Identification of TDRP1 Gene and Its Association with Pig Reproduction Traits

Abstract

This study was performed to identify and characterize the pig TDRP1 gene and to investigate its association with reproduction traits. The obtained pig TDRP1 cDNA (713 base pair [bp]) comprises a 561-bp open reading frame, which encodes a peptide of 187 amino acids. The identities of pig TDRP1 cDNA were 84.6%, 75.7%, and 77.4% with its counterparts in human, rat, and mice, respectively. Real-time polymerase chain reaction indicated that pig TDRP1 gene was highly expressed in pituitary of male and uterus of female animals. The pig TDRP1 gene contains three exons and two introns. A total of 13 single-nucleotide polymorphisms (SNPs) and 1 indel were identified in the screened partial genomic sequence, with most polymorphisms in introns. Allelic frequencies of five SNPs among eight pig breeds were further investigated, and it indicated that Landrace had the lowest genetic diversity. In Yorkshire, three SNPs (c.215+144T>C, c.215+249A>G, and c.215+672T>C) exhibited complete linkage disequilibrium in one haplotype block, and association analyses showed that all of them were significantly associated with number born alive of first parity (NBA1) (p<0.05). c.215+672T>C was also significantly associated with NBA6 (p<0.05). In addition, these three SNPs and two other ones (c.215+1001G>A and c.215+1026C>T) were associated with total born alive of second parity (TBA2) and TBA6 at the suggestive level (0.05<p<0.1).

Introduction

S permatocytes are derived from somatic cells and activate the process of spermatogenesis. Schultz et al. (2003) indicated that only 4% of the mouse genome is dedicated to expression in postmeiotic male germ cells, most of which are probably retained in mature spermatozoa. Recently, a new gene encoding Testis Development-Related Protein (TDRP) that was cloned from a human testis cDNA library was shown to play an important role in spermatogenesis, and its expression was significantly lower in the testis tissues of azoospermic men compared with that of normal controls (Wang et al., 2010). Studies further indicated that TDRP1 gene knockout results in spermatogenesis dysfunction (Dix et al., 1996; Dickins et al., 2002; Brower et al., 2007).

The human TDRP gene, also named Chromosome 8 open reading frame 42 (C8orf42), is located at chromosome 8p23 and has two distinct transcripts. Transcript TDRP1 has three exons and a 549-base pair (bp) ORF, which encodes a 183 amino acid (aa) peptide. TDRP2, however, comprises four exons and a 594-bp ORF encoding a peptide of 198 aa. TDRP1 is related to spermatogenesis; however, the function of TDRP2 is not clear (Wang et al., 2010).

In mammals, spermatogenesis is a crucial factor for reproduction traits. Many male infertility cases have abnormal spermatogenesis (de Kretser, 1997; Skakkebaek et al., 2006; Poongothai et al., 2009). Therefore, the involvement of TDRP1 in spermatogenesis indicates that it is a candidate gene for reproduction traits in mammals. In pig, the TDRP1 gene has not been yet identified. The purposes of this study was to clone and characterize the pig TDRP1 gene and to investigate its genetic effect on reproduction traits by association analyses.

A total of 850 pigs (2 males and 848 females) from 11 pig populations were used in this study. These populations include eight Chinese local breeds of Xiang pig (XP; 1 male and 1 female), Lantang pig (5 females), Small-ear Spotted (SES) pigs (55 females), Zang pig (ZP; 50 females), Wujing (WJ) pig (50 females), Gaoligongshan (GLGS) pig (50 females), Baoshan (BS) pig (50 females), and Sakan (SK) pig (50 females) as well as three exotic breeds of Landrace (LR; 193 females), Yorkshire (YS; 1 male and 340 females), and Duroc (DR; 5 females). Either ear tissue or live tissues were collected from these pigs at 100 days age for the purpose of sequence cloning, variation, mRNA quantitative expression, and marker trait association analyses. The YS commercial population (334 females) was recorded for the first to sixth parity total number born and number born alive (NBA). All pigs were fed with commercial corn-soybean–based diets that met NRC requirements. All animals were randomly sampled from Guangdong Wens Foodstuff Corporation Ltd. and Yunnan Province, China.

