Lysyl Oxidase G473A Polymorphism Is Associated with Increased Risk of Coronary Artery Diseases

Abstract

Lysyl oxidase (LOX) plays a crucial role in the maintenance of extracellular matrix stability and could participate in vascular remodeling associated with cardiovascular diseases. A novel polymorphism in the LOX gene, G473A (rs1800449), was identified. The objective of this study was to investigate the association between LOX G473A polymorphism and susceptibility to coronary artery diseases (CADs) in Chinese population. The LOX variant G473A was detected by polymerase chain reaction–restriction fragment length polymorphism in 656 CAD cases and 718 age-matched controls. Frequencies of LOX 473 AA genotype and A allele were significantly higher in patients with CAD than in controls (odds ratio = 1.93, 95% confidence interval 1.26–2.95, p = 0.002; and odds ratio = 1.38, 95% confidence interval 1.15–1.67, p = 0.001). Our data suggest that the G473A polymorphism of LOX gene is associated with increased susceptibility to CAD.

Introduction

L ysyl oxidase (LOX) is a copper-dependent amine oxidase that initiates the covalent cross-linking of collagen and elastin (Lucero and Kagan, 2006). LOX catalyses an oxidative de-amination of lysine and hydroxylysine residues to alpha-aminoadipic-delta-semialdehydes (Lucero and Kagan, 2006). These highly reactive semialdehydes can spontaneously condense to form intra- and intermolecular covalent cross-linkages that assure extracellular matrix (ECM) stability (Kagan and Li, 2003; Lucero and Kagan, 2006). LOX activity is essential to maintain the tensile and elastic features of connective tissues of skeletal, pulmonary, and cardiovascular systems, among others (Kagan and Li, 2003; Lucero and Kagan, 2006).

In the vascular wall, LOX is expressed in fibroblasts, endothelial cells, and vascular smooth muscle cells (VSMCs) (Maki et al., 2002). The prominent role of this enzyme in the development and function of the cardiovascular system has been established through gene knockout strategies (Hornstra et al., 2002; Maki et al., 2002). LOX deficiency leads to the death of most animals at the end of the gestational period or within the first hours of life (Hornstra et al., 2002; Maki et al., 2002). High incidence of aortic aneurysms, aortic tortuosity, and signs of aortic rupture were observed in LOX^−/− mice (Hornstra et al., 2002; Maki et al., 2002). Microscopic analysis revealed an extended fragmentation of elastic fibers, disruption of VSMC contact, discontinuities of both internal elastic lamina and lamellae, detachment of endothelial cells from the basal lamina, and alterations on endothelial cell morphology (Hornstra et al., 2002; Maki et al., 2002). In normal adult animals, experimental evidence suggests that LOX deregulation could be involved in different stages of the atherosclerotic process from endothelial dysfunction to plaque progression and rupture, which are important factors of coronary artery diseases (CADs). Likewise, other cardiovascular diseases characterized by an intense destructuration of ECM, such as aneurysms and coronary dissections, have been related to the disturbance of LOX expression (Nakashima and Sueishi, 1992; Huffman et al., 2000; Sibon et al., 2005; Yoshimura et al., 2006).

The human LOX gene resides on chromosome 5q23.2 (Min, et al., 2009). It codes for the synthesis of a secreted 50-kDa glycosylated proenzyme (Pro-LOX), which is extracellularly cleaved into a mature active 32-kDa enzyme (LOX) and an 18-kDa propeptide (LOX-PP) by the procollagen C proteinases bone morphogenic protein-1 (BMP-1) and the related tolloid-like proteins TLL1 and TLL2 (Palamakumbura et al., 2004). A single-nucleotide polymorphism (SNP), G473A (rs1800449) in the LOX gene, resulting in an Arg158Gln substitution in a highly conserved region within LOX-PP (Min et al., 2009), has been shown to affect susceptibility to breast cancer in different human populations (Min et al., 2009; Ren et al., 2011). In the present study, we investigated the correlation between LOX G473A polymorphism and CADs.

