In Vivo Binding of Orc2 to a Region of the Chicken Lysozyme GAS 41 Origin Containing Multiple Sp1-Binding Sites

Abstract

Most known DNA replication origins in vertebrate genomes have been found to occur close to transcriptional promoters. The origin of bidirectional DNA replication of the chicken lysozyme GAS41 locus was identified in a CpG island covering the GAS41 gene promoter. In this study, we generated an α-Orc2 antibody from rabbits immunized with the C-terminal half of Orc2 for studying in vivo Orc2 binding to the lysozyme-GAS41 origin. Using the chromatin immunoprecipitation technique and quantitative real-time polymerase chain reaction, we were able to map the Orc2-binding site to a region of the lysozyme GAS41 origin that contains multiple Sp1/Sp3-binding sites comapping with two DNase I hypersensitive sites. Further, knockdown of endogenous Sp1 by RNA interference reduced specific Orc2 binding to the lysozyme GAS41 origin. These results suggest that Sp1 participates in recruiting Orc2 to the origin.

Introduction

I nitiation of DNA replication in eukaryotic cells occurs at multiple sites called origins in eukaryotic cells. The origin recognition complex (ORC) consisting of six subunits (Orc1–Orc6) is essential for the assembly of the multiprotein prereplication complex at origins licensing them for initiation of replication. Besides Orc1–Orc6, other proteins including Cdt1, Cdc6, and MCM2–7 have also been shown to be components of the prereplication complex (Bell and Dutta, 2002). In Saccharomyces cerevisiae, ORC ATP-dependently binds to a specific 11-bp consensus sequence present in origins called the autonomous replicating sequence via the Orc1 subunit (Rao and Stillman, 1995; Müller et al., 2010), whereas in Schizosaccharomyces pombe, binding of ORC to AT-rich replication origins is mediated by nine AT-hooks in the N-terminal domain of the Orc4 subunit (Chuang and Kelly, 1999; Lee et al., 2001). Presently little is known about the mechanism of origin recognition by ORC in higher organisms, because ORC binding to origins is not sequence specific. Interestingly, several studies have shown that ORC can be recruited to replication origins for licensing initiation by sequence-specific origin-binding nuclear proteins. For initiation of Epstein-Barr virus (EBV) replication, the EBV nuclear antigen 1 (EBNA1) binds to the EBV origin of plasmid (OriP) and recruits the host cell ORC (Dhar et al., 2001; Schepers et al., 2001). In addition to EBNA1-binding sites, OriP contains three binding sites for the telomere repeat factor (TRF); TRF2, but not TRF1, is able to recruit ORC to OriP and stimulate OriP replication (Atanasiu et al., 2006). Studies in Drosophila have shown that myb and heterochromatin protein 1 (HP1) interact with ORC and that both direct ORC to replication origins and heterochromatin for replication (Pak et al., 1997; Beall et al., 2002). Further, several other studies suggested that a variety of nuclear proteins such as Ku80, A1F-C, or HMGA1a play a key role in the determination of sequence-specific ORC target sites at replication origins (Sibani et al., 2005; Minami et al., 2006; Thomae et al., 2008). Recently, c-myc was found to interact with the prereplication complex binding to a DNA replication origin, and a direct role of c-myc in the initiation of DNA replication was suggested (Dominguez-Sola et al., 2007).

An origin of bidirectional DNA replication was localized to a small region between the chicken genes for lysozyme and GAS41. This origin is embedded in a ∼1.8-kb largely nonmethylated CpG island spanning the 3′ end of the lysozyme gene and the 5′ end of the GAS41 gene and displays a high initiation activity mapped closely to two DNase I hypersensitive (HS) sites of the GAS41 promoter (Phi-van et al., 1998; Phi-van and Strätling, 1999; Zimmermann et al., 2002, 2007). In this study, using a chromatin immunoprecipitation (ChIP) protocol in combination with quantitative real-time polymerase chain reaction (PCR), we investigated the in vivo interaction of Orc2 and Sp1 with chromatin of the lysozyme GAS41 origin. The binding sites of these factors were mapped to the DNase I HS sites containing Sp1 motifs, and Sp1 seems to be required for the specific Orc2 binding to the lysozyme GAS41 origin.

