Differing Effects of Azithromycin and Doxycycline on Cytokines in Cells from Chlamydia trachomatis

Abstract

Chlamydial infection of the lower genital tract usually spreads to the upper genital tract and is then responsible for more serious consequences, such as infertility, ectopic pregnancy, pelvic pain, and pelvic inflammatory disease. Genital infection with Chlamydia trachomatis and the resulting cytokine response largely determines the outcome of infection and disease. To date, studies showing comparative effects of azithromycin and doxycycline treatment for C. trachomatis infection in women with reproductive sequelae like infertility and their effect on immune molecules like cytokines are lacking. Hence, our objective was to study the effect of azithromycin and doxycycline in vitro on cytokines in cells from C. trachomatis–positive fertile and infertile women as well as their efficacy in C. trachomatis infection. Fertile and infertile women with primary and recurrent C. trachomatis infection attending the gynecology outpatient department of Safdarjung Hospital, New Delhi, India, were enrolled. Enzyme-linked immunosorbent assay and real-time reverse transcription–polymerase chain reaction was performed for evaluating cytokines in cells stimulated with chlamydial elementary bodies (EBs) in the presence and absence of antibiotics (azithromycin and doxycycline). C. trachomatis–infected women were also followed up to assess the efficacy of azithromycin and doxycycline. We observed inhibition of cytokines (interleukin [IL]-1beta (β), IL-6, IL-8, IL-10, and tumor necrosis factor-alpha) in the presence of azithromycin in EB-stimulated cells from both fertile and infertile women with primary and recurrent C. trachomatis infection. However, in presence of doxycycline, inhibition of cytokines (IL-1β and IL-6) was only observed in stimulated cells from fertile women with primary C. trachomatis infection. The clinical efficacy of azithromycin was also better than doxycycline in recurrent C. trachomatis infection in women with complications such as infertility. Overall, this study suggests that azithromycin treatment with broader immunomodulatory effects may be preferable to doxycycline for the treatment of recurrent C. trachomatis infection associated with infertility.

Introduction

C hlamydia trachomatis is a highly prevalent sexually transmitted disease (STD) (Gerbase et al., 1998) with potentially serious long-term consequences such as pelvic inflammatory disease (PID), tubal factor infertility, and ectopic pregnancy (Schachter, 1978).

The specific balance between pro-inflammatory and anti-inflammatory cytokines at the site of inflammation influences tissue damage (Debattista et al., 2003; Kinnunen et al., 2003; Stephens, 2003; Hafner et al., 2008; Srivastava et al., 2008; Darville and Hiltke, 2010). Chlamydial infections are usually treated with azithromycin or doxycycline. Although several studies have shown satisfactory results in acute infections (Ossewaarde et al., 1992; Thorpe et al., 1996; Sendag et al., 2000), in chronic infections, treatment is less satisfactory (Oriel, 1982). In a study by Tuffrey et al. (1994) single-dose oral azithromycin therapy was found to prevent infertility in a mouse model of chlamydial salpingitis. Similarly, azithromycin was found to be more effective than doxycycline in treating C. trachomatis infection and prevention of immunopathological upper reproductive tract damage in a macaque model of PID (Patton et al., 2005). In our previous study, we have shown that azithromycin provides anti-inflammatory effects by inhibiting cytokine production in cervical secretions from women infected with C. trachomatis (Srivastava et al., 2009). Previous studies suggest that azithromycin and doxycycline are equally efficacious in chlamydial cervical infection; however, human studies for their effect on the long-term sequelae of chlamydial infections are limited (Patton et al., 1994).

To date, studies showing the comparative efficacy of azithromycin and doxycycline for C. trachomatis infection in women with reproductive sequelae such as infertility and their effect on immune molecules such as cytokines are lacking. Therefore, our objective was to study the effect of azithromycin and doxycycline in vitro on cytokines in cells from C. trachomatis–positive fertile and infertile women as well as their comparative efficacy in C. trachomatis infection.

Materials and Methods

Study population

After obtaining informed written consent, 748 patients attending the gynecology outpatient department, Safdarjung Hospital, New Delhi, India, for gynecological complaints (cervical discharge, cervicitis, and infertility) were enrolled in the study. The study received approval from the ethics review committee of Safdarjung Hospital, New Delhi, India (Srivastava et al., 2009). At recruitment, a detailed clinical questionnaire was administered to each patient for collecting information on reasons for referral, gynecology history, including menstruation, symptoms of genital and urinary tract infection, and obstetric and medical histories. Patients with positive urine pregnancy test were excluded from the study.

Infertile women were identified as those that lack recognized conception after 1.5 to 2 years of regular intercourse without the use of contraception. The infertile group included women with referred diagnostic laparoscopy/hysterosalpingography (Reddy et al., 2004). Women with male factor-related infertility were excluded from the study.

Collection of Samples

The vulva was examined for lesions and vaginal/cervical discharge. The cervix was inspected for ulcers, warts, ectopy, erythema, discharge, or any other abnormalities. After cleaning the endocervix with a cotton swab (Hi Media), endocervical swabs were collected from patients for diagnosis of C. trachomatis and other STD pathogens. Another cotton swab was collected in sucrose phosphate glutamate (SPG) media (pH 7.0) for isolation and propagation of C. trachomatis.

