Mitochondria DNA Polymorphisms Are Associated with Susceptibility to Endometriosis

Abstract

Because energy production involves oxidative phosphorylation, mitochondria are major sources of reactive oxygen species in the cell. Recent findings indicate that mitochondrial DNA (mtDNA) variants may play a role in the etiology of certain autoimmune and chronic inflammatory diseases. The aim of this study was to investigate the possible association between mtDNA polymorphisms and susceptibility to endometriosis. This study included 198 patients with histologically confirmed endometriosis and 167 patients without endometriosis as controls. Common variants of mtDNA at nt10398 (A/G transition), nt13708 (G/A transition), and nt16189 (T/C transition) were detected using polymerase chain reaction. An association study was performed with a chi-square test and logistic regression analysis. The prevalence of the mtDNA nt16189 variant was higher in patients with endometriosis (46.0%, 91 of 198) than in controls (34.7%, 58 of 167) (p=0.030) with odds ratio (OR) of 1.98 (95% confidence interval [CI]: 1.04–3.78). A combination of the 10398 and 16189 variants was also associated with increased risk for endometriosis (OR=1.90, 95% CI: 1.13–3.18, p=0.015). These associations remained significant even after adjusting for age and body mass index. Our data strongly suggest that the mtDNA 16189 variants and the combination of mtDNA 16189 and 10398 variants increase susceptibility to endometriosis.

Introduction

E ndometriosis, defined as the proliferation of endometrial tissue outside the uterine cavity, is one of the most common benign gynecologic disorders. It is a polygenically inherited disease with complex, multifactorial etiology related to interaction among genetic, immunologic, hormonal, and environmental factors (Crosignani et al., 2006). Recent studies have investigated the role of the immune system and oxidative stress in the development of endometriosis (Gupta et al., 2006; Augoulea et al., 2009). Oxidative stress is the disturbance in the balance between the production of reactive species, including reactive oxygen species (ROS) and antioxidant defenses, and results in a relative excess of reactive species. At endometriotic sites, inflammatory cells including eosinophils, neutrophils, and macrophages generate ROS, which contributes to the development of oxidative stress in the peritoneal cavity. Oxidative stress further augments the immune response in affected sites and the oxidative proinflammatory state of the peritoneal fluid is an important mediator of endometriosis (Augoulea et al., 2009).

Mitochondria are organelles found in all nucleated cells. They are composed of about 1500 proteins encoded by nuclear DNA (nDNA) and mitochondrial DNA (mtDNA) (Taylor and Turnbull, 2005). The mitochondrial genome (mtDNA) consists of closed circular DNA encoding 2 rRNA, 22 tRNA, and 13 proteins (Anderson et al., 1981). All 13 proteins encoded by mtDNA are involved in mitochondrial oxidative phosphorylation (OXPHOS) enzyme complexes that are essential for ATP production. Because energy production involves OXPHOS, mitochondria are also major sources of ROS in the cell. It is estimated that 90% of cellular oxygen is consumed in the mitochondria and that about 2%–4% of that oxygen is converted to ROS. As there is no system that efficiently protects and repairs mtDNA under much higher levels of oxidative stress, mtDNA is more vulnerable to alteration than nDNA (Kang and Hamasaki, 2005).

Although defective mitochondrial function is most commonly thought to be related to neuromuscular and neurodegenerative diseases, studies indicate that mtDNA mutations are also involved in other human diseases and malignancies (Carew and Huang, 2002; Mootha et al., 2003; Suzuki et al., 2003; Rohan et al., 2010). A number of recent studies have suggested that mtDNA variants may also play a role in the etiology of certain cancers, autoimmune diseases, and chronic inflammatory diseases (Canter et al., 2005; Yu et al., 2008, 2009; Jonsen et al., 2009; Singh and Kulawiec, 2009). However, the data concerning the association of defective mitochondrial function with endometriosis are limited (Kao et al., 2005). Given that mitochondria are involved in ROS formation, apoptosis, and energy production required for the activation and proliferation of peripheral lymphocytes and that mitochondria and autoimmunity are closely linked to each other, we hypothesized that mtDNA variants are involved in the pathogenesis of endometriosis. In this study, we investigated three common mtDNA variants at nt10398 (A→G transition), nt13708 (G→A transition), and nt16189 (T→C transition), which have been shown to be involved with ROS production and oxidative damage, and assessed whether these mtDNA polymorphisms are associated with susceptibility to endometriosis.