Materials and Methods

Patients and controls

The study group included 656 Chinese patients with CAD (age range: 39–77 years) and 718 controls (age range: 35–79 years) recruited from the Shanghai East Hospital between January and December 2009. The diagnosis of CAD was confirmed by coronary angiography performed with the Judkins technique using a quantitative coronary angiographic system and was defined by angiography with at least one main coronary vessel with >50% luminal narrowing or with a history of acute myocardial infarction. In the same period, 718 outpatients who underwent regular physical examinations at the same hospital were recruited as controls. They were diagnosed free of CAD by their medical history of CAD or angiography, free of clear ischemic changes by electrocardiography and without chest pain symptoms. Individuals with congestive heart failure, peripheral vascular disease, rheumatic heart disease, pulmonary heart disease, tumor, chronic kidney, or hepatic disease were excluded from the study. All individuals enrolled were from the Han population in China. Social demographic information, family history of CAD, past history, and lifestyle factors were obtained through questionnaire interview. Written informed consent was obtained from each participant. The study was approved by the Review Boards of the Shanghai East Hospital. Each study participant provided a peripheral blood sample.

Genotyping analyses

Genomic DNA was extracted from the peripheral blood lymphocytes using a commercially available kit according to the manufacturer's instructions (Blood genomic DNA miniprep kit; Axygen Biosciences). The LOX G473A polymorphism was detected using a polymerase chain reaction (PCR)–restriction fragment length polymorphism method. The PCR primers were designed based on the GenBank reference sequence and Primer 5.0. The primers were as follows: forward primer 5′ CTCACAGTACCAGCCTCAGCG 3′ and reverse primer 5′ CCAGGTCTGGGCCTTTCATA 3′. The PCRs were performed in a total volume of 35 μL reaction mixture containing 100 ng genomic DNA, 12.5 pmol of each primer, 0.1 mM each dNTP, 1xPCR buffer, 1.0 mM MgCl₂, and 1.5 U of Taq DNA polymerase (Fermentas). Reactions were conducted using a thermal cycler (Biometra) under the following conditions: an initial incubation at 95°C for 10 min, 30 cycles of 95°C for 30 s, 57°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 7 min. The efficiency of the PCR was confirmed by gel electrophoresis on a 1.5% agarose gel. After DNA amplification, the PCR products were digested overnight at 37°C with 10 U of the specific restriction endonuclease PstI (Fermentas), which cuts the A allele. The digestion products were then resolved and separated on a 2% agarose gel stained with ethidium bromide for visualization under ultraviolet light. After electrophoresis, homozygous A alleles were represented by DNA bands with sizes at 291 and 114 bp; an uncut fragment of 405 bp indicated the homozygous G alleles; whereas heterozygous genotypes were displayed as a combination of 405, 291, and 114 bp. To confirm the genotyping results, 20% of PCR-amplified DNA samples were examined by DNA sequencing. Results between PCR and DNA sequencing analysis were 100% concordant.

Statistical analysis

The SPSS statistical software package ver.19.0 (SPSS Inc.) was used for statistical analysis. Demographic data between the study groups were compared by the chi-square test and the Student's t-test. The polymorphism was tested for deviation from Hardy–Weinberg equilibrium by comparing the observed and expected genotype frequencies using the chi-square test. For SNP analysis, genotype and allele frequencies of LOX G473A were compared between groups using the chi-square test, and odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression. p-Values <0.05 were considered significant.

Results

Clinical characteristics of the study subjects

The clinical characteristics of all the subjects are shown in Table 1. There was no significant difference in age and gender between the patients with CAD and the healthy adults. The traditional risk factors for CAD such as hypertension and diabetes showed higher frequencies in patients. Also, compared with the control, the CAD group had higher levels of body mass index, triglyceride, and low-density lipoprotein cholesterol, but lower total cholesterol and high-density lipoprotein cholesterol, all of which are established CAD risk factors (Table 1, p < 0.05).

Table 1.

General Characteristics of the Patients with Coronary Artery Disease and Control Group

Characteristics	CAD (n = 656)	Control (n = 718)	p
Age (years)	56.437 ± 8.156	55.585 ± 7.963	>0.05
Gender (M/F)	433/223	467/251	>0.05
BMI (kg/m²)	24.359 ± 9.614	23.021 ± 9.102	<0.05
Smoking, n (%)	253 (38.6)	76 (10.6)	<0.001
Hypertension, n (%)	344 (52.4)	115 (16.0)	<0.001
Diabetes, n (%)	130 (19.8)	37 (5.2)	<0.001
TG (mM)	1.892 ± 1.287	1.042 ± 0.432	<0.001
TC (mM)	4.806 ± 1.002	4.221 ± 0.711	<0.05
HDL-C (mM)	1.211 ± 0.335	1.389 ± 0.372	<0.05
LDL-C (mM)	2.945 ± 0.901	2.523 ± 0.462	<0.05

Data are mean ± standard deviation.