The animal care and use protocol was approved by the Laboratorial Animal Care and Use Committee in Guangdong Province, China, and in accordance with Law of the People's Republic of China on Animal Protection.

A total of 11 primer pairs were used in this study (Table 1). According to the TDRP1 cDNA sequences predicted by us (Zhang et al., 2010), primer PM1 was designed to clone TDRP1gene. The PM2 pair was used to obtain the sequence of intron 2. PM3, PM4, and PM5 were used for cloning and identification of polymorphisms of TDRP1 gene. PM6 and PM7 pairs were used for quantitative real-time polymerase chain reaction (PCR) analyses of pig TDRP1 gene and β-actin, respectively. PM8 to PM11 were used for genotyping of four single-nucleotide polymorphisms (SNPs) by PCR–restriction fragment length polymorphism (RFLP) method. All primers were designed using GeneTool Lite software (www.BioTools.com/) and then synthesized by GeneRay Co. Ltd.

Table 1.

Primers Used in This Study

Gene	Primer	Nucleotides (5′→3′)	Annealing temperature (°C)	Product size (bp)	Purpose
TDRP1	PM1	FOR: CGCGTCCGGTCCTTGCA REV: TTTGGAAACACTTGGGAGCTG	63	713	cDNA cloning
	PM2	FOR: GTGCAGGGGGCGAGTTTCREV: TTTGGAAACACTTGGGAGCTG	63	1760	Amplification of intron 2
	PM3	FOR: GTGCAGGGGGCGAGTTTCREV: TCGCACAGGCTTATTCACAGA	63	993	Identification of variations
	PM4	FOR: AGGTCCCTCGGCAGCAATGREV: CCCTGAGTCGGCGGCTAC	63	840
	PM5	FOR: CGCGTCCGGTCCTTGCAGREV: GGCAGCGGGGGCAGCAG	62	211
	PM6	FOR: CGGGGTTGGAAAGAAGTGAREV: CGGGATGGACGGTCACTC	61	272	Determination of gene expression
β-Actin	PM7	FOR: TGCGGCATCCACGAAACTACREV: AGGGCCGTGATCTCCTTCTG	61	146
TDRP1	PM8	FOR: CGGGGTTGGAAAGAAGTGACTREV: GGGCAGGTCCTCGCACAC	63	894	PCR-RFLP
	PM9	FOR: TGACGACCTGATGGCACTGREV: GGCCCAGAGTAAGCAATCG	60	466
	PM10	FOR: GCGAGAAACCAACTTAGGAAATREV: GAACCTTTGATCACCACATTTAA	55	227

FOR and REV refer to forward and reverse primers, respectively.

RNA extraction and DNA preparation

Total RNA of XP (one male and one female) and YS (one male and one female) was extracted from the isolated tissues using an improved Trizol isolation method (Invitrogen) following the manufacturer's instructions. One microgram of total RNA was used to obtain cDNA by reverse transcription with Rever Tra Ace Transcriptase Kit (Toyobo) and random hexamers. Genomic DNA from all 846 female pigs was extracted from pig ears with typical phenol–chloroform method (Sambrook et al., 1989).

Cloning of pig TDRP1 cDNA

Using cDNA transcribed from testis as template, the whole coding sequences (CDS) of pig TDRP1 gene was amplified by Reverse Transcription (RT)-PCR with primer PM1. PCR was performed in 30 μL reaction mixtures containing 1 μL cDNA template, 0.3 μL PM1, 2.5 U ExTaq polymerase, 15 μL of 2X PCR Mix, and distilled water. PCR was run in a Mastercycler gradient (Eppendorf Limited) with the following procedure: 3 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 63°C, and 45 s at 72°C, and a final extension of 8 min at 72°C. PCR products were checked for size and quality on 1% agarose gels and then were purified using the Gel Extraction Kit (U-gene). Subsequently, PCR products were cloned into the pMD18-T Easy plasmid vector (Promega) and then sequenced by BGI-Shenzhen.