Materials and Methods

Study subjects

The present study included 365 premenopausal women who underwent elective surgery with subsequent pathological evaluation at the Department of Obstetrics and Gynecology, Gangnam Severance Hospital, between January 2007 and March 2010. The study sample was biologically homogeneous, as all subjects were of Korean descent. This study was approved by the Institutional Review Board of Gangnam Severance Hospital and all subjects provided written informed consent. One hundred ninety-eight women had direct visualization of endometriotic lesions and/or pathologically confirmed endometriosis at the time of surgery, and the stage of endometriosis was determined using the revised American Society of Reproductive Medicine classification (American Society for Reproductive Medicine, 1997). Thirty-seven patients were diagnosed with minimal to mild disease (26 patients with stage I and 11 patients with stage II endometriosis) and 161 patients were diagnosed with moderate to severe disease (80 patients with stage III and 81 patients with stage IV endometriosis). One hundred sixty-seven patients without evidence of endometriosis served as control subjects. Controls included 55 cases of dermoid cysts, 40 cases of serous cystadenoma, 28 cases of mucinous cystadenoma, 38 cases of myomas, and 6 cases of paratubal cysts that were otherwise healthy. Postmenopausal women, previous hormone or GnRH agonist users, and patients who had adenomyosis, endometrial cancer, endometrial hyperplasia or endometrial polyps, tubo-ovarian abscess, and/or pelvic inflammatory disease were excluded from this study.

For all patients, pretreatment serum CA-125 levels were measured with CA-125 II electrochemiluminescence immunoassay using a Roche/Hitachi Modular Analytics E170 (Roche Diagnostics, Tokyo, Japan). The presence of dysmenorrhea before surgery was recorded using a four-point scale and a Visual Analog Scale (VAS). The scores for the four-point scale were as follows: 0=no dysmenorrhea; 1=minimal (can work, somewhat uncomfortable); 2=moderate (can work, but quite uncomfortable); or 3=severe (miss work, has to be in bed). VAS consisted of a 10-cm-linear analog scale marked from 0 to 10, where 0 represented no pain and 10 represented the most severe pain. The score was recorded by marking a point on the 10-cm line. Body mass index (BMI) was calculated as weight in kilograms divided by height in meters squared.

Sample DNA extraction and mtDNA genotyping

Blood samples were collected from all patients using a standard venipuncture technique and ethylenediaminetetraacetic acid tubes. DNA was subsequently extracted from peripheral blood lymphocytes using standard methods.

The three single-nucleotide polymorphisms (SNPs) of mtDNA nt10398 (A/G), nt13708 (G/A), and nt16189 (T/C) were amplified by three polymerase chain reactions (PCRs). The primers were generally positioned approximately 50–60 bp from the boundary to allow for the detection of the SNPs (Table 1). PCR using genomic DNA was carried out in 30 μL reaction volumes containing 100 ng genomic DNA, 0.2 mM primers, 100 mM dNTP, reaction buffer (100 mM Tris [pH 8.3], 500 mM KCl, 15 mM MgCl₂, 0.01% gelatin), and 5 U/μL SP-Taq polymerase (COSMO Genetech. Co. Ltd., Seoul, Korea) with the following cycling profile: denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s and a final extension step at 72°C for 30 s. All thermal cycles were run on TaKaRa PCR Thermal Cycler (TaKaRa). All PCR fragments were purified using a PCR purification kit (COSMO Genetech. Co. Ltd.) after gel electrophoresis with a 1.5% agarose gel. All PCR products were directly sequenced in both directions using a 3100 Genetic Analyzer (PE Applied Biosystems, Foster City, CA) with PRISM Dye Terminator and Dye Primer Cycle Sequencing chemistries.

Table 1.