CAD, coronary artery disease; BMI, body mass index; TG, triglyceride; TC, total cholesterol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol.

The LOX G473A polymorphism in CAD cases and controls

We analyzed the association of LOX G473A polymorphism in 656 patients with CAD and 718 CAD negative controls (Table 2). The SNP genotyped was in Hardy-Weinberg equilibrium (HWE) (p > 0.05). LOX 473 AA genotype frequency was significantly higher in patients than in controls (OR = 1.93, 95% CI 1.26–2.95, p = 0.002); the A carrying genotypes (GA+AA) showed higher frequency in patients (OR = 1.33, 95% CI 1.06–1.67, p = 0.013). In addition, LOX 473 A allele carrier frequency was significantly higher in patients than in controls (OR = 1.38, 95% CI 1.15–01.67, p = 0.001). However, the GA genotype did not show any significant difference between patients and controls (p = 0.144). These data suggested that the LOX 473 AA genotype and A allele were associated with increased susceptibility to CAD in Chinese population.

Table 2.

Genotype and Allele Frequencies of LOX G473A Polymorphism in Coronary Artery Disease Cases and Controls

Frequencies of genotype or allele	Cases (%) n = 656	Controls (%) n = 718	OR (95% CI)	p
Genotype
GG	421 (64.2)	506 (70.5)	1.00
GA	174 (26.5)	174 (24.2)	1.20 (0.94–1.54)	0.144
AA	61 (9.3)	38 (5.3)	1.93 (1.26–2.95)	0.002^a
GA+AA	235 (35.8)	212 (29.5)	1.33 (1.06–1.67)	0.013^a
Allele
G	1016 (77.4)	1186 (82.6)	1.00
A	296 (22.6)	250 (17.4)	1.38 (1.15–1.67)	0.001^a

p < 0.05.

CI, confidence interval; OR, odds ratio.

LOX G473A polymorphism and clinical-pathological characteristics in patients with CAD

We further evaluated the association between LOX G473A polymorphism and clinical-pathological factors in patients with CAD (Table 3). Patients older than 60 years of age and younger than 60 years of age did not show any difference in genotype or allele frequencies. Similarly, gender and diabetes were not shown to be associated with the mutation. Patients with CAD hypertension had higher frequencies of AA genotype and A allele compared with controls (AA: 11.3% vs. 7.1%; A: 24.3% vs. 20.7%). However, neither of the differences was statistically significant (p = 0.065 and p = 0.119).

Table 3.

Stratification Analysis of Polymorphism According to Clinical-Pathological Characteristics in Patients with Coronary Artery Disease

	Frequencies
Characteristics	n (%)	n (%)	OR (95% CI)	p
Age	≤60 (n = 307)	>60 (n = 349)
GG	196 (63.8)	225 (64.5)	1.00
GA	82 (26.7)	92 (26.4)	1.02 (0.72–1.46)	0.899
AA	29 (9.5)	32 (9.1)	1.04 (0.61–1.78)	0.885
G	474 (77.2)	542 (77.7)	1.00
A	140 (22.8)	156 (22.3)	1.03 (0.79–1.33)	0.845
Gender	Male (n = 433)	Female (n = 223)
GG	275 (63.5)	146 (65.5)	1.00
GA	114 (26.3)	60 (26.9)	1.01 (0.70–1.46)	0.963
AA	44 (10.2)	17 (7.6)	1.37 (0.76–2.49)	0.293
G	664 (76.7)	352 (78.9)	1.00
A	202 (23.3)	94 (21.1)	1.14 (0.86–1.50)	0.356
Hypertension	With (n = 344)	Without (n = 312)
GG	216 (62.8)	205 (65.7)	1.00
GA	89 (25.9)	85 (27.2)	0.99 (0.70–1.42)	0.972
AA	39 (11.3)	22 (7.1)	1.68 (0.96–2.94)	0.065
G	521 (75.7)	495 (79.3)	1.00
A	167 (24.3)	129 (20.7)	1.23 (0.95–1.60)	0.119
Diabetes	With (n = 130)	Without (n = 526)
GG	81 (62.3)	340 (64.6)	1.00
GA	35 (26.9)	139 (26.4)	1.06 (068–1.65)	0.806
AA	14 (10.8)	47 (9.0)	1.25 (0.66–2.38)	0.496
G	197 (75.8)	819 (77.9)	1.00
A	63 (24.2)	233 (22.1)	1.12 (0.82–1.55)	0.472

Discussion

In the current study, we showed that the LOX G473A polymorphism was associated with increased susceptibility to CAD in Chinese population. This article demonstrates that polymorphism in LOX gene could be a risk factor for CAD.