Real-time quantitative RT-PCR of TDRP1 gene

Real-time quantitative RT-PCR was used to evaluate TDRP1 gene expression in various pig tissues. The pig β-actin gene was used as an internal control to quantify mRNA level of TDRP1. The 20 μL mixture contained 1 μL cDNA template, 0.2 μL of 10 μM primers, 10 μL of 2X Q-PCR SYBR Green Mix (Toyobo), and 0.04 μL of 50X ROX reference. Real-time PCR was performed at 95°C for 3 min, followed by 40 cycles of 30 s at 95°C, 30 s at 61°C, and 40 s at 72°C in Mx 3005P (Agilent). Melting curve analyses were performed to confirm that a specific PCR band was produced. In addition, each PCR product was sequenced by BGI-Shenzhen for further validation.

In this study, each sample was repeated for three times. Quantitative values were obtained from the threshold PCR cycle number (Ct), at which the increase in signal was associated with an exponential growth for PCR product to be detected. The relative mRNA levels in each sample were normalized by β-actin. The relative expression levels of pig TDRP1 gene were indicated by 2^−ΔCt as described by Nie et al. (2009), for which ΔCt=Ct_target _gene – Ct_β-actin.

Analyses of TDRP1 peptide and prediction of the genomic structure of TDRP1

Bioinformatics analyses of pig TDRP1 peptide were performed to predict its structure and function (www.cbs.dtu.dk/services/NetNES/). The obtained TDRP1 cDNA was blasted to the released pig genome in pig BLAT search (http://mgc.ucsc.edu/cgi-bin/hgBlat), to predict the genomic structure of the pig TDRP1 gene. The previously unknown sequences of intron 2 were amplified by primer PM2 and they were helpful for predicting gene structure and identifying polymorphisms later.

SNP identification and genotyping by PCR-RFLP

PCR products of primers PM3 to PM5 were sequenced by BGI-Shenzhen to identify potential polymorphisms of pig the TDRP1 gene. Sequence BLAST was performed with the Seqman program of the DNASTAR software package (www.dnastar.com/). Only those variations that presented twice were regarded as SNPs. With the help of MapDraw program of DNASTAR software package, the enzymes Ssp I, Hpy 188I, Tsp 45I, and Bsm AI were determined for PCR-RFLP analyses. PCR products of PM8 to PM11 were digested with specific enzyme overnight at 37°C. The digestion mixture contained 8 μL PCR products, 1 μL of 10×digestion buffer, and 3.0 U of enzyme. The digested PCR products were electrophoresed on 2.5% agarose gel and visualized on a TFM-40 UV transilluminator.

Statistics

Allelic frequency

For the five genotyped SNPs, allelic frequencies within different populations were estimated using Microsatellite-Toolkit software (http://animalgenomics.ucd.ie/sdepark/ms-toolkit/). The Hardy–Weinberg equilibrium at each locus was assessed by simple χ ² test.

Linkage disequilibrium and haplotype analyses

The Haploview version 3.32 software (www.broad.mit.edu/mpg/haploview/) was used to estimate the linkage disequilibrium (LD) and infer haplotype block across five SNPs. Genotypes of 827 random samples for five SNPs were run in Haploview with default parameter. Only those loci that follow Hardy–Weinberg equilibrium are included in LD analyses. The extent of linkage between two loci was considered as LD (r ²≥0.33), strong LD (r ²≥0.6), and complete disequilibrium (r ²=1). The haplotype block was defined following the four-gamete test (Wang et al., 2002).

Marker–trait association analyses

Marker–trait association analyses was performed by the SAS 8.0 GLM procedure (Liu et al., 2011) and the genetic effects were analyzed using the following mixed model: \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland, xspace}\usepackage{amsmath, amsxtra}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6}\begin{document} \begin{align*} Y = \mu + G + P_i + e \end{align*} \end{document}

where Y is an observation on the trait, μ is the overall population mean, G is the fixed effect of genotype, P_i is the fixed effect of parity (i=1, 2, 3, 4, 5, and 6), and e is the residual random error. Multiple comparisons were analyzed with least squares means. The values were considered significant at p≤0.05 and presented as least squares means±standard error means.