Oligonucleotides Used for the Detection of Mitochondrial DNA nt10398 (A/G), nt13708 (G/A), and nt16189 (T/C)

Oligonucleotide	Sequence	Size
10398-F	5′ CCCTCCTTTTACCCCTACCA 3′	371 bp
10398-R	5′ GGCTAAGAGGGAGTGGGTGT 3′
13708-F	5′ TCATACACAAACGCCTGAGC 3′	386 bp
13708-R	5′ GGGTAGAATCCGAGTATGTTGG 3′
16189-F	5′ TCCACCATTAGCACCCAAAG 3′	390 bp
16189-R	5′ GGGACGAGAAGGGATTTGAC 3′

F, forward; R, reverse.

Statistical analysis

Statistical analysis was conducted using SPSS version 18 (SPSS, Chicago, IL). Continuous variables were expressed as means±standard deviation and compared using Student's t-test. The statistical difference in the frequency of occurrence of the variants of mtDNA between endometriosis and control group was assessed by Pearson's χ ² test. Logistic regression analysis was used to analyze the association of variants of mtDNA with endometriosis after correction for age and BMI. p<0.05 was considered significant.

Results

The clinical characteristics of the patients are shown in Table 2. Mean age, mean parity, and BMI were significantly lower in patients with endometriosis than in controls, whereas scores from the four-point scale and VAS for dysmenorrhea were significantly higher in the endometriosis group than in the control group. The mean serum CA-125 levels were 74.87±180.21 IU/mL for endometriosis group and 32.45±82.79 IU/mL for the control group (p=0.005).

Table 2.

Clinical Characteristics of Study Group

	Endometriosis (N=198)	Control (N=167)	p-Value
Age (years)	34.10±7.37	36.55±10.05	0.010
Parity	0.48±0.66	0.76±0.81	0.001
BMI (m²/kg)	21.24±3.65	22.51±3.53	0.001
Dysmenorrhea
Four-point scale	1.32±1.02	0.67±0.88	<0.001
VAS	3.13±3.00	1.89±2.36	<0.001
CA-125 (IU/mL)	74.87±180.21	32.45±82.79	0.005

Data are expressed as mean±standard deviation.

BMI, body mass index; VAS, Visual Analog Scale.

Among the three mtDNA variants, only the prevalence of nt16189 was significantly higher in patients with endometriosis than in controls (45.9% vs. 34.7%, p=0.030) with odds ratio (OR) of 1.598 (95% confidence interval [CI]: 1.046–2.442) (Table 3). The other two mtDNA variants were not associated with susceptibility to endometriosis in the cohort. We further analyzed the frequency of combination of the three mtDNA variants, and the prevalence of the combination of nt10398 and nt16189 variants was significantly higher in the endometriosis group than in the control group (26.8% vs. 16.2%, p=0.015, OR: 1.895, 95% CI: 1.129–3.183).

Table 3.

Associations Between Mitochondrial DNA Polymorphisms and Susceptibility to Endometriosis

	Frequency
SNP	Endometriosis (N=198)	Control (N=167)	OR (95% CI)	p-Value
10398 A/G	134 (67.7)	107 (64.1)	1.174 (0.760–1.813)	0.469
13708 G/A	9 (4.5)	5 (3.0)	1.543 (0.507–4.696)	0.442
16189 T/C	91 (45.9)	58 (34.7)	1.598 (1.046–2.442)	0.030
10398 G + 13708 A	2 (1.0)	0 (0.0)	0.990 (0.976–1.004)	0.193
13708 A + 16189 C	4 (2.0)	2 (1.2)	1.701 (0.308–9.405)	0.538
10398 G + 16189 C	53 (26.8)	27 (16.2)	1.895 (1.129–3.183)	0.015
10398 A + 16189 T	26 (13.1)	29 (17.4)	0.719 (0.405–1.287)	0.260

Data are expressed as n (%).

SNP, single-nucleotide polymorphism; OR, odds ratio; CI, confidence interval.