Materials and Methods

Preparation of α-Orc2 antibodies

cDNA coding the C-terminal half of chicken Orc2 (residues 353–588) was generated from plasmid riken1_17f11 containing the full-length Orc2 cDNA (GenBank accession no. AJ720422) by PCR using primers 5′-TCTGTTCTCAACCATATGACAGAG-3′ and 5′-TTTGGGAACAGGGATCCGTTATAT-3′ containing NdeI and BamHI restriction sites (underlined). Following digestion with NdeI and BamHI, the PCR fragment was cloned in the correct orientation and reading frame into vector pET-16b (Calbiochem-Novagen). The resulting plasmid was transformed into the Escherichia coli strain BL21(DE3)plysS (Calbiochem-Novagen), followed by treatment with isopropyl-1-thio-β-d-galactopyranoside to induce the expression of the C-terminal half of Orc2 with an N-terminal His tag. His-tagged Orc2 polypeptide was purified from the bacterial lysate under denaturing conditions with 6 M guanidine hydrochloride using nickel-nitrilotriacetic acid matrices from Qiagen following the protocol supplied by the manufacturer. For immunization, purified Orc2 polypeptide was injected into rabbits. IgG was purified from immune serum using a Proteus Protein A kit from Serva.

Cell culture, cell synchronization, and transfection

Chicken myelomonocytic HD11 (Beug et al., 1979) and hepatic DU249 cells (Langlois et al., 1974) were maintained in Iscove's modified Dulbecco's medium (IMDM) supplemented with 8% fetal calf serum, 2% chicken serum, 100 units/mL penicillin, and 100 μg/mL streptomycin at 37°C in humidified 95% air and 5% CO₂. Human hepatoma HepG2 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% FCS (Goethe et al., 2007). Cells were synchronized in G₁ and S phase as previously described (Zimmermann et al., 2007). To collect G₂-phase cells, G₁/S-arrested cells were released in fresh IMDM medium for 6 h. Small interfering RNA was transfected into DU249 cells using TurboFect siRNA Transfection Reagent (Fermentas, St. Leon-Rot, Germany) according to the instructions of the manufacturer. The sequences to silence Sp1 were 5′-ACGAGAACUCCAACAGUUCcc-3′ and 5′-GGCCUCCAGACUAUUAACCuc-3′. A nontargeting siRNA (MWG-Biotech) was used as a negative control.

Nucleoprotein preparation and ChIP

DU249 cells (3×10⁸) grown on 145-mm dishes were treated with 1% formaldehyde (Merck) for 10 min at 37°C. After removal of the medium, cells were washed twice with cold phosphate-buffered saline (PBS), scraped off in PBS supplemented with 10 mM sodium bisulfite (pH 7.2), and centrifuged at 600 g for 5 min at 4°C. The cells were suspended in 10 mL of hypotonic buffer A containing 10 mM Tris (pH 8.0), 3 mM MgCl₂, 10 mM NaCl, and 10 mM sodium bisulfite, incubated for 15 min at 4°C, and disrupted by 15 strokes of Dounce homogenization using a tight pestle. After centrifugation, the nuclear pellet was washed twice with 20 mL of hypotonic buffer A and twice with 20 mL of high salt buffer B containing 1 M NaCl, 10 mM Tris (pH 8.0), 0.1% Nonidet P40, 5 mM EDTA, and 10 mM sodium bisulfite and subsequently suspended in 1 mL ChIP buffer (150 mM NaCl, 50 mM Tris [pH 8.0], 0.5% Nonidet P40, 5 mM EDTA, and 10 mM sodium bisulfite). The sample was then sonicated by ten 30-s pulses at 4°C in a Branson Sonifier 450 and digested with 25 units of micrococcal nuclease (Fermentas) per mg DNA in the presence of 3 mM CaCl₂ at 37°C for 15 min. The reaction was stopped by adding 10 mM EDTA. Following centrifugation at 12,000 g for 3 min, the supernatant containing crosslinked nucleoprotein complexes was transferred to a fresh tube. The fragment length of the nucleoprotein complexes was controlled by 2% agarose gel electrophoresis. ChIP and DNA preparation were performed as previously described (Hübner and Phi-van, 2010).

Quantitative real-time PCR

DNA purified from the immunoprecipitated nucleoprotein complexes was analyzed by quantitative real-time PCR with SYBR Green I using a 7500 Real Time PCR System (Applied Biosystems) as previously described (Hübner and Phi-van, 2010).

Nuclear extract preparation and western blot analysis

Nuclear extracts from exponentially growing cells were prepared using the protocol of Schreiber et al. (1989) except that nuclear proteins were extracted by different salt concentrations. Western blot analysis was performed as previously described (Hübner and Phi-van, 2010).