A cytobrush was placed within the endocervical canal so that cells from the endocervical region and the zone between the endocervical and ectocervical regions (transformation zone) could be obtained. All cytobrush samples had negative results for blood contamination. The cytobrush was then held in a sterile centrifuge tube containing phosphate-buffered saline (PBS). Two milliliters of nonheparinized blood was collected for separating serum.

Culture of cervical mononuclear cells

Cervical mononuclear cells were isolated and counted as described earlier (Srivastava et al., 2008). The cells were washed three times with PBS and suspended in RPMI-1640 (Sigma-Aldrich) containing 5% fetal calf serum (FCS; PAA). Briefly, cells were cultured in round-bottomed 96-well plates (5×10⁴ cells/well) in a total volume of 200 μL and subsequently stimulated with inactivated C. trachomatis serovar D (a human clinical genital isolate) elementary bodies (EBs) at multiplicity of infection (MOI) 2 in the presence and absence of azithromycin (Sigma-Aldrich; 2 μg/mL) or doxycycline (Sigma-Aldrich; 5 μg/mL) and were incubated in humidified 5% CO₂ at 37°C for 72 h (for enzyme-linked immunosorbent assay [ELISA]) and 12 h (for real time reverse transcription-polymerase chain reaction [RT-PCR]). Time points for evaluating cytokines (72 h for ELISA and 12 h for RT-PCR) were found to be optimum as reported earlier (Agrawal et al., 2009; Gupta et al., 2009a, 2009b). Cell viability was examined after isolation of cervical mononuclear cells and at time points 12 h and 72 h using trypan blue staining to ensure that cells were viable during the experiment. Concentrations of the above mentioned antibiotics (azithromycin and doxycycline) were chosen as it has been reported that approximately the same concentrations are present at the site of infection (Whelton et al., 1980; Worm and Osterlind, 1995).

Laboratory diagnosis

Spots were made on glass slides from cervical swab samples. These were stained with fluorescein isothiocyanate (FITC)–conjugated monoclonal antibodies to C. trachomatis major outer membrane protein (MOMP) using MicroTrak C. trachomatis Direct Specimen Test kit according to the manufacturer's instructions. Cervical samples positive/negative by direct fluorescent assay (DFA) were further confirmed by doing PCR analysis as mentioned earlier (Srivastava et al. 2011). Diagnosis for other STD pathogens were done by culture for Neisseria gonorrhoeae, Mycoplasma hominis, Ureaplasma urealyticum, and by microscopy on gram-stained smears for Candida spp., bacterial vaginosis and Trichomonas vaginalis as mentioned earlier (Reddy et al., 2004).

Treatment

Patients found to have C. trachomatis infections were prescribed azithromycin (1 g single dose) or doxycycline (100 mg twice daily for 7 days). Patients with recurrent infection were followed up for 3 months (12 weeks) and checked for C. trachomatis infection each month and, if found positive, the treatment was repeated and the same dose of azithromycin (1 g single dose) or doxycycline (100 mg twice daily for 7 days) was given.

Antibody assay

Sera of patients were assayed for IgG antibodies to C. trachomatis by commercially available ELISA kit (Ridascreen), according to the manufacturer's instructions.

Minimum inhibitory concentration determination

Minimum inhibitory concentration (MIC) was determined by immunofluorescence assay and RT-PCR method. C. trachomatis isolates were propagated in human cervical epithelial adenocarcinoma cell line HeLa 229 cells as described previously (Bhengraj et al., 2010), purified, and stored at −80°C in SPG medium. Fresh monolayers of HeLa cells were prepared by seeding 2×10⁵ cells/well in 24-well tissue culture plate (Nunc) in Eagle's minimum essential medium (HiMedia) supplemented with 10% FCS, 2 mM L-glutamine (Sigma-Aldrich), HEPES buffer (SRL), and 25 mM sodium bicarbonate (Sigma-Aldrich). Before infection, the cell monolayers were washed once with PBS (pH 7.0) and treated with 30 μg/mL DEAE-dextran (Sigma-Aldrich) and incubated at 35°C for 30 min. Chlamydial inoculum was added on to the cell monolayers at an MOI of 1 and incubated for 1h at 35°C. Cells were centrifuged at room temperature for 30 min at 1000 rpm and incubated at 35°C for 2 h. After incubation, inoculum was replaced with twofold serially diluted doxycycline prepared in Dulbecco's modified Eagle's medium (Sigma-Aldrich) supplemented with 5% FCS, and 1 μg/mL cycloheximide (Sigma-Aldrich) and incubated for 48 h in a humidified incubator at 35°C with 5% CO₂. As control, infected cells were incubated in the absence of doxycycline.

Immunofluorescence assay

C. trachomatis inclusion bodies were detected by immunofluorescence assay after staining with FITC-labeled monoclonal antibody against C. trachomatis MOMP. The MICs were determined by counting the number of inclusions, the MIC being the lowest concentration of antibiotic with no inclusions visible.