For further analysis, the endometriosis group was divided into subgroups according to severity of disease (Table 4). When the prevalence of three mtDNA variants and combination of these three mtDNA variants in patients with endometriosis were compared with controls according to severity of disease, the differences in the prevalence of nt16189 variant and the combination of nt10398 and nt16189 variants were more prominent in patients with minimal to mild disease, whereas only a marginal significance was noted in patients with moderate to severe disease. However, no significant differences in the frequency of mtDNA variants within each endometriosis subgroup were noted. We also conducted a subgroup analysis according to the degree of dysmenorrhea, but found no significant differences in the frequency of mtDNA polymorphisms between each of the endometriosis subgroups and the control group (data not shown).

Table 4.

Associations Between Mitochondrial DNA Polymorphisms and Susceptibility to Endometriosis According to Disease Severity

SNP	Stage I + II (N=37)	OR (95% CI) ^a	p-Value ^a	Stage III + IV (N=161)	OR (95% CI) ^a	p-Value ^a
10398 A/G	25 (67.6)	1.168 (0.548–2.492)	0.687	109 (67.7)	1.175 (0.744–1.857)	0.488
13708 G/A	1 (2.7)	0.900 (0.102–7.939)	0.924	8 (5.0)	1.694 (0.542–5.292)	0.359
16189 T/C	21 (56.8)	2.467 (1.196–5.089)	0.013	70 (43.5)	1.446 (0.926–2.257)	0.065
10398 G + 13708 A	0 (0.0)	—	—	2 (1.2)	0.988 (0.971–1.005)	0.149
13708 A + 16189 C	0 (0.0)	1.012 (0.995–1.029)	0.504	4 (2.5)	2.102 (0.380–11.638)	0.385
10398 G + 16189 C	14 (37.8)	3.156 (1.444–6.897)	0.003	39 (24.2)	1.658 (0.959–2.866)	0.069
10398 A + 16189 T	5 (13.5)	0.744 (0.267–2.070)	0.569	21 (13.0)	0.714 (0.388–1.312)	0.276

Versus control.

Data are expressed as n (%).

The accumulation of mtDNA mutations has been linked to the aging process and the association of BMI with endometriosis has been previously documented (Hediger et al., 2005; Sato et al., 2007; Yi et al., 2009; Stefanatos and Sanz, 2011). As there were significant differences in age and BMI between study groups, logistic regression analysis was performed. A multivariable logistic regression analysis showed that mtDNA nt16189 variant and the combination of mtDNA nt10398 and nt16189 variants were significantly associated with susceptibility to endometriosis even after adjusting for age and BMI (Table 5).

Table 5.

Multivariable Logistic Regression Analysis Model for Associations Between Mitochondrial DNA Variants and Susceptibility to Endometriosis

SNP	Adjusted odds ratio ^a (95% CI)	p-Value
16189 T/C	1.624 (1.038–2.541)	0.034
10398 G + 16189 C	1.846 (1.072–3.179)	0.027

Multivariate regression included age and BMI.

Discussion

In this study, we demonstrated that mtDNA nt16189 variant and the combination of mtDNA nt10398 and nt16189 variants are associated with an increased risk for endometriosis. To the best of our knowledge, this is the first study to date that has examined the association of mtDNA polymorphisms with endometriosis, and our results imply that mtDNA polymorphism may play an important role in the pathogenesis of endometriosis.

Although mitochondria perform multiple cellular functions including control of cell death, growth, and development and integration of signals from mitochondria to nucleus and nucleus to mitochondria, they are the major sources of energy and ROS production (Singh and Kulawiec, 2009). Although mitochondria are major sources of ROS in the cell, it is true that mitochondria are not the only major source of ROS production. However, as the mitochondrial genome is close to the site of ROS production, lacks histones and introns, and has much less efficient DNA repair mechanisms than nDNA, mtDNA is particularly susceptible to damage by ROS (Canter et al., 2005). In addition to somatic changes, mtDNA polymorphisms may have subtle effects on ROS production. However, it has been postulated that if the variants reduce efficacy of mitochondrial functioning, the accumulation of ROS may lead to cancer (Bai et al., 2007). Given the various roles of mitochondria in cellular functions, it is biologically plausible that mtDNA mutations affecting mitochondrial respiratory enzyme complexes may be involved in the pathogenesis of endometriosis by accumulation of ROS and dysfunctional mitochondria induced apoptosis.