Results

cDNA sequence of the pig TDRP1 gene

The obtained pig TDRP1 cDNA was 713 bp in length, which comprised 112 bp 5′ UTR, 561 bp ORF, and 40 bp 3′ UTR. The cDNA sequence was submitted to NCBI database and was assigned accession number HM590584. The encoded pig TDRP1 protein contains 187 aa (NCBI accession number of ADP24685). Bioinformatics analyses demonstrated that a leucine-rich nuclear export signal (NES) existed in the TDRP1 protein. The cDNA of pig TDRP1 gene has identities of 84.6%, 75.7%, and 77.4% with its counterparts in human, rat, and mice, respectively.

Expression of TDRP1 gene in pig tissues

Real-time quantitative PCR showed that the expression of the pig TDRP1 gene was found in several tissues in both females and males (Fig. 1). In females, higher mRNA levels were detected in brain tissues (cerebrum, cerebellum, hypothalamus, and pituitary) and reproduction system (ovary, oviduct, and uterus), whereas lower levels were found in other tissues. In males, the highest mRNA level was found in pituitary and then in other central tissues (cerebrum, cerebellum, and hypothalamus) and reproduction system (testis) (Fig. 1). When the YS and XP breeds were compared, a significant difference of TDRP1 mRNA was found in the ovary and oviduct of females (p<0.05) and in the hypothalamus, pituitary, and testis of males (p<0.05) (Fig. 1).

FIG. 1.

Relative mRNA levels of TDRP1 in different tissues of Yorkshire (YS) and Xiang pig (XP). Cer, cerebrum; Ceb, cerebellum; Hyp, hypothalamus; Pit, pituitary; Hea, heart; Liv, liver; Spl, spleen; Lun, lung; Kid, kidney; Abf, abdominal fat; Suf, subcutaneous fat of back; Fvim, forth vastus intermedius muscles; Bvim, back vastus intermedius muscles; Lom, longissimus muscle; Smi, small intestine; Lai, large intestine; Sto, stomach; Lym, lymphnode; Ova, ovary; Ovi, oviduct; Ute, uterus; Tes, testis; N, nondetectable.

Genomic characterization of pig TDRP1 gene

No significant match of pig TDRP1 cDNA with the released pig genome was found, probably because of genomic gaps. According to the structure of human TDRP1 gene, the pig TDRP1 gene might consist of three exons and two introns. The obtained intron 2 of pig TDRP1 gene was 1269 bp in length, which is similar to that of human. The splice junctions of intron 2 follow the GT/AG rule. We failed to obtain intron 1 of pig TDRP1 gene, probably because it is too long to be amplified. Iin humans, the TDRP1 gene contains a 40-kb intron 1.

Single-nucleotide polymorphisms

Based on sequencing profiles and BLAST analyses, polymorphisms were detected (Supplementary Fig. S1; Supplementary Data are available online at www.liebertonline.com/dna). As a result, 13 SNPs and 1 indel were identified in the 1982-bp region of the pig TDRP1 gene, giving rise to a SNP every 152 bp on average. The intron has higher variation rate than the exon. Three SNPs were found in the 5′UTR of exon 1, and the other 11 variations were all detected in intron 2. Eight of these SNPs could be recognized by specific restriction enzymes and, therefore, could be genotyped by PCR-RFLP method.

Allelic frequency and LD

Differences of allele frequencies were found among populations or loci (Table 2). LR has the lowest diversity compared with the rest seven populations. LD analyses showed different haplotype blocks among different populations (Supplementary Fig. S2). One main haplotype block was found in SES, ZP, WJ, and BS pigs, revealing no recombination between c.215+144T>C and c.215+249A>G (D′=1). A different block appeared in the YS pig, which showed the linkage across c.215+144T>C, c.215+249A>G, and c.215+672T>C in this population. In SK, no block was found, but there were two main blocks in GLGS pig. In LR, only one SNP followed Hardy–Weinberg equilibrium, and therefore, LD analyses were not performed.