Statistical analysis

Statistical significance was evaluated by the Student's t-test. p<0.05 was considered significant.

Results

Orc2 is tightly bound to chromatin

To study chicken Orc2, an α-Orc2 antibody was raised in rabbits using a bacterially expressed C-terminal half of chicken Orc2. In immunoblots this antibody as well as an antibody against human Orc2 recognized chicken Orc2 as a polypeptide band with an apparent molecular weight of ∼73 kDa (Fig. 1A), whereas human Orc2 displayed an apparent molecular weight of ∼67 kDa (Kreitz et al., 2001; Keller et al., 2002). To examine chromatin binding of Orc2, nuclei isolated from hepatic DU249 cells were sequentially treated with increasing salt concentrations. The resulting nuclear extracts were analyzed by immunoblotting. Figure 1B shows that Orc2 was mainly extracted by high salt with 0.4−0.8 M NaCl, whereas the transcription factor Sp1 was already mobilized from chromatin with 0.2 M NaCl. These results seem to be consistent with the fact that, in contrast to transcription factors, Orc2 is tightly bound to chromatin of different nuclear compartments including the highly packaged heterochromatin (Pak et al., 1997). Further, the requirement of high salt for the extraction of Orc2 is probably also due to large Orc2-containing protein complexes binding to chromatin.

FIG. 1.

Differential mobilization of origin recognition complex (Orc) 2 from chromatin. (A) Nuclear extracts from chicken DU249, HD11, and human Hep G2 cells were separated on SDS–polyacrylamide gels and then electroblotted onto nitrocellulose membranes. The blots were immunostained using antibodies against human Orc2 (α-hOrc2) and chicken Orc2 (α-cOrc2). Asterisk (*) indicates the possible degradation product of Orc2. (B) Nuclei prepared from 10⁷ DU249 cells were successively extracted with 400 μL of 0.2, 0.4, 0.6, and 0.8 M NaCl. Five microliters of each extract was analyzed by immunoblotting using the antibodies against Sp1 and Orc2.

Orc2 and Sp1 bind to the HS sites located within the lysozyme-GAS41 origin

Previous studies using a technique of indirect end labeling have shown that two DNase I HS sites contained in a region of the origin and GAS41 promoter comap exactly with a cluster of Sp1/Sp3-binding sites (Hübner and Phi-van, 2010). To determine whether Orc2 binds to the HS sites in vivo, we established a ChIP assay. For this assay, cells were treated with formaldehyde to crosslink chromatin proteins to DNA. After removing noncrosslinked proteins by high-salt extraction, the crosslinked high-salt-resistant chromatin was fragmented by a combination of ultrasonic pulses and digestion with micrococcal nuclease to produce chromatin fragments of <0.4 kb in length (data not shown). These chromatin fragments were used for immunoprecipitation with antibodies against Orc2 and Sp1 or with IgG from preimmune serum, and the resulting immunoprecipitates were then analyzed by immunoblotting. As shown in Figure 2, Orc2 and Sp1 were found in the fraction containing sheared chromatin fragments, which were resistant to the high-salt extraction (input), indicating that treatment of cells with formaldehyde efficiently crosslinked Orc2 to chromatin. Figure 2 shows further that Orc2 and Sp1 were contained in the chromatin precipitated by α-Orc2 and α-Sp1 antibodies, but not present in the immunoprecipitates with IgG from preimmune serum.

FIG. 2.

Chromatin immunoprecipitation (ChIP) with Orc2 and Sp1. Crosslinked chromatin fragments (input) from DU249 cells were immunoprecipitated with 3.75 μg α-Orc2 and 3.75 μg of preimmune IgG, or 0.2 μg α-Sp1 antibodies and 0.2 μg of preimmune IgG, for every 25 μg chromatin. α-Orc2, α-Sp1, and preimmune IgG precipitates were analyzed by western blotting with α-Orc2 antibody (A) or α-Sp1 antibody (B, C). Protein extract from input and nuclear extract from DU249 cells were used as controls. The small thin arrow indicates Sp1 in Orc2 immunoprecipitate. Asterisk (*) indicates possible nonreduced heavy chain dimer of IgG.