Reverse transcription-polymerase chain reaction

Total RNA was isolated using Trizol reagent (Invitrogen) according to the manufacturer's instructions. Complementary DNA (cDNA) was prepared using a SuperScript™ First-Strand Reverse Transcriptase kit (Invitrogen), in accordance with the manufacturer's instructions. Amplification of cDNA was carried out using the primer sequences of 16S rRNA gene (5′CTGCAGCCTCCGTAGAGTCTGGGCAGTGTC 3′ and 5′TTCAGATTGAACGCTGGCGGCGTGGATG 3′) as described earlier (Bhengraj et al., 2008). The PCR product was visualized by electrophoresis on a 2% agarose gel stained with ethidium bromide. The lowest concentration of antibiotic which inhibited the appearance of a PCR product determined the MIC.

Quantification of cytokines

Interleukin (IL)-1beta (1β), IL-2, IL-4, IL-6, IL-8, IL-10, IL-13, interferon-gamma (IFN-γ), and tumor necrosis factor-alpha (TNF-α) were quantified by commercially available ELISA kits (eBiosciences) in accordance with the manufacturer's instructions.

RNA extraction and real-time RT-PCR analysis for cytokines

Total RNA was isolated using RNeasy Mini Kit (Qiagen) in accordance with the manufacturer's instructions and stored at −80°C. cDNA was prepared using a SuperScript First-Strand Reverse Transcriptase kit (Invitrogen) in accordance with the manufacturer's instructions. Real-time PCR was performed with the DyNAmo™ SYBR^® Green qPCR Kit (Finnzymes). Sequences for endogenous control (β-actin) and cytokine genes (IL-1β, IL-2, IL-4, IL-6, IL-10, IFN-γ, and TNF-α) used in this study were same as reported earlier by Jasper et al. (2006). Sequences for IL-8 primers were as mentioned by Hara et al. (2009). All primers were of HPLC-purified grade and were commercially synthesized (MWG-Biotech AG). The negative control included in each reaction consisted of nuclease-free water substituted for cDNA. PCR amplification was performed in an Applied Biosystems 7000 Real-Time PCR System (Applied Biosystems). For data analysis, the 2^−ΔΔCt method was used to calculate fold change (Livak and Schmittgen, 2001).

Statistical analysis

Differences between two groups were evaluated using Mann–Whitney U test. p<0.05 was considered significant.

Results

Study population

Cervical C. trachomatis infection was diagnosed by DFA/polymerase chain reaction in 260 patients. Fifty-eight of these were excluded from the study as they were found to be co-infected with either bacterial vaginosis, Candida spp., T. vaginalis, M. hominis, U. urealyticum, or Neisseria gonorrhea in the cervix or had previous history of these infections.

Based on clinical history and diagnosis, the patients were categorized into following groups: Group A comprised of women with primary C. trachomatis infection (n=144) without any records for previous history of chlamydial infections and were also found to be negative for IgG antibodies against C. trachomatis in serum. Group B comprised women having recurrent C. trachomatis infection (n=58) and being tested positive for infection for ≥2 times within a period of ≥3 months after appropriate antibiotic treatment. Further, they were found to be positive for IgG antibodies against C. trachomatis in serum (Agrawal et al., 2007a, 2007b), confirming previous C. trachomatis infection. The median ages of women with primary and recurrent infections were comparable (28 and 30 years, respectively).

Primary and recurrent infection

Group A was further divided into two groups: Group I (n=85) comprised of fertile women and Group II (n=59) comprised of infertile women.

Group B was divided into two groups: Group III (n=20) comprised of fertile women and Group IV (n=38) comprised of infertile women.

Groups I, II, III, and IV were further divided on the basis of antibiotics (azithromycin and doxycycline) given: Group IA comprised C. trachomatis–positive fertile patients who were given azithromycin; Group IB comprised C. trachomatis–positive fertile patients who were given doxycycline. Group IIA comprised C. trachomatis–positive infertile patients who were given azithromycin; Group IIB comprised C. trachomatis–positive infertile patients who were given doxycycline. Group IIIA comprised C. trachomatis–positive fertile patients who were given azithromycin; Group IIIB comprised C. trachomatis–positive fertile patients who were given doxycycline. Group IVA comprised C. trachomatis–positive infertile patients who were given azithromycin; Group IVB comprised C. trachomatis–positive infertile patients who were given doxycycline.

Efficacy of Azithromycin and Doxycycline for C. trachomatis infection in women

Out of 202 C. trachomatis–positive patients, 19 were excluded because other antibiotics were also prescribed to them. Thirty-six patients were lost to follow-up and 12 patients were excluded as the compliance for doxycycline was not 100%. Further, six patients were not included as their partners denied to participate in the study.

In Group A the treatment efficacies for both the antibiotics were similar:

Azithromycin: In Group IA (n=21), 20 were found negative for C. trachomatis after treatment (Table 1). In Group IIA (n=19), 18 were found negative for C. trachomatis after treatment (Table 1).

Table 1.

Clinical Efficacy of Azithromycin and Doxycycline in Women with Primary Infection

		Group IA (n=21)	Group IIA (n=19)
Azithromycin	CT negative after 4 weeks	20	18
	CT positive after 4 weeks	1	1

		Group IB (n=27)	Group IIB (n=27)
Doxycycline	CT negative after 4 weeks	26	25
	CT positive after 4 weeks	1	2

Group I comprised C. trachomatis–positive fertile women; Group II comprised C. trachomatis–positive infertile women; CT represents Chlamydia trachomatis.