The LOX G473A polymorphism has been found in different human races and is associated with a high risk of breast cancer (Min et al., 2009; Ren et al., 2011). Although the mechanism remains to be fully elucidated, it is possible that the G473A, resulting in an Arg158Gln substitution in a highly conserved region within LOX-PP, may reduce the ability of LOX-PP to suppress Ras signaling (Min et al., 2009). Activation of Ras can induce vascular cell senescence, which causes atherosclerosis (Minamino et al., 2004). Also, activation of Ras may promote vascular inflammation in vitro and in vivo, which is another factor for atherosclerosis (Minamino et al., 2004). Thus, LOX G473A polymorphism may affect atherosclerosis, the main cause for developing CAD.

In addition, LOX plays a crucial role in the maintenance of ECM stability and could participate in vascular remodeling associated with cardiovascular diseases (Rodríguez et al., 2008). LOX is associated with VSMC migration and proliferation, and its activity could be essential in the insolubilization of ECM components (Maki et al., 2005). The coordinate regulation of ECM synthesis and their modifying enzymes in response to growth factors and cytokines, such as transforming growth factor beta (TGFβ) and platelet-derived growth factor (PDGF), is critical in vascular remodeling associated with atherosclerosis and restenosis (Ferns et al., 1991; Nabel et al., 1993). TGFβ and PDGF are growth factors involved in the pathogenesis of restenosis and atherosclerosis and are considered therapeutic targets (Ferns et al., 1991; Nabel et al., 1993; Yamamoto et al., 2000; Kingston et al., 2001; Levitzki, 2005; Khan et al., 2007). TGFβ increases LOX expression and activity in VSMC (Gacheru et al., 1997; Shanley et al., 1997) and lung fibroblasts in cell culture (Boak et al., 1994). Further, TGFβ concomitantly up-regulates collagen type I and III synthesis in VSMC and enhances the production of proteoglycans and fibronectin in the rat aorta injury model (Ignotz and Massague, 1986). Interestingly, fibronectin is involved in LOX proteolytic activation (Fogelgren et al., 2005), a mechanism that could participate in the induction of LOX by TGFβ. PDGF, a key mitogen that promotes neointimal growth after coronary angioplasty (Ferns et al., 1991), also increases LOX expression in VSMC (Green et al., 1995). Similarly, granulocyte macrophage colony-stimulating factor, a cytokine implicated in vascular remodeling, increases both LOX and BMP-1 expression levels in VSMC (Weissen-Plenz et al., 2008). In fact, granulocyte macrophage colony-stimulating factor-deficient mice show decreased levels of tropoelastin and LOX and BMP-1 expression, with a concomitant deficiency in the cross-linkage of elastic fibers (Weissen-Plenz et al., 2008). Moreover, studies have revealed that disturbances of LOX expression could be related to endothelial dysfunction, lesion progression, or plaque rupture (Rodríguez et al., 2002). LOX is strongly down-regulated in the earlier stages of the atherosclerotic process (Rodríguez et al., 2008). Researchers have observed that systemic hypercholesterolaemia down-regulates aortic LOX expression in the porcine model of diet-induced atherosclerosis that develops fatty streaks in aorta after 100 days of diet intervention (Badimon, 2001; Rodríguez et al., 2002; Casani, et al., 2005). Since LOX has multiple roles in cardiovascular diseases, although LOX expression might be affected by the G473A polymorphism, it is possible that the LOX G473A polymorphism could influence the development of CAD through different pathways.