Further, we analyzed the chromatin immunoprecipitated by α-Orc2 and α-Sp1 antibodies by immunoblotting with each other. Interestingly, we also found that Orc2 immunoprecipitates contain Sp1 (Fig. 2C), indicating that Sp1 and Orc2 bind to very closely adjacent sequences. This result is thus consistent with the previous finding that a fraction of Sp1 coprecipitates with Orc2-bearing chromatin (Keller et al., 2002). However, for unknown reasons we did not detect Orc2 in Sp1 immunoprecipitates (data not shown). Perhaps, in relation to total Sp1, there might be only a small Sp1 fraction that binds to origins, implicating that little Orc2 is coprecipitated with Sp1 by Sp1-specific antibodies and therefore was undetectable by immunoblotting used in this study.

DNA was isolated from fragmented immunoprecipitated chromatin and analyzed by quantitative real-time PCR to detect the sequences that were specifically enriched in immunoprecipitated chromatin. Trying to map Orc2 binding to the lysozyme GAS41 origin more exactly, we used five primer pairs designed for analysis of ∼0.8 kb including the GAS41 promoter and the origin and two primer pairs located ∼1.7 kb upstream and downstream of the GAS41 promoter (Fig. 3 and Table 1). PCR performed with these primers and genomic DNA as template showed equal amplification efficiency for each primer pair (data not shown). Then, we addressed the question of whether some sequences of the lysozyme-GAS41 locus were enriched in the fragmented chromatin fraction (input), which was generated by the high-salt extraction, ultrasonic pulses, and digestion with micrococcal nuclease, before it was used for immunoprecipitation with the indicated antibodies. DNA purified from this fraction was analyzed by the real-time PCR. As shown in Figure 4A, PCR with each primer pair resulted in approximately equal amplification, which indicates that none of the selected sequences was enriched in the fraction. Next, we analyzed the DNA purified from fragmented immunoprecipitated chromatin by real-time PCR. Figure 4B shows that the sequences LG3 and LG4 very close to the DNase I HS sites and Sp1 cluster were enriched 7.5-fold and 6.5-fold over the sequence LG1 or 2.7-/2.1-/2.8-fold and 2.3-/1.6-/2.4-fold over the adjacent sequences LG2, LG5, and LG6, respectively, in the α-ORC2 immunoprecipitated chromatin. Statistical analysis using the unpaired t-test revealed that these differences were statistically highly significant (p≤0.01). Interestingly, very similar results were obtained with DNA from α-Sp1 immunoprecipitated chromatin. The enrichment of sequences LG3 and LG4 was 8.9- and 8-fold, respectively, higher than that of LG1 in the α-Sp1 immunoprecipitated chromatin (Fig. 4C). In contrast, none of the selected sequences was significantly enriched in immunoprecipitate with preimmune IgG (Fig. 4B, C). Taken together, these results suggest that Orc2 as well as Sp1 bind to the DNase I HS sites within the lysozyme GAS41 origin in vivo.

FIG. 3.

The lysozyme GAS41 locus with the coding sequences for lysozyme and GAS41 and the origin of bidirectional DNA replication (OBR). Two thin arrows and five open boxes indicate the sequences analyzed by real-time polymerase chain reaction (PCR) (LG1−7). Two DNase I hypersensitive (HS) sites comap with the Sp1 cluster (Hübner and Phi-van, 2010).

FIG. 4.

Enrichment of the lysozyme GAS41 origin sequences by antibodies against Orc2 and Sp1. DNA was purified from crosslinked chromatin fragments (input) (A), α-Orc2 precipitates (B), α-Sp1 precipitates (C), and preimmune IgG precipitates (B, C). The purified DNA was analyzed by quantitative real-time PCR using seven primer pairs (Table 1) for the amplification of fragments LG1−7 shown in Figure 3. The relative enrichment of the fragments analyzed was calculated by comparison to the upstream located fragment LG1. Results are mean values from three ChIP experiments.

Table 1.