Doxycycline: In Group IB (n=27), 26 were found negative for C. trachomatis after treatment (Table 1). In Group IIB (n=27), 25 were found negative for C. trachomatis after treatment (Table 1).

In Group B the treatment efficacies for both the antibiotics were found to be different:

Azithromycin: In Group IIIA (n=7), four were found negative for C. trachomatis after 4 weeks of treatment and three were found negative for C. trachomatis after 8 weeks of treatment (Table 2). In Group IVA (n=12), five were found negative for C. trachomatis after 8 weeks of treatment and seven were found negative for C. trachomatis after 12 weeks of treatment (Table 2).

Table 2.

Clinical Efficacy of Azithromycin and Doxycycline in Women with Recurrent Infection

		Group IIIA (n=7)	Group IVA (n=12)
Azithromycin	CT negative after 4 weeks	4	0
	CT negative after 8 weeks	3	5
	CT negative after 12 weeks	0	7
	CT positive after 12 weeks	0	0

		Group IIIB (n=6)	Group IVB (n=10)
Doxycycline	CT negative after 4 weeks	1	0
	CT negative after 8 weeks	2	0
	CT negative after 12 weeks	3	2
	CT positive after 12 weeks	0	8

Group III comprised C. trachomatis–positive fertile women; Group IV comprised C. trachomatis–positive infertile women.

Doxycycline: In Group IIIB (n=6), one was found negative for C. trachomatis after 4 weeks of treatment, two were found negative for C. trachomatis after 8 weeks of treatment, and three were found negative for C. trachomatis after 12 weeks of treatment (Table 2). In Group IVB (n=10), only two were found negative for C. trachomatis after 12 weeks of treatment (Table 2).

Further, we also evaluated the MIC for the isolates from C. trachomatis–positive women (Group IV) with treatment failure (after 12 weeks of continuous doxycycline treatment) and found all were susceptible to doxycycline in vitro. The results of in vitro susceptibility testing against representative isolates are summarized in Table 3.

Table 3.

In Vitro Susceptibilities to Doxycycline for Clinical Isolates of Chlamydia trachomatis in Patients (Group IV) with Treatment Failure (12 Weeks of Continuous Doxycycline Treatment) as Determined by Immunofluorescence and Reverse Transcription–Polymerase Chain Reaction

	MIC (μg/mL)
Isolates	IF	RT-PCR
CT 492	0.03	0.06
CT 502	0.06	0.12
CT 548	0.06	0.06
CT 552	0.03	0.12
CT 560	0.12	0.24
CT 569	0.06	0.06
CT 590	0.03	0.06
CT 644	0.06	0.24

Group IV comprised C. trachomatis–positive infertile women.

MIC, minimum inhibitory concentration; IF, immunofluorescence; RT-PCR, reverse transcription–polymerase chain reaction.

Quantification of cytokines by ELISA

Out of 202 C. trachomatis–positive patients, 75 were excluded, as either the count of mononuclear cells in the cervical cells was too low or epithelial cells were present.

Group A, comprising women with primary infection, was divided into Group I (n=52; comprising C. trachomatis–positive fertile women) and Group II (n=44; comprising C. trachomatis–positive infertile women). Group B, comprising women with recurrent infection, was divided into Group III (n=17; comprising C. trachomatis–positive fertile women) and Group IV (n=14; comprising C. trachomatis–positive infertile women).

A significant decrease in the IL-1β, IL-6, IL-8, and TNF-α was observed in Group I and Group II in the presence of azithromycin in C. trachomatis–stimulated cells (Table 4). In the presence of doxycycline, a significant decrease in the levels of IL-1β and IL-6 was observed in Group I, whereas a decrease in the levels of IL-1β and IL-6 was also observed in Group II but it was not significant (Table 4). There was no detectable IL-4 level in any culture supernatant (data not shown).

Table 4.

Secreted Cytokines Concentration After Chlamydia trachomatis Elementary Bodies Stimulation in the Presence and Absence of Azithromycin and Doxycycline in Cells Obtained from Women with Primary Infection