Table 2.

Genotype and Allele Frequencies of Five Single-Nucleotide Polymorphisms in the Pig TDRP1 Gene Among Eight Populations

Site	Location	RFLP enzyme	Freq. (%)	SES (50)	ZP (50)	WJ (50)	GLGS (50)	BS (50)	SK (50)	LR (187)	YS (334)
c.215+144T>C	Intron 2		TC	66.67 (32)	42.86 (21)	44 (22)	58 (29)	28 (14)	48.98 (24)	0	52.11 (173)
			TT	20.83 (10)	40.82 (20)	50 (25)	30 (15)	60 (30)	42.86 (21)	100 (187)	28.61 (95)
			CC	12.5 (6)	16.32 (8)	6 (3)	12 (6)	12 (6)	8.16 (4)	0	19.28 (64)
			T	54.17	62.24	72	59	74	67.35	100^a	54.67
c.215+249A>G	Intron 2		AG	66.67 (32)	42.86 (21)	44 (22)	58 (29)	28 (14)	44.9 (22)	0	52.41 (174)
			GG	12.5 (6)	18.37 (9)	4 (2)	12 (6)	12 (6)	10.2 (5)	100 (187)	19.58 (65)
			AA	20.83 (10)	38.77 (19)	52 (26)	30 (15)	60 (30)	44.9 (22)	0	28.01 (93)
			G	45.84	39.8	26	41	26	32.65	100^a	45.79
c.215+672T>C	Intron 2	Hpy 188I	TC	16.33 (8)	22 (11)	58 (29)	54 (27)	30 (15)	18.37 (9)	0	53.59 (179)
			TT	83.67 (41)	78 (39)	16 (8)	46 (23)	68 (34)	81.63 (40)	0	22.46 (75)
			CC	0	0	26 (13)	0	2 (1)	0	100 (187)	23.95 (80)
			T	91.84	89	45	73	83	90.82	0^a	49.26
c.215+1001G>A	Intron 2	Tsp 45I	GA	2 (1)	2 (1)	63.83 (32)	51.06 (24)	0	19.57 (9)	0	51.95 (173)
			GG	98 (49)	98 (49)	10.64 (5)	48.94 (25)	100 (50)	80.43 (39)	0	22.52 (75)
			AA	0	0	25.53 (12)	0	0	0	100 (187)	25.53 (85)
			G	99	99	42.56	74.47	100^a	90.22	0^a	48.5
c.215+1026C>T	Intron 2	Bsm AI	CT	61.22 (30)	22.92 (11)	34.69 (17)	53.06 (26)	32.65 (16)	27.66 (13)	44 (72)	54.95 (183)
			TT	10.21 (5)	6.25 (3)	6.12 (3)	18.37 (9)	8.16 (4)	4.26 (2)	56 (115)	24.33 (81)
			CC	28.57 (14)	70.83 (34)	59.19 (29)	28.57 (14)	59.19 (29)	68.08 (32)	0	20.72 (69)
			T	40.82	17.71	23.47	44.9	24.49	18.09	72	51.81

Numbers in brackets indicate sample size for breed or genotype.

The breed does not follow Hardy–Weinberg equilibrium at the given locus (p<0.05).

RFLP, restriction fragment length polymorphism; Freq., frequency; SES, Small-ear Spotted; ZP, Zang pig; WJ, Wujing; GLGS, Gaoligongshan; BS, Baoshan; SK, Sakan; LR, Landrace; YS, Yorkshire; DR, Duroc.