In this study, we demonstrated that mtDNA nt16189 variant is associated with endometriosis. The mtDNA nt16189 variant has been shown to be associated with insulin resistance, metabolic syndrome, and susceptibility to type 2 diabetes (Poulton et al., 2002; Weng et al., 2005; Bhat et al., 2007). It is located in a cytosine run within the noncoding D-loop of mtDNA, close to sequences that are conserved across multiple species, which may be involved in the regulation of replication and transcription (Sbisa et al., 1997). Previous studies indicate that mtDNA nt16189 variant may impair the ability of a cell to properly respond to oxidative stress and oxidative damage (Lin et al., 2005a, 2005b). Because oxidative stress plays an important role in both immune response and inflammation, this finding may support a mechanism for the association of the nt16189 variant with susceptibility to endometriosis.

We also evaluated the association of the mtDNA nt10398 variant with susceptibility to endometriosis. The mtDNA nt10398 variation results in a nonconserved amino acid substitution of threonine (encoded by the A allele) with alanine (encoded by the G allele) within the NADH dehydrogenase 3 (ND3) subunit of Complex I. Complex I serves to dehydrogenate NADH and shuttle electrons to coenzyme Q, generating superoxide as a byproduct (Lenaz et al., 2006). There is also an increasing support for the association of the 10398 variation in the ND3 locus of mtDNA with increased rates of electron leakage and ROS production due to altered Complex I function (Ross et al., 2001; van der Walt et al., 2003). This polymorphism has been shown to be associated with type 2 diabetes, breast cancer, and secondary antiphospholipid syndrome in systemic lupus erythematosus patients (Canter et al., 2005; Bhat et al., 2007; Jonsen et al., 2009). Mechanisms of the adverse effects of the 10398 A allele in other diseases involving oxidative stress include less efficient functioning of Complex I in individuals whose mitochondria carry this allele and, alternatively, the reduced ability of cells in these individuals to constrain an oxidative challenge (van der Walt et al., 2003; Canter et al., 2005). Although our results showed no significant association between the nt10398 variant and endometriosis, the combination of the nt10398 and nt16189 variants displayed significant association with endometriosis. This finding may be explained by the fact that these two variants are closely related to ROS production and ROS clearance, which seem to be a pivotal event in the development of endometriosis. We assume that the accumulation of excessive oxidative stress caused by overproduction of ROS and the alteration of Complex I due to mitochondrial 10398 variation is further exacerbated by the diminished ability of the cell to properly respond to oxidative stress and oxidative damage due to mtDNA nt16189 variant. Thus, the combination of these variants may lead to susceptibility to endometriosis.

One interesting finding in this study is that these associations were more prominent in patients with minimal to mild disease than in patients with moderate to severe disease. Other studies have also associated genetic polymorphisms with minimal to mild endometriosis, suggesting that the genotypes associated with susceptibility to endometriosis may differ according to severity of disease (Baranova et al., 1999; Kim et al., 2005). The sample size in this study, however, is too small to draw such conclusions and therefore warrants a follow-up study using a larger number of patients in this specific disease population.

Limitations to our study include a relatively small sample size. Salanti et al. (2005) suggested that the most realistic OR between SNPs and a complex trait disease can be achieved with a sample size of at least 1000 subjects. Given that our sample size is smaller than the ideal sample size, meta-analysis with multiple studies is needed. Second, healthy women without pelvic pain or disease would have been an ideal comparison group to distinguish between endometriosis and normal patients. Choosing adequate control patients is a complex and often overlooked problem in endometriosis research. Although we only included patients surgically proven to be free of endometriosis, the majority of our control group had other benign diseases, which may have different effects on mtDNA polymorphisms. Further, correction for multiple comparisons has not been applied to the results in this hypothesis-generating study, increasing the possibility for chance findings.

In conclusion, this study demonstrated that mtDNA 16189 variant and the combination of mtDNA 16189 and 10398 variants are associated with increased risk of endometriosis. Although the mechanism underlying this association remains unclear, these findings can help to define the role of the mitochondrial genome in the pathogenesis of endometriosis. However, this is a preliminary study showing associations with several limitations. Therefore, follow-up studies with a large number of patients are warranted to confirm the possible association of mtDNA polymorphisms with susceptibility to endometriosis and to define their exact role in the pathogenesis of endometriosis.

