gogat

, Marchant

, Dufour

, Bonnel

, Gadin

, Menasche

, Abitbol

2004. Prosaposin gene expression in normal and dystrophic RCS rat retina. Invest Ophthalmol Vis Sci, 45:1297–1305.

31.

Yokota

, Uchijima

, Nishizawa

, Namba

, Koide

2001. Identification of differentially expressed genes in rat hippocampus after transient global cerebral ischemia using subtractive cDNA cloning based on polymerase chain reaction. Stroke, 32:168–174.

32.

Zhao

, Bell

A.W.

, El-Alfy

, Morales

C.R.

1998. Mouse testicular sulfated glycoprotein-1: sequence analysis of the common backbone structure of prosaposins. J Androl, 19:165–174.

33.

Zhao

, Morales

C.R.

2000. Identification of a novel sequence involved in lysosomal sorting of the sphingolipid activator protein prosaposin. J Biol Chem, 275:24829–2439.