Primer Sequences for Quantitative Real-Time Polymerase Chain Reaction

Fragment ^a	Primer sequence	Size of PCR product (bp)
LG1	5′ GCAGCAGAGGTCAGAGTAACCA 3′	62
	5′ TGCTGGACACAGGCTGATGA 3′
LG2	5′ GACATAACAGCGAGCGTGAACT 3′	53
	5′ CCGTTTCCATCGCTGACG 3′
LG3	5′ AACGACTATACGCAAACGCCTT 3′	52
	5′ TGGCGGCGGAAAGAGAC 3′
LG4	5′ CCCCTCCGGTGCAATATG 3′	51
	5′ GGAGTCAGGCCCGAACTCA 3′
LG5	5′ CCGCTTCTCTTCTCTCCCG 3′	60
	5′ TTCCCGTACACTACCGGCTT 3′
LG6	5′ CATCAGTGGACGGTTTACGTGA 3′	51
	5′ CTCGGGCCCTACCTCGTT 3′
LG7	5′ CAGCTGACACTTGGTGCTTACAA 3′	66
	5′ CGGCGAAGGTATCCTCATTTT 3′

Fragments analyzed by real-time PCR are indicated in Figure 3.

PCR, polymerase chain reaction.

siRNA-mediated repression of Sp1 affects the Orc2 binding to the lysozyme GAS41 origin

To investigate whether Sp1 binding is a prerequisite for the Orc2 binding to the lysozyme GAS41 origin, we knocked down Sp1 by transfection of DU249 cells with Sp1 siRNA and then analyzed the effect of Sp1 silencing on Orc2 binding by ChIP assay. Western blot analysis of nuclear extracts from DU249 cells transfected with Sp1 siRNA shows a drastic decrease in endogenous Sp1 expression (Fig. 5A). Consequently, we examined the binding of Sp1 and Orc2 to the lysozyme GAS41 origin by calculating the enrichment of the origin sequence LG3 in Sp1 and Orc2 immunoprecipitates, which was normalized to the far upstream located fragment LG1. Figure 5B and C show that transfection with Sp1 siRNA also caused a significant decrease of the Sp1 binding and reduced the specific Orc2 binding to the origin by 35% in comparison to the negative control siRNA. Thus, these data suggest that Sp1 is required for binding of Orc2 to the lysozyme GAS41 origin. However, the reduction of the Orc2 binding is not strongly correlated with the siRNA-mediated decrease of Sp1 binding. One possible explanation is that Orc2, after recruiting to origins, is tightly bound to chromatin, which is possibly independent of Sp1.

FIG. 5.

Involvement of Sp1 in Orc2 binding to the lysozyme GAS41 origin. DU249 cells were transfected with either control siRNA or Sp1 siRNA. Nuclear extracts from transfected cells were analyzed by western blotting using α-Sp1 and α-Orc2 antibodies (A). Crosslinked chromatin fragments from transfected cells were immunoprecipitated with antibodies against Sp1 (B) and Orc2 (C). DNA was purified from the immunoprecipitates and analyzed by quantitative real-time PCR of fragments LG1 and LG3. Results are mean values from three experiments.

Orc2 is bound to the lysozyme GAS41 origin in the G₁, S, and G₂ phases of the cell cycle

To examine whether Sp1 and Orc2 binding to the lysozyme GAS41 origin is cell cycle regulated, we analyzed the Sp1 and Orc2 binding in synchronized DU249 cells by the ChIP assay. Figure 6A and B show the relative enrichment of LG3 in Sp1 and Orc2 immunoprecipitates, respectively. It is shown that the enrichment of LG3 by α-Sp1 as well as by Orc2 was equally high from cells of G₁, S, and G₂ phases, indicating that Sp1 and Orc2 were bound to the lysozyme GAS41 origin in G₁, S, and G₂ phases of the cell cycle. Thus, these results are consistent with the previous finding by Li and DePamphilis (2002) that Orc2 is tightly bound to chromatin throughout the cell cycle.

FIG. 6.

Orc2 binding to the lysozyme GAS41 origin during the cell cycle. Cells were synchronized for entering the G₁, S, and G₂ phase of the cell cycle. The Sp1 and Orc2 binding to the lysozyme GAS41 origin was analyzed by ChIP assay using α-Sp1 (A) and α-Orc2 antibodies (B) and quantitative real-time PCR of fragments LG1 and LG3. Results are mean values from three experiments.

Discussion

To study the interaction of Orc2 with the chicken lysozyme GAS41 origin, we prepared an α-cOrc2 antibody. Using the ChIP assay with this antibody we found that Orc2 preferentially binds to the open chromatin of two DNase I HS sites of the lysozyme GAS41 origin containing multiple Sp1-binding sites. These results are consistent with previous findings that ORC binds to nucleosome-free regions in both S. cerevisiae and Drosophila (Eaton et al., 2010; MacAlpine et al., 2010) or to regions of low nucleosome occupancy in the Chinese hamster dihydrofolate reductase locus (Lubelsky et al., 2011). On the other hand, using EMSA with oligonucleotides derived from sequences of the lysozyme GAS41 origin, we were not able to identify any Orc2-binding sites (data not shown), suggesting that Orc2 binding to this origin is not sequence specific.