	Group I (n=52)					Group II (n=44)
	CT	CT+Azithromycin	p-value ^a	CT+Doxycycline	p-value ^b	CT	CT+Azithromycin	p-value ^c	CT+Doxycycline	p-value ^d
IL-1β (pg/mL)	143 (22–490)	76 (15–396)	0.002^e	73 (32–365)	0.01^e	240 (52–657)	120 (25–381)	0.006^e	175 (25–606)	0.1
IL-2 (pg/mL)	5 (0–38)	5 (0–26)	0.6	6 (0–37)	0.4	6 (0–42)	5 (0–36)	0.9	5 (0–20)	0.8
IL-6 (pg/mL)	77 (42–688)	48 (7–354)	0.002^e	53 (20–428)	0.007^e	217 (20–537)	114 (15–374)	0.001^e	172 (22–383)	0.08
IL-8 (pg/mL)	193 (78–717)	63 (8–258)	<0.0001^e	180 (30–584)	0.1	255 (110–966)	117 (30–448)	<0.0001^e	244 (57–627)	0.1
IL-10 (pg/mL)	138 (24–692)	101 (23–512)	0.2	136 (28–448)	0.5	246 (48–819)	197 (37–739)	0.09	219 (56–654)	0.5
IL-13 (pg/mL)	5 (0–28)	6 (0–20)	0.9	6 (0–33)	0.9	7 (0–24)	5 (0–18)	0.2	6 (0–40)	0.9
IFN-γ (pg/mL)	144 (21–611)	91 (14–488)	0.07	115 (11–437)	0.2	88 (20–574)	61 (22–524)	0.3	73 (15–446)	0.4
TNF-α (pg/mL)	185 (27–582)	94 (30–439)	0.01^e	127 (12–522)	0.08	115 (18–389)	76 (15–277)	0.01^e	87 (21–392)	0.2

Group I comprised C. trachomatis–positive fertile women; Group II comprised C. trachomatis–positive infertile women; cytokine concentration is denoted by median and range in parenthesis.

Significance level between CT+Azithromycin and CT in Group I.

Significance level between CT+Doxycycline and CT in Group I.

Significance level between CT+Azithromycin and CT in Group II.

Significance level between CT+Doxycycline and CT in Group II.

Significance level.

IL, interleukin; IFN, interferon; TNF-α, tumor necrosis factor-alpha.

A significant decrease in the levels of IL-1β, IL-6, IL-8, IL-10, and TNF-α was observed in Group III and Group IV in the presence of azithromycin in C. trachomatis–stimulated cells (Table 5). In the presence of doxycycline no significant decrease in the levels of cytokines was observed in either group (Table 5). There was no detectable IL-4 level in any culture supernatant (data not shown).

Table 5.

	Group III (n=17)					Group IV (n=14)
	CT	CT+azithromycin	p-value ^a	CT+Doxycycline	p-value ^b	CT	CT+azithromycin	p-value ^c	CT+Doxycycline	p-value ^d
IL-1β (pg/mL)	177 (15–544)	74 (20–385)	0.03^e	162 (28–414)	0.7	389 (36–1240)	189 (14–422)	0.02^e	259 (28–440)	0.1
IL-2 (pg/mL)	4 (0–16)	6 (0–30)	0.5	6 (0–16)	0.2	5 (0–12)	5 (0–13)	0.6	6 (0–32)	0.6
IL-6 (pg/mL)	260 (37–377)	107 (14–361)	0.04^e	190 (19–443)	0.5	538 (116–865)	233 (33–454)	0.01^e	371 (32–676)	0.1
IL-8 (pg/mL)	218 (34–614)	90 (29–487)	0.04^e	163 (30–625)	0.7	666 (150–1195)	339 (55–552)	0.001^e	525 (50–882)	0.2
IL-10 (pg/mL)	240 (60–864)	100 (24–550)	0.04^e	227 (54–537)	0.8	751 (74–1680)	319 (25–570)	0.01^e	613 (80–1180)	0.3
IL-13 (pg/mL)	6 (0–16)	6 (0–18)	0.9	6 (0–14)	0.9	7 (0–30)	5 (0–16)	0.5	8 (0–20)	0.5
IFN-γ (pg/mL)	217 (30–785)	160 (17–490)	0.2	162 (25–564)	0.4	167 (42–644)	91 (22–300)	0.1	131 (23–392)	0.7
TNF-α (pg/mL)	316 (20–655)	88 (16–475)	0.009^e	254 (20–477)	0.2	214 (36–560)	76 (36–315)	0.04^e	184 (26–455)	0.6

Group III comprised C. trachomatis–positive fertile women; Group IV comprised C. trachomatis–positive infertile women; cytokine concentration is denoted by median and range in parenthesis.

Significance level between CT+Azithromycin and CT in Group III.

Significance level between CT+Doxycycline and CT in Group III.

Significance level between CT+Azithromycin and CT in Group IV.

Significance level between CT+Doxycycline and CT in Group IV.

Significance level.

Cytokine mRNA expression levels

mRNA expression levels for IL-1β, IL-2, IL-4, IL-6, IL-8, IL-10, IFN-γ, and TNF-α were detected in C. trachomatis–stimulated cervical cells in the presence and absence of antibiotics.

In Group A, a significant decrease in mRNA expression levels of IL-1β, IL-6, IL-8, IL-10, and TNF-α was observed in Group I and Group II in the presence of azithromycin, whereas only decrease in IL-1β and IL-6 mRNA expression levels was observed in Group I and none in Group II in the presence of doxycycline (Fig. 1).

FIG. 1.

Estimation of mRNA expression of cytokines upon Chlamydia trachomatis EBs stimulation in the presence and absence of azithromycin and doxycycline in cervical cells obtained from women with primary infection. Real-time RT-PCR analysis of mRNA levels was done, where Group I comprised of C. trachomatis–positive fertile women and Group II comprised of C. trachomatis–positive infertile women. “a” represents C. trachomatis EB's; “b” represents C. trachomatis EB's+azithromycin; “c” represents C. trachomatis EB's+doxycycline. All cytokines were normalized against corresponding levels of endogenous β-actin. The graph show results as fold change represented by bars. Bars represent mean±SEM for all experiments. * represents p<0.05 as compared to “a” in Group I. ♦ represents p<0.05 as compared to “a” in Group II. EB, elementary body; RT-PCR, reverse transcription-polymerase chain reaction.