Our data showed that patients with CAD with hypertension had a higher frequency of AA genotype compared with controls (AA: 11.3% vs. 7.1%) (Table 3). Although it did not reach significant difference (p = 0.065), it is possible that the LOX G473A mutation could affect hypertension, as the polymorphism may induce atherosclerosis and atherosclerosis, which is a critical factor for hypertension. It would be interesting to conduct an independent research on this polymorphism and hypertension. According to the International HapMap Project, LOX G473A mutation lies in European, Asian, Sub-Saharan African, and African American populations. The average frequency of 473A allele is 24.6%. Therefore, studies in different populations could be helpful for further understanding of the correlation between this polymorphism and CAD.

In summary, this study demonstrated that the LOX gene 473 AA genotype and A allele were associated with an increased risk of CAD in a Chinese population. Our results raise the possibility that a function shift caused by genetic variants in immunity genes could have important consequences on the pathogenesis of CAD.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Badimon

2001. Atherosclerosis and thrombosis: lessons from animal models. Thromb Haemost, 86:356–365.

Boak

A.M.

, Roy

, Berk

, Taylor

, Polgar

, Goldstein

R.H.

, Kagan

H.M.

1994. Regulation of lysyl oxidase expression in lung fibroblasts by transforming growth factor-beta 1 and prostaglandin E2. Am J Respir Cell Mol Biol, 11:751–755.

Casani

, Sanchez-Gomez

, Vilahur

, Badimon

2005. Pravastatin reduces thrombogenicity by mechanisms beyond plasma cholesterol lowering. Thromb Haemost, 94:1035–1041.

Ferns

G.A.

, Raines

E.W.

, Sprugel

K.H.

, Motani

A.S.

, Reidy

M.A.

, Ross

1991. Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science, 253:1129–1132.

Fogelgren

, Polgar

, Szauter

K.M.

, Ujfaludi

, Laczko

, Fong

K.S.

, Csiszar

2005. Cellular fibronectin binds to lysyl oxidase with high affinity and is critical for its proteolytic activation. J Biol Chem, 280:24690–24697.

Gacheru

S.N.

, Thomas

K.M.

, Murray

S.A.

, Csiszar

, Smith-Mungo

L.I.

, Kagan

H.M.

1997. Transcriptional and post-transcriptional control of lysyl oxidase expression in vascular smooth muscle cells: effects of TGF-b1 and serum deprivation. J Cell Biochem, 65:395–407.

Green

R.S.

, Lieb

M.E.

, Weintraub

A.S.

, Gacheru

S.N.

, Rosenfield

C.L.

, Shah

, Kagan

H.M.

, Taubman

M.B.

1995. Identification of lysyl oxidase and other platelet-derived growth factor-inducible genes in vascular smooth muscle cells by differential screening. Lab Invest, 73:476–482.

Hornstra

I.K.

, Birge

, Starcher

, Bailey

A.J.

, Mecham

R.P.

, Shapiro

S.D.

2002. Lysyl oxidase is required for vascular and diaphragmatic development in mice. J Biol Chem, 278:14387–14393.

Huffman

M.D.

, Curci

J.A.

, Moore

, Kerns

D.B.

, Starcher

B.C.

, Thompson

R.W.

2000. Functional importance of connective tissue repair during the development of experimental abdominal aortic aneurysms. Surgery, 128:429–438.

10.

Ignotz

R.A.

, Massague

1986. Transforming growth factor-beta stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix. J Biol Chem, 261:4337–4345.

11.

Kagan

H.M.

, Li

2003. Lysyl oxidase: properties, specificity, and biological roles inside and outside of the cell. J Cell Biochem, 88:660–672.

12.

Khan

, Agrotis

, Bobik

2007. Understanding the role of transforming growth factor-beta1 in intimal thickening after vascular injury. Cardiovasc Res, 74:223–234.

13.

Kingston

P.A.

, Sinha

, David

, Castro

M.G.

, Lowenstein

P.R.

, Heagerty

A.M.

2001. Adenovirus-mediated gene transfer of a secreted transforming growth factor-beta type II receptor inhibits luminal loss and constrictive remodeling after coronary angioplasty and enhances adventitial collagen deposition. Circulation, 104:2595–2601.

14.

Levitzki

2005. PDGF receptor kinase inhibitors for the treatment of restenosis. Cardiovasc Res, 65:581–586.

15.

Lucero

H.A.

, Kagan

H.M.

2006. Lysyl oxidase: an oxidative enzyme and effector of cell function. Cell Mol Life Sci, 63:2304–2316.

16.

Maki

J.M.

, Rasanen

, Tikkanen

, Sormunen

, Makikallio

, Kivirikko

K.I.