Several studies have reported positive effects of transcription factors on DNA replication. For example, the cellular oncoprotein c-myc, by interacting with the prereplicative complex, binds to the c-myc gene origin and modulates DNA replication origin activity (Dominguez-Sola et al., 2007), or other transcription factors such as NF1 and Oct-1 are able to bend the Ad5 origin, leading to a synergistic enhancement of DNA replication (Mysiak et al., 2004). It has also been reported that transcription factor binding to promoter elements can induce origin activity (Ghosh et al., 2004) or site-specific initiation of DNA replication (Danis et al., 2004).

Sp1 is a zinc finger transcription factor and has been already shown to be required for viral replication of simian virus 40, polyomavirus, papillomavirus, EBV, and cytomegalovirus (Guo and DePamphilis, 1992; Demeret et al., 1995; Baumann et al., 1999; Isomura et al., 2005). A possible role of Sp1 in DNA replication of Metazoa is also conceivable. Sp1 is essential for transcription of the house-keeping gene GAS41, which possesses a promoter without the typical TATA box as part of an upstream located CpG island (Hübner and Phi-van, 2010). Our results obtained from experiments using Sp1 siRNA support the assumption that Sp1 might play a role in the initiation process of the lysozyme GAS41 origin. Although the initiation at origins is inhibited by highly packaged chromatin, transcription activators may recruit chromatin remodelers, which in turn may open chromatin as access for the initiation and replication factors to the origins. The open chromatin structure of two DNase I HS sites at the lysozyme GAS41 origin is probably maintained by the Sp1/Sp3 binding (Hübner and Phi-van, 2010). In contrast to yeast, binding of Orc2 to origins in Metazoa is not sequence specific and therefore might require additional nuclear factors. Our results suggest that Sp1 plays such a role. The binding of Sp1 to many CG-boxes results in high concentrations of Sp1 at the lysozyme GAS41 origin, which might enable Orc2 to be recruited to the origin. Further, because Sp1 can form a tetramer, which causes DNA looping at promoters for recruiting transcription factors (Mastrangelo et al., 1991), it is also speculated that Sp1 could bend the chromatin at the lysozyme GAS41 origin to facilitate the assembly of preinitiation complexes. Therefore, it remains interesting to determine the exact role of Sp1 for the assembly of the prereplicative complex at the lysozyme GAS41 origin.

Footnotes

Acknowledgments

The authors thank Dr. W.-H. Strätling (University Medical Center Hamburg-Eppendorf) for helpful discussions, Drs. J.-M. Buerstedde and R.B. Caldwell (German Research Center for Environmental Health, Munich) for providing plasmid riken1_17f11, and Drs. R. Knippers and D. Schaarschmidt (University of Konstanz) for providing human Orc2-specific antibodies.

Disclosure Statement

No competing financial interests exist.

References

Atanasiu

, Deng

, Wiedmer

, Norseen

, Lieberman

P.M.

2006. ORC binding to TRF2 stimulates OriP replication. EMBO Rep, 7:716–721.

Baumann

, Feederle

, Kremmer

, Hammerschmidt

1999. Cellular transcription factors recruit viral replication proteins to activate the Epstein-Barr virus origin of lytic DNA replication, oriLyt. EMBO J, 18:6095–6105.

Beall

E.L.

, Manak

J.R.

, Zhou

, Bell

, Lipsick

J.S.

, Botchan

M.R

. 2002. Role for a Drosophila Myb-containing protein complex in site-specific DNA replication. Nature, 420:833–837.

Bell

S.P.

, Dutta

2002. DNA replication in eukaryotic cells. Annu Rev Biochem, 71:333–374.

Beug

, von Kirchbach

, Döderlein

, Conscience

J.F.

, Graf

1979. Chicken hematopoietic cells transformed by seven strains of defective avian leukemia viruses display three distinct phenotypes of differentiation. Cell, 18:375–390.

Chuang

R.-Y.

, Kelly

T.J.

1999. The fission yeast homologue of Orc4p binds to replication origin DNA via multiple AT-hooks. Proc Natl Acad Sci U S A, 96:2656–2661.