In Group B, a significant decrease in mRNA expression levels of IL-1β, IL-6, IL-8, IL-10, and TNF-α was observed in Group III and Group IV in presence of azithromycin, whereas no decrease in mRNA expression levels was observed in both Group III and Group IV in the presence of doxycycline (Fig. 2).

FIG. 2.

Estimation of mRNA expression of cytokines upon C. trachomatis EBs stimulation in the presence and absence of azithromycin and doxycycline in cervical cells obtained from women with recurrent infection. Real-time RT-PCR analysis of mRNA levels was done, where Group III comprised of C. trachomatis–positive fertile women and Group IV comprised of C. trachomatis–positive infertile women. “a” represents C. trachomatis EB's; “b” represents C. trachomatis EB's+azithromycin; “c” represents C. trachomatis EB's+doxycycline. All cytokines were normalized against corresponding levels of endogenous β-actin. The graph show results as fold change represented by bars. Bars represent mean±SEM for all experiments. * represents p<0.05 as compared to “a” in Group III. ♦ represents p<0.05 as compared to “a” in Group IV.

Discussion

Epidemiological and animal model studies suggest that sequelae of genital chlamydial infection are more associated with second or subsequent infections than to initial infection (Beatty et al., 1994; Hillis et al., 1997; Van Voorhis et al., 1997). In our study, we have observed that continuous treatment of azithromycin for 2–3 months in infertile women with recurrent infection is better for the treatment of C. trachomatis infection, whereas no such effect was observed with doxycycline treatment. Tuffrey et al. (1994) had suggested that in the mouse model of chlamydial salpingitis, azithromycin treatment prevents chlamydial-induced infertility by reducing ultrastructural damage to the epithelium of the oviduct lumen. Further, Patton et al. (2005) had shown azithromycin to be more effective than doxycycline in treating C. trachomatis infection and the prevention of immunopathological upper reproductive tract damage in a macaque model of PID. In an in vitro study Reveneau et al. had suggested that azithromycin would be efficacious against persistent chlamydial infection. In contrast, doxycycline may not be as effective in treating persistent infection (Reveneau et al., 2005). Katz et al. (1991) had compared treatment for 7 days of tetracycline (500 mg) four times daily with a 21-day regimen in C. trachomatis–infected patients and suggested that a longer regimen may not be more efficacious. We further evaluated the MIC values for the isolates obtained from doxycycline treatment failure cases and found all eight isolates were susceptible to doxycycline. Dean et al. (2000) also reported that isolates from persistently infected women were susceptible to antibiotics in vitro but were not treated clinically. This suggests that doxycycline was not effective in vivo for recurrent C. trachomatis infection in chronic condition such as infertility. Overall, it suggests that azithromycin treatment may be more efficacious as compared to doxycycline for recurrent C. trachomatis infection in women with complications such as infertility.

In the present study we have also observed that azithromycin inhibits cytokines (IL-1β, IL-6, IL-8, IL-10, and TNF-α) in EB-stimulated cells obtained from both fertile and infertile women having primary or recurrent C. trachomatis infection. However, in the presence of doxycycline inhibition of cytokines (IL-1β and IL-6) were only observed in stimulated cells from fertile women with primary C. trachomatis infection. Genital infection with C. trachomatis and the resulting cytokine environment largely determines the outcome of infection and disease (Stephens, 2003). IL-1 has been suggested to act as the initiator of fallopian tube destruction during C. trachomatis infection (Hvid et al., 2007). Previous study suggests that IL-6 levels were increased in silent tubal C. trachomatis infections (Li and Liang, 2000). Elevated IL-6 production has been reported in the fallopian tubes of macaques after repeated infection with C. trachomatis (Van Voorhis et al., 1997). Bianchi et al. (1997) had shown increased level of IL-8 after C. trachomatis infection in U937 cells and suggested that IL-8 may play an important role in the inflammatory reaction to chlamydial infection. Others also reported elevated levels of IL-8 during C. trachomatis infection (Rasmussen et al., 1997; Buchholz and Stephens, 2006). IL-10 has been shown to be unfavorable for the protective immunity and control of Chlamydia infection (Yang et al., 1999). In addition, the production of IL-10 has been associated with severe pathological conditions in C. trachomatis infection (Reddy et al., 2004; Srivastava et al., 2008). Darville et al. had shown that in the mouse genital tract, infertility associated with endometriosis has been shown to be related to the production of TNF-α (Darville et al., 2000). TNF-α was found to be produced in response to chlamydial infection by the human fallopian tube (Ault et al., 1996). Gervassi et al. (2004) had shown that C. trachomatis infection in dendritic cells upregulates IL-1β, IL-6, IL-8, and TNF-α. Further, it has been shown that an elevated level of IL-1β, IL-6, IL-10, and IL-8 by C. trachomatis in cervical cells is associated with pathological conditions like fertility disorder (Agrawal et al., 2009). Macrolide antibiotics are used in the treatment of infections caused by many different pathogens. There is evidence that macrolides can affect the host response to infection by mechanisms that are unrelated to their antimicrobial properties (Labro, 1998; Giamarellos-Bourboulis, 2008; Shinkai et al., 2008; Ribeiro et al., 2009). Macrolides have been shown to inhibit the production of pro-inflammatory cytokines, such as IL-6, IL-8, and TNF-α, by cultured human bronchial epithelial cells (Khair et al., 1995; Kawasaki et al., 1998) and in whole blood (Schultz et al., 1998). Azithromycin has been demonstrated to affect to various degrees production of IL-1β, IL-6, IL-10, and TNF-α by human monocytes (Khan et al., 1999). We recently reported that azithromycin treatment inhibits inflammatory cytokines and chemokines in epithelial cells from infertile women with recurrent C. trachomatis infection (Srivastava et al., 2011). Suzuki et al. showed that pretreating cultured human nasal epithelial cells with macrolides inhibits IL-8 secretion. They observed that the inhibitory effect of IL-8 secretion was more effective against lipopolysaccharide (LPS)-induced secretion than against constitutive secretion; this suggests that macrolides suppress excessive production of IL-8 (Suzuki et al., 1997). Similar findings showing inhibition of cytokines by azithromycin treatment have been reported by others for other cells types (Ikegaya et al., 2009; Meyer et al., 2009).