, Soininen

2002. Inactivation of the lysyl oxidase gene Lox leads to aortic aneurysms, cardiovascular dysfunction and perinatal death in mice. Circulation, 106:2503–2509.

17.

Maki

J.M.

, Sormunen

, Lippo

, Kaarteenaho-Wiik

, Soininen

, Myllyharju

2005. Lysyl oxidase is essential for normal development and function of the respiratory system and for the integrity of elastic and collagen fibers in various tissues. Am J Pathol, 167:927–936.

18.

Min

, Yu

, Kirsch

K.H.

, Zhao

, Vora

S.R.

, Trackman

P.C.

, Spicer

D.B.

, Rosenberg

, Palmer

J.R.

, Sonenshein

G.E.

2009. A loss-of-function polymorphism in the propeptide domain of the LOX gene and breast cancer. Cancer Res, 69:6685–6693.

19.

Minamino

, Miyauchi

, Yoshida

, Tateno

, Komuro

2004. The role of vascular cell senescence in atherosclerosis: antisenescence as a novel therapeutic strategy for vascular aging. Curr Vasc Pharmacol, 2:141–148.

20.

Nabel

E.G.

, Shum

, Pompili

V.J.

, Yang

Z.Y.

, San

, Shu

H.B.

, Liptay

, Gold

, Gordon

, Derynck

1993. Direct transfer of transforming growth factor beta 1 gene into arteries stimulates fibrocellular hyperplasia. Proc Natl Acad Sci U S A, 90:10759–10763.

21.

Nakashima

, Sueishi

1992. Alteration of elastic architecture in the lathyritic rat aorta implies the pathogenesis of aortic dissecting aneurysm. Am J Pathol, 140:959–969.

22.

Palamakumbura

A.H.

, Jeay

, Guo

, Pischon

, Sommer

, Sonenshein

G.E.

, Trackman

P.C.

2004. The propeptide domain of lysyl oxidase induces phenotypic reversion of ras-transformed cells. J Biol Chem, 279:40593–40600.

23.

Ren

, Wu

, He

, Shao

, Cheng

, Huang

2011. Lysyl oxidase 473 g > a polymorphism and breast cancer susceptibility in Chinese Han population. DNA Cell Biol, 30:111–116.

24.

Rodríguez

, Martínez-González

, Raposo

, Alcudia

J.F.

, Guadall

, Badimon

2008. Regulation of lysyl oxidase in vascular cells: lysyl oxidase as a new player in cardiovascular diseases. Cardiovasc Res, 79:7–13.

25.

Rodríguez

, Raposo

, Martínez-González

, Casaní

, Badimon

2002. Low density lipoproteins down-regulates lysyl oxidase in vascular endothelial cells and the arterial wall. Arterioscler Thromb Vasc Biol, 22:1409–1414.

26.

Shanley

C.J.

, Gharaee-Kermani

, Sarkar

, Welling

T.H.

, Kriegel

, Ford

J.W.

, Stanley

J.C.

, Phan

S.H.

1997. Transforming growth factor-beta 1 increases lysyl oxidase enzyme activity and mRNA in rat aortic smooth muscle cells. J Vasc Surg, 25:446–452.

27.

Sibon

, Sommer

, Lamaziere

J.M.

, Bonnet

2005. Lysyl oxidase deficiency: a new cause of human arterial dissection. Heart, 91:e33.

28.

Weissen-Plenz

, Eschert

, Volker

, Sindermann

J.R.

, Beissert

, Robenek

, Scheld

H.H.

, Breithardt

2008. Granulocyte macrophage colony-stimulating factor deficiency affects vascular elastin production and integrity of elastic lamellae. J Vasc Res, 45:103–110.

29.

Yamamoto

, Morishita

, Tomita

, Shimozato

, Nakagami

, Kikuchi

, Aoki

, Higaki

, Kaneda

, Ogihara

2000. Ribozyme oligonucleotides against transforming growth factor-beta inhibited neointimal formation after vascular injury in rat model: potential application of ribozyme strategy to treat cardiovascular disease. Circulation, 102:1308–1314.

30.

Yoshimura

, Aoki

, Ikeda

, Furutani

, Hamano

, Matsuzaki

2006. Regression of abdominal aortic aneurysm by inhibition of c-Jun N-terminal kinase in mice. Ann N Y Acad Sci, 1085:74–81.