Association of pig TDRP1 gene polymorphisms with reproduction traits

Association analyses showed that c.215+144T>C was significantly associated with number born alive of first parity (NBA1) (p<0.05) and suggestively associated with total number born of second parity (TBA2) and NBA6 (0.05<p<0.1). c.215+249A>G was significantly associated with NBA1 (p<0.05) and suggestively associated with total number born of second parity (TBA1) (0.05<p<0.1). c.215+672T>C was significantly associated with NBA1 and NBA6 (p<0.05) and suggestively associated with TBA2 (0.05<p<0.1). c.215+1001G>A was suggestively significantly associated with NBA1, TBA5, and NBA6, and suggestive associations of c.215+1026C>T with TBA2, NBA5, and TBA5 were also found by this study (0.05<p<0.1) (Table 3).

Table 3.

Association of Pig TDRP1 Gene Polymorphisms with Reproduction Traits

SNPs	Traits	p-Value	Least squares mean±stand error
c.215+144T>C	NBA1	0.0283	9.14±0.29 (CC/64)^ab	9.60±0.17 (CT/173)^A	8.79±0.28 (TT/95)^b
	TBA2	0.0920	11.17±0.36 (CC/64)^ab	11.65±0.20 (CT/173)^a	10.93±0.27 (TT/95)^b
	NBA6	0.0540	11.00±0.62 (CC/64)^a	10.45±0.26 (CT/173)^a	9.15±0.53 (TT/95)^b
c.215+249A>G	NBA1	0.0145	8.74±0.29 (AA/93)^A	9.62±0.17 (AG/174)^b	9.13±0.28 (GG/65)^ab
	TBA1	0.0969	10.64±0.28 (AA/93)^a	11.27±0.16 (AG/174)^b	10.78±0.33 (GG/65)^ab
c.215+672T>C	NBA1	0.0475	8.78±0.33 (CC/80)^a	9.60±0.16 (CT/179)^b	9.08±0.26 (TT/75)^ab
	TBA2	0.0578	11.15±0.29 (CC/80)^ab	11.67±0.20 (CT/179)^a	10.84±0.34 (TT/75)^b
	NBA6	0.0323	8.92±0.58 (CC/80)^a	10.53±0.27 (CT/179)^b	10.83±0.54 (TT/75)^b
c.215+1001G>A	NBA1	0.0911	8.77±0.30 (AA/85)^a	9.46±0.18 (AG/173)^b	9.38±0.27 (GG/75)^ab
	TBA5	0.0673	13.17±0.51 (AA/85)^a	11.94±0.32 (AG/173)^b	12.85±0.42 (GG/75)^ab
	NBA6	0.0875	9.09±0.61 (AA/85)^a	10.40±0.27 (AG/173)^b	10.76±0.53 (GG/75)^b
c.215+1026C>T	TBA2	0.0686	10.04±0.33 (CC/69)^ab	11.66±0.20 (CT/183)^a	10.91±0.32 (TT/81)^b
	NBA5	0.0904	10.41±0.41 (CC/69)^ab	10.15±0.30 (CT/183)^a	11.33±0.45 (TT/81)^b

The letters and numbers in parentheses indicate genotype and individuals. Values within a row with no common superscript letters differ significantly (p<0.05).

NBA1, 5, 6, number born alive of first, fifth, and sixth parity; TBA1, 2, 5, total number born of first, second, and fifth parity; SNP, single-nucleotide polymorphism.

Discussion

The pig TDRP1 gene sequence was first isolated by this study. The pig TDRP1 was predicted to be a 187-aa peptide with a molecular weight of 20.49 kDa, and have percent identities of 82.5%, 71.1%, and 72.5% with that of human, rat, and mice, respectively (Zhang et al., 2010). The obtained cDNA of pig TDRP1 gene has very high homology to other mammals, as it shares identities of 84.6%, 75.7%, and 77.4% with its counterparts in human, rat, and mice, respectively. Like human, a significant leucine-rich NES exists in the pig TDRP1 protein. NESs are extremely important for the subcellular location of proteins as it may affect the vitality of cells, and it is also related to the spermatogenesis and cell division (la Cour et al., 2004). This suggests that TDRP1 might function as a nuclear factor in spermatogenesis.