Danis

, Brodolin

, Menut

, Maiorano

, Girard-Reydet

, Mechali

2004. Specification of a DNA replication origin by a transcription complex. Nat Cell Biol, 6:721–730.

Demeret

, Le Moal

, Yaniv

, Thierry

1995. Control of HPV 18 DNA replication by cellular and viral transcription factors. Nucleic Acids Res, 23:4777–4784.

Dhar

S.K.

, Yoshida

, Machida

, Khaira

, Chaudhuri

, Wohlschlegel

J.A.

, Leffak

, Yates

, Dutta

2001. Replication from oriP of Epstein-Barr virus requires human ORC and is inhibited by geminin. Cell, 106:287–296.

10.

Dominguez-Sola

, Ying

C.Y.

, Grandori

, Ruggiero

, Chen

, Li

, Galloway

D.A.

, Gu

, Gautier

, Dalla-Favera

2007. Non-transcriptional control of DNA replication by c-Myc. Nature, 448:445–451.

11.

Eaton

M.L.

, Galani

, Kang

, Bell

S.P.

, MacAlpine

D.M.

2010. Conserved nucleosome positioning defines replication origins. Genes Dev, 24:748–753.

12.

Goethe

, Basler

, Phi-van

2007. Regulation of C/EBPβ mRNA expression and C/EBPβ promoter activity by PKA and PKC in a myelomonocytic cell line (HD11) Inflamm Res, 56:274–281.

13.

Ghosh

, Liu

, Randall

, Bevington

, Leffak

2004. Transcription factor binding and induced transcription alter chromosomal c-myc replicator activity. Mol Cell Biol, 24:10193–10207.

14.

Guo

Z.S.

, DePamphilis

M.L.

1992. Specific transcription factors stimulate simian virus 40 and polyomavirus origins of DNA replication. Mol Cell Biol, 12:2514–2524.

15.

Hübner

, Phi-van

2010. Sp1 and Sp3 regulate transcription of the chicken GAS41 gene. Biochim Biophys Acta, 1799:442–447.

16.

Isomura

, Stinski

M.F.

, Kudoh

, Daikoku

, Shirata

, Tsurumi

2005. Two Sp1/Sp3 binding sites in the major immediate-early proximal enhancer of human cytomegalovirus have a significant role in viral replication. J Virol, 79:9597–9607.

17.

Keller

, Ladenburger

E.-M.

, Kremer

, Knippers

2002. The origin recognition complex marks a replication origin in the human TOP1 gene promoter. J Biol Chem, 277:31430–31440.

18.

Kreitz

, Ritzi

, Baack

, Knippers

2001. The human origin recognition complex protein 1 dissociates from chromatin during S phase in HeLa cells. J Biol Chem, 276:6337–6342.

19.

Langlois

A.J.

, Lapis

, Ishizaki

, Beard

J.W.

, Bolognesi

D.P.

1974. Isolation of a transplantable cell line induced by the MC29 avian leukosis virus. Cancer Res, 34:1457–1464.

20.

Lee

J.-K.

, Moon

K.-Y.

, Jiang

, Hurwitz

2001. The Schizosaccharomyces pombe origin recognition complex interacts with multiple AT-rich regions of the replication origin DNA by means of the AT-hook domains of the spOrc4 protein. Proc Natl Acad Sci U S A, 98:13589–13594.

21.

C.-J.

, DePamphilis

M.L.

2002. Mammalian Orc1 protein is selectively released from chromatin and ubiquitinated during the S-to-M transition in the cell division cycle. Mol Cell Biol, 22:105–116.

22.

Lubelsky

, Sasaki

, Kuipers

M.A.

, Lucas

, Le Beau

M.M.

, Carignon

, Debatisse

, Prinz

J.A.

, Dennis

J.H.

, Gilbert

D.M.

2011. Pre-replication complex proteins assemble at regions of low nucleosome occupancy within the Chinese hamster dihydrofolate reductase initiation zone. Nucleic Acids Res, 39:3141–3155.

23.

MacAlpine

H.K.

, Gordan

, Powell

S.K.

, Hartemink

A.J.

, MacAlpine

D.M.

2010. Drosophila ORC localizes to open chromatin and marks sites of cohesin complex loading. Genome Res, 20:201–211.

24.

Mastrangelo

I. A.

, Courey

A.J.

, Wall

J.S.

, Jackson

S.P.

, Hough

P.V.C.