Footnotes

Acknowledgments

This research was supported by Faculty Research Grant from Yonsei University, College of Medicine, Seoul, Korea (6-2011-0093).

Disclosure Statement

No potential conflicts of interest exist.

References

American Society for Reproductive Medicine. 1997. Revised American Society for Reproductive Medicine classification of endometriosis: 1996. Fertil Steril, 67:817–821.

Anderson

, Bankier

A.T.

, Barrell

B.G.

, de Bruijn

M.H.

, Coulson

A.R.

, Drouin

et al. 1981. Sequence and organization of the human mitochondrial genome. Nature, 290:457–465.

Augoulea

, Mastorakos

, Lambrinoudaki

, Christodoulakos

, Creatsas

2009. The role of the oxidative-stress in the endometriosis-related infertility. Gynecol Endocrinol, 25:75–81.

Bai

R.K.

, Leal

S.M.

, Covarrubias

, Liu

, Wong

L.J.

2007. Mitochondrial genetic background modifies breast cancer risk. Cancer Res, 67:4687–4694.

Baranova

, Canis

, Ivaschenko

, Albuisson

, Bothorishvilli

, Baranov

et al. 1999. Possible involvement of arylamine N-acetyltransferase 2, glutathione S-transferases M1 and T1 genes in the development of endometriosis. Mol Hum Reprod, 5:636–641.

Bhat

, Koul

, Sharma

, Rai

, Bukhari

S.I.

, Dhar

M.K.

et al. 2007. The possible role of 10398A and 16189C mtDNA variants in providing susceptibility to T2DM in two North Indian populations: a replicative study. Hum Genet, 120:821–826.

Canter

J.A.

, Kallianpur

A.R.

, Parl

F.F.

, Millikan

R.C.

2005. Mitochondrial DNA G10398A polymorphism and invasive breast cancer in African-American women. Cancer Res, 65:8028–8033.

Carew

J.S.

, Huang

2002. Mitochondrial defects in cancer. Mol Cancer, 1:9.

Crosignani

, Olive

, Bergqvist

, Luciano

2006. Advances in the management of endometriosis: an update for clinicians. Hum Reprod Update, 12:179–189.

10.

Gupta

, Agarwal

, Krajcir

, Alvarez

J.G.

2006. Role of oxidative stress in endometriosis. Reprod Biomed Online, 13:126–134.

11.

Hediger

M.L.

, Hartnett

H.J.

, Louis

G.M.

2005. Association of endometriosis with body size and figure. Fertil Steril, 84:1366–1374.

12.

Jonsen

, Yu

, Truedsson

, Nived

, Sturfelt

, Ibrahim

et al. 2009. Mitochondrial DNA polymorphisms are associated with susceptibility and phenotype of systemic lupus erythematosus. Lupus, 18:309–312.

13.

Kang

, Hamasaki

2005. Alterations of mitochondrial DNA in common diseases and disease states: aging, neurodegeneration, heart failure, diabetes, and cancer. Curr Med Chem, 12:429–441.

14.

Kao

S.H.

, Huang

H.C.

, Hsieh

R.H.

, Chen

S.C.

, Tsai

M.C.

, Tzeng

C.R.

2005. Oxidative damage and mitochondrial DNA mutations with endometriosis. Ann N Y Acad Sci, 1042:186–194.

15.

Kim

S.H.

, Choi

Y.M.

, Jun

J.K.

, Kim

J.G.

, Moon

S.Y.

2005. Estrogen receptor dinucleotide repeat polymorphism is associated with minimal or mild endometriosis. Fertil Steril, 84:774–777.

16.

Lenaz

, Fato

, Genova

M.L.

, Bergamini

, Bianchi

, Biondi

2006. Mitochondrial Complex I: structural and functional aspects. Biochim Biophys Acta, 1757:1406–1420.

17.

Lin

T.K.

, Chen

S.D.

, Wang

P.W.

, Wei

Y.H.

, Lee

C.F.