Only one transcript of the pig TDRP gene, TDRP1 rather than TDRP2, was found by this study. In human, both TDRP1 and TDRP2 were reported. Because of the gaps in pig genome, the exact genomic organization of the pig TDRP1 gene was uncertain; however, exon 2 and intron 2 are 104 and 1269 bp each, similar to human. The splice junctions of intron 2 of pig TDRP1 gene followed the GT/AG rule. According to the TDRP1 gene structure of human, the pig TDRP1 gene probably comprises three exons and two introns.

The high expression of pig TDRP1 in reproductive and nerve tissues suggested its potential functions in these systems. TDRP1 was found to be abundantly expressed in the nervous system (cerebellum, cerebrum, hypothalamus, and pituitary) and reproductive system (ovary, oviduct, uterus, and testis) and weakly expressed in other tissues except for small intestine. In males, the highest mRNA level was found in the pituitary. In rat, however, the TDRP gene only predominantly expresses in testis and weakly expressed in adipose tissue and kidney, but not in skeletal muscle, stomach, spleen, brain heart, small intestine, lung, ovary, and uterus (Wang et al., 2010). In human, two transcripts of TDRP (TDRP1 and TDRP2) were also detected in the testis, and their distribution in the other tissues was unclear (Wang et al., 2010). In both males and females, the pig TDRP1 gene highly expresses in the reproduction axis of hypothalamus–pituitary–gonad. However, some differences between male and female were found, that is, the TDRP1 mRNA level in male pituitary was higher than in female. In addition, TDRP1 expression in YS testis was significantly lower compared with Chinese local breed (XP) (p<0.5). The sperm density of XP is 2.60±0.29 billion/mL, which is higher than YS (2.41±0.17); and Rhe sperm motility of XP is 0.838±0.046, which is also higher than YS (0.803±0.036) (Bi and Miao, 2007). The relationship between lower TDRP1 expression in testis with lower sperm density requires further clarification.

In YS populations, three SNPs (c.215+144T>C, c.215+249A>G, and c.215+672T>C) were found in complete linkage, and they were all significantly associated with NBA1. Until now, the polymorphisms of TDRP1 gene and their associations with reproduction traits remain unclear in mammals. In this study, 13 SNPs and 1 indel were found in the 1982-bp region of the pig TDRP1 gene. Three SNPs were found in exon 1 and the other 11 variations were in intron 2. Five SNPs (c.215+144T>C, c.215+249A>G, c.215+672T>C, c.215+1001G>A, and c.215+1026C>T) were chosen to analyze the diversity among eight Chinese national pig breeds and two exotic breeds. The mean Hz in the commercial LR pigs was lower than Chinese local pigs, but YS pig has the highest mean Hz and follows Hardy–Weinberg equilibrium at five loci. By association analyses, we found that three SNPs (c.215+144T>C, c.215+249A>G, and c.215+672T>C) located in intron 2 were significantly associated with NBA1 (p<0.05). In addition, suggestive associations of these three SNP and two others (c.215+1001G>A and c.215+1026C>T) with some pig reproductions traits were also found (Table 3). It was interesting that these three SNPs were completely linked in the same haplotype block (Supplementary Fig. S2). Introns are noncoding region of a gene, and they might contain some cis-acting elements, which regulate gene transcription (Latchman, 1998). Some SNPs in the introns of other genes also showed significant associations with pig reproduction traits (Moe et al., 2009; Liu et al., 2011). The observed associations suggest potential genetic effects of pig TDRP1 on reproduction traits.

Conclusion

We identified and characterized the pig TDRP1 gene and found that it is differently expressed among various tissues and between male and female. A total of 13 SNPs and 1 indel were identified, and some polymorphisms were associated with pig reproduction traits.

Footnotes

Acknowledgments

This study was supported by the National Major Special Projects on New Varieties Cultivation for Transgenic Organisms (2008ZX08006-005 and 2009ZX08009-145B) and the Important Projects in Key Fields in Guangdong and Hongkong, 2008 (2008A02).

Disclosure Statement

No competing financial interests exist.