Tetracyclines have also been shown to have other biological actions independent of their antimicrobial effects (Golub et al., 1998; Griffin et al., 2011). Tetracyclines modulate cytokine secretion by Porphyromonas gingivalis LPS-stimulated whole blood (Cazalis et al., 2009). In addition, doxycycline was shown to inhibit the production of IL-1β in LPS-treated corneal epithelial cultures (Solomon et al., 2000). Doxycycline reduces LPS-induced inflammatory mediator secretion, including IL-1β and IL-6 in macrophage and ex vivo human whole blood models (Cazalis et al., 2008). Doxycycline also suppresses IL-6 during C. trachomatis infection (Ikeda-Dantsuji et al., 2007). Similarly, we have also observed that azithromycin and doxycycline inhibit cytokine production and expression. Cytokines are known targets of macrolides and, in our study, azithromycin inhibits TNF-α, IL-8, IL-1β, IL-6, and IL-10 (all associated with Chlamydia-induced pathological conditions). In the presence of doxycycline, we found that IL-1β and IL-6 (secretion and expression) were decreased only in cells stimulated with EBs from fertile women with primary infection. Hence, in pathological conditions such as infertility or recurrent infection, where exaggerated inflammatory responses have been reported, the ability of azithromycin to inhibit cytokine production may make it a better therapeutic choice compared to doxycycline. Our study indicates that azithromycin possess immunomodulatory activity and inhibits cytokines and thus control inflammatory mediators induced by C. trachomatis at the site of infection.

The intent of the study provides some perspective on the treatment of chlamydial infection in chronic condition such as infertility. This study suggests that azithromycin treatment with broader immunomodulatory effects may be preferable to doxycycline for the treatment of recurrent C. trachomatis infection associated with infertility. However, as a limitation of the study we would like to mention that long term follow-up studies are required to evaluate if azithromycin with its antibacterial property as well as its immunomodulatory property of inhibiting cytokines (associated with pathological condition) will help in cure of infertility (i.e., leading to pregnancy) in C. trachomatis–infected women. Our findings could have important implications in the management of human chlamydial infections.

Footnotes

Acknowledgments

We thank Mrs. Madhu Badhwar, Mrs. Asha Rani, and Mrs. Rosamma Thomas for providing technical assistance. This study was supported by a grant from the Indian Council of Medical Research, India. We also acknowledge the Indian Council of Medical Research for providing financial assistance to Pragya Srivastava, Hem Chandra Jha, Harsh Vardhan, and Rajneesh Jha in the form of a research fellowship. University Grants Commission, India, is acknowledged for providing research fellowship to Apurb Rashmi Bhengraj.

Disclosure Statement

No competing financial interests exist.

References

Agrawal

, Gupta

, Dutta

, Srivastava

, Bhengraj

A.R.

, Salhan

, Mittal

2009. Protective or pathogenic immune response to genital chlamydial infection in women—a possible role of cytokine secretion profile of cervical mucosal cells. Clin Immunol, 130:347–354.

Agrawal

, Vats

, Salhan

, Mittal

2007a. Mucosal and peripheral immune responses to chlamydial heat shock proteins in women infected with Chlamydia trachomatis. Clin Exp Immunol, 148:461–468.

Agrawal

, Vats

, Wallace

P.K.

, Salhan

, Mittal

2007b. Cervical cytokine responses in women with primary or recurrent chlamydial infection. J Interferon Cytokine Res, 27:221–226.

Ault

K.A.

, Tawfik

O.W.

, Smith-King

M.M.

, Gunter

, Terranova

P.F.

1996. Tumor necrosis factor-alpha response to infection with Chlamydia trachomatis in human fallopian tube organ culture. Am J Obstet Gynecol, 175:1242–1245.