, Chen

T.L.

et al. 2005a. Increased oxidative damage with altered antioxidative status in type 2 diabetic patients harboring the 16189 T to C variant of mitochondrial DNA. Ann N Y Acad Sci, 1042:64–69.

18.

Lin

, Berg

A.H.

, Iyengar

, Lam

T.K.

, Giacca

, Combs

T.P.

et al. 2005b. The hyperglycemia-induced inflammatory response in adipocytes: the role of reactive oxygen species. J Biol Chem, 280:4617–4626.

19.

Mootha

V.K.

, Lindgren

C.M.

, Eriksson

K.F.

, Subramanian

, Sihag

, Lehar

et al. 2003. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet, 34:267–273.

20.

Poulton

, Luan

, Macaulay

, Hennings

, Mitchell

, Wareham

N.J.

2002. Type 2 diabetes is associated with a common mitochondrial variant: evidence from a population-based case-control study. Hum Mol Genet, 11:1581–1583.

21.

Rohan

T.E.

, Wong

L.J.

, Wang

, Haines

, Kabat

G.C.

2010. Do alterations in mitochondrial DNA play a role in breast carcinogenesis? J Oncol, 2010:604304.

22.

Ross

O.A.

, McCormack

, Curran

M.D.

, Duguid

R.A.

, Barnett

Y.A.

, Rea

I.M.

et al. 2001. Mitochondrial DNA polymorphism: its role in longevity of the Irish population. Exp Gerontol, 36:1161–1178.

23.

Salanti

, Sanderson

, Higgins

J.P.

2005. Obstacles and opportunities in meta-analysis of genetic association studies. Genet Med, 7:13–20.

24.

Sato

, Nakada

, Shitara

, Kasahara

, Yonekawa

, Hayashi

2007. Deletion-mutant mtDNA increases in somatic tissues but decreases in female germ cells with age. Genetics, 177:2031–2037.

25.

Sbisa

, Tanzariello

, Reyes

, Pesole

, Saccone

1997. Mammalian mitochondrial D-loop region structural analysis: identification of new conserved sequences and their functional and evolutionary implications. Gene, 205:125–140.

26.

Singh

K.K.

, Kulawiec

2009. Mitochondrial DNA polymorphism and risk of cancer. Methods Mol Biol, 471:291–303.

27.

Stefanatos

, Sanz

2011. Mitochondrial complex I: a central regulator of the aging process. Cell Cycle, 10:1528–1532.

28.

Suzuki

, Toyooka

, Miyajima

, Iizasa

, Fujisawa

, Bekele

N.B.

et al. 2003. Alterations in the mitochondrial displacement loop in lung cancers. Clin Cancer Res, 9:5636–5641.

29.

Taylor

R.W.

, Turnbull

D.M.

2005. Mitochondrial DNA mutations in human disease. Nat Rev Genet, 6:389–402.

30.

van der Walt

J.M.

, Nicodemus

K.K.

, Martin

E.R.

, Scott

W.K.

, Nance

M.A.

, Watts

R.L.

et al. 2003. Mitochondrial polymorphisms significantly reduce the risk of Parkinson disease. Am J Hum Genet, 72:804–811.

31.

Weng

S.W.

, Liou

C.W.

, Lin

T.K.

, Wei

Y.H.

, Lee

C.F.

, Eng

H.L.

et al. 2005. Association of mitochondrial deoxyribonucleic acid 16189 variant (T->C transition) with metabolic syndrome in Chinese adults. J Clin Endocrinol Metab, 90:5037–5040.

32.

K.W.

, Shin

J.H.

, Park

M.S.

, Kim

S.H.

, Hur

J.Y.

2009. Association of body mass index with severity of endometriosis in Korean women. Int J Gynaecol Obstet, 105:39–42.

33.

, Koczan

, Sulonen

A.M.

, Akkad

D.A.

, Kroner

, Comabella

et al. 2008. mtDNA nt13708A variant increases the risk of multiple sclerosis. PLoS One, 3:e1530.

34.

, Wieczorek

, Franke

, Yin

, Pierer

, Sina

et al. 2009. Association of UCP2-866 G/A polymorphism with chronic inflammatory diseases. Genes Immun, 10:601–605.