References

T.F.

, Miao

2007. Study on the reproductive characters of Xiang pig. Acta Ecol Anim Domast, 28:82–85(In Chinese).

Brower

J.V.

, Rodic

, Seki

, Jorgensen

, Fliess

, Yachnis

A.T.

, McCarrey

J.R.

, Oh

S.P.

, Terada

2007. Evolutionarily conserved mammalian adenine nucleotide translocase 4 is essential for spermatogenesis. J Biol Chem, 282:29658–29666.

de Kretser

D.M.

1997. Male infertility. Lancet, 349:787–790.

Dickins

R.A.

, Frew

I.J.

, House

C.M.

, O'Bryan

M.K.

, Holloway

A.J.

, Haviv

, Traficante

, de Kretser

D.M.

, Bowtell

D.D.

2002. The ubiquitin ligase component Siah1a is required for completion of meiosis I in male mice. Mol Cell Biol, 22:2294–2303.

Dix

D.J.

, Allen

J.W.

, Collins

B.W.

, Mori

, Nakamura

, Poorman-Allen

, Goulding

E.H.

, Eddy

E.M.

1996. Targeted gene disruption of Hsp70-2 results in failed meiosis, germ cell apoptosis, and male infertility. Proc Natl Acad Sci U S A, 93:3264–3268.

la Cour

, Kiemer

, Mølgaard

, Gupta

, Skriver

, Brunak

2004. Analysis and prediction of leucine-rich nuclear export signals. Protein Eng Des Sel, 17:527–536.

Latchman

D.S.

1998. Gene Regulation—A Eukaryotic Perspective, 3rd. Stanley Thornes Ltd.: United Kingdom, 345–310.

Liu

L.Q.

, Li

F.E.

, Deng

C.Y.

, Xiong

Y.Z.

2011. Molecular cloning, tissue expression and association of porcine NR4A1 gene with reproductive traits. Mol Biol Rep, 38:103–114.

Moe

, Lien

, Aasmundstad

, Meuwissen

T.H.

, Hansen

M.H.

, Bendixen

, Grindflek

2009. Association between SNPs within candidate genes and compounds related to boar taint and reproduction. BMC Genet, 10:32.

10.

Nie

, Fang

, Xie

, Shi

, Zhang

2009. cDNA cloning, characterization, and variation analysis of chicken adipose triglyceride lipase (ATGL) gene. Mol Cell Biochem, 320:67–74.

11.

Poongothai

, Gopenath

T.S.

, Manonayaki

2009. Genetics of human male infertility. Singapore Med J, 50:336–347.

12.

Sambrook

, Fritsch

E.F.

, Maniatis

1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York.

13.

Schultz

, Hamra

F.K.

, Garbers

D.L.

2003. A multitude of genes expressed solely in meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive targets. Proc Natl Acad Sci U S A, 100:12201–12206.

14.

Skakkebaek

N.E.

, Jørgensen

, Main

K.M.

, Rajpert-De , Meyts

, Leffers

, Andersson

A.M.

, Juul

, Carlsen

, Mortensen

G.K.

, Jensen

T.K.

, Toppari

2006. Is human fecundity declining? Int J Androl, 29:2–11.

15.

Wang

, Akey

J.M.

, Zhang

, Chakraborty

, Jin

2002. Distribution of recombination crossovers and the origin of haplotype blocks: the interplay of population history, recombination, and mutation. Am J Hum Genet, 71:1227–1234.

16.

Wang

, Jiang

, Zhou

, Zhang

, Yang

, Lu

, Wang

, Ding

, Hu

2010. Molecular cloning of a novel nuclear factor, TDRP1, in spermatogenic cells of testis and its relationship with spermatogenesis. Biochem Biophys Res Commun, 394:29–35.

17.

Zhang

, Fang

M.X.

, Nie

Q.H.

, Zhang

X.Q.

2010. Electronic cloning and bioinformatic analysis of the pig TDRP1 gene. J Hum Agric Univ, 6:672–677(In Chinese).

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.32 MB