1991. DNA looping and Sp1 multimer links: a mechanism for transcriptional synergism and enhancement. Proc Natl Acad Sci U S A, 88:5670–5674.

25.

Minami

, Takahashi

, Suto

, Saito

, Tsutsumi

2006. Binding of AIF-C, an Orc1-binding transcriptional regulator, enhances replicator activity of the rat aldolase B origin. Mol Cell Biol, 26:8770–8780.

26.

Müller

, Park

, Shor

, Huebert

D.J.

, Warren

C.L.

, Ansari

A.Z.

, Weinreich

, Eaton

M.L.

, MacAlpine

D.M.

, Fox

C.A.

2010. The conserved bromo-adjacent homology domain of yeast Orc1 functions in the selection of DNA replication origins within chromatin. Genes Dev, 24:1418–1433.

27.

Mysiak

M.E.

, Wyman

, Holthuizen

P.E.

, van der Vliet

P.C.

2004. NFI and Oct-1 bend the Ad5 origin in the same direction leading to optimal DNA replication. Nucleic Acids Res, 32:6218–6225.

28.

Pak

D. T.

, Pflumm

, Chesnokov

, Huang

D.W.

, Kellum

, Marr

, Romanowski

, Botchan

M.R.

1997. Association of the origin recognition complex with heterochromatin and HP1 in higher eukaryotes. Cell, 91:311–323.

29.

Phi-van

, Sellke

, von Bodenhausen

, Strätling

W.H.

1998. An initiation zone of chromosomal DNA replication at the chicken lysozyme gene locus. J Biol Chem, 273:18300–18307.

30.

Phi-van

, Strätling

W.H.

1999. An origin of bidirectional DNA replication is located within a CpG island at the 3′ end of the chicken lysozyme gene. Nucleic Acids Res, 27:3009–3017.

31.

Rao

, Stillman

1995. The origin recognition complex interacts with a bipartite DNA binding site within yeast replicators. Proc Natl Acad Sci U S A, 92:2224–2228.

32.

Schepers

, Ritzi

, Bousset

, Kremmer

, Yates

J.L.

, Harwood

, Diffley

J.F.X.

, Hammerschmidt

2001. Human origin recognition complex binds to the region of the latent origin of DNA replication of Epstein-Barr virus. EMBO J, 20:4588–4602.

33.

Schreiber

, Matthias

, Müller

M.M.

, Schaffner

1989. Rapid detection of octamer binding proteins with “mini-extracts,” prepared from a small number of cells. Nucleic Acids Res, 17:6419.

34.

Sibani

, Price

G.B.

, Zannis-Hadjopoulos

2005. Ku80 binds to human replication origins prior to the assembly of the ORC complex. Biochemistry, 44:7885–7896.

35.

Thomae

A.W.

, Pich

, Brocher

, Spindler

M.-P.

, Berens

, Hock

, Hammerschmidt

, Schepers

2008. Interaction between HMGA1a and the origin recognition complex creates site-specific replication origins. Proc Natl Acad Sci U S A, 105:1692–1697.

36.

Zimmermann

, Ahrens

, Matthes

, Buerstedde

J.-M.

, Strätling

W.H.

, Phi-van

2002. Targeted disruption of the GAS41 gene encoding a putative transcription factor indicates that GAS41 is essential for cell viability. J Biol Chem, 277:18626–18631.

37.

Zimmermann

, Holtz

, Phi-van

2007. The chromatin structure of the lysozyme GAS41 origin of DNA replication changes during the cell cycle. Biol Res, 40:185–192.

In Vivo Binding of Orc2 to a Region of the Chicken Lysozyme GAS 41 Origin Containing Multiple Sp1-Binding Sites

Abstract

Introduction

Materials and Methods

Preparation of α-Orc2 antibodies

Cell culture, cell synchronization, and transfection

Nucleoprotein preparation and ChIP

Quantitative real-time PCR

Nuclear extract preparation and western blot analysis

Statistical analysis

Results

Orc2 is tightly bound to chromatin

Orc2 and Sp1 bind to the HS sites located within the lysozyme-GAS41 origin

siRNA-mediated repression of Sp1 affects the Orc2 binding to the lysozyme GAS41 origin

Orc2 is bound to the lysozyme GAS41 origin in the G1, S, and G2 phases of the cell cycle

Discussion

Footnotes

Acknowledgments

Disclosure Statement

References

Orc2 is bound to the lysozyme GAS41 origin in the G₁, S, and G₂ phases of the cell cycle