Beatty

W.L.

, Byrne

G.I.

, Morrison

R.P.

1994. Repeated and persistent infection with Chlamydia and the development of chronic inflammation and disease. Trends Microbiol, 2:94–98.

Bhengraj

A.R.

, Dar

S.A.

, Talwar

G.P.

, Mittal

2008. Potential of a novel polyherbal formulation BASANT for prevention of Chlamydia trachomatis infection. Int J Antimicrob Agents, 32:84–88.

Bhengraj

A.R.

, Vardhan

, Srivastava

, Salhan

, Mittal

2010. Decreased susceptibility to azithromycin and doxycycline in clinical isolates of Chlamydia trachomatis obtained from recurrently infected female patients in India. Chemotherapy, 56:371–377.

Bianchi

, Dosquet

, Henry

, Couderc

M.C.

, Ferchal

, Scieux

1997. Chlamydia trachomatis growth stimulates interleukin 8 production by human monocytic U-937 cells. Infect Immun, 65:2434–2436.

Buchholz

K.R.

, Stephens

R.S.

2006. Activation of the host cell proinflammatory interleukin-8 response by Chlamydia trachomatis. Cell Microbiol, 8:1768–1779.

10.

Cazalis

, Bodet

, Gagnon

, Grenier

2008. Doxycycline reduces lipopolysaccharide-induced inflammatory mediator secretion in macrophage and ex vivo human whole blood models. J Periodontol, 79:1762–1768.

11.

Cazalis

, Tanabe

, Gagnon

, Sorsa

, Grenier

2009. Tetracyclines and chemically modified tetracycline-3 (CMT-3) modulate cytokine secretion by lipopolysaccharide-stimulated whole blood. Inflammation, 32:130–137.

12.

Darville

, Andrews

C.W.

Jr. , Rank

R.G.

2000. Does inhibition of tumor necrosis factor alpha affect chlamydial genital tract infection in mice and guinea pigs? Infect Immun, 68:5299–5305.

13.

Darville

, Hiltke

T.J.

2010. Pathogenesis of genital tract disease due to Chlamydia trachomatis. J Infect Dis, 201,Suppl 2:S114–S125.

14.

Dean

, Suchland

R.J.

, Stamm

W.E.

2000. Evidence for long-term cervical persistence of Chlamydia trachomatis by omp1 genotyping. J Infect Dis, 182:909–916.

15.

Debattista

, Timms

, Allan

2003. Immunopathogenesis of Chlamydia trachomatis infections in women. Fertil Steril, 79:1273–1287.

16.

Gerbase

A.C.

, Rowley

J.T.

, Mertens

T.E.

1998. Global epidemiology of sexually transmitted diseases. Lancet, 351,Suppl 3:2–4.

17.

Gervassi

, Alderson

M.R.

, Suchland

, Maisonneuve

J.F.

, Grabstein

K.H.

, Probst

2004. Differential regulation of inflammatory cytokine secretion by human dendritic cells upon Chlamydia trachomatis infection. Infect Immun, 72:7231–7239.

18.

Giamarellos-Bourboulis

E.J.

2008. Macrolides beyond the conventional antimicrobials: a class of potent immunomodulators. Int J Antimicrob Agents, 31:12–20.

19.

Golub

L.M.

, Lee

H.M.

, Ryan

M.E.

, Giannobile

W.V.

, Payne

, Sorsa

1998. Tetracyclines inhibit connective tissue breakdown by multiple non-antimicrobial mechanisms. Adv Dent Res, 12:12–26.

20.

Griffin

M.O.

, Ceballos

, Villarreal

F.J.

2011. Tetracycline compounds with non-antimicrobial organ protective properties: possible mechanisms of action. Pharmacol Res, 63:102–107.

21.

Gupta

, Srivastava

, Vardhan

, Salhan

, Mittal

2009a. Host immune responses to chlamydial inclusion membrane proteins B and C in Chlamydia trachomatis infected women with or without fertility disorders. Reprod Biol Endocrinol, 7:38.

22.

Gupta

, Vardhan

, Srivastava

, Salhan

, Mittal

2009b. Modulation of cytokines and transcription factors (T-Bet and GATA3) in CD4 enriched cervical cells of Chlamydia trachomatis infected fertile and infertile women upon stimulation with chlamydial inclusion membrane proteins B and C. Reprod Biol Endocrinol, 7:84.

23.

Hafner

, Beagley

, Timms

2008. Chlamydia trachomatis infection: host immune responses and potential vaccines. Mucosal Immunol, 1:116–130.

24.

Hara

, Shiraishi

, Kobayashi

, Kadota

, Shirakata

, Hashimoto

, Ohashi

2009. Alteration of TLR3 pathways by glucocorticoids may be responsible for immunosusceptibility of human corneal epithelial cells to viral infections. Mol Vis, 15:937–948.

25.

Hillis

S.D.

, Owens

L.M.

, Marchbanks

P.A.

, Amsterdam

L.F.

, Mac Kenzie

W.R.

1997. Recurrent chlamydial infections increase the risks of hospitalization for ectopic pregnancy and pelvic inflammatory disease. Am J Obstet Gynecol, 176:103–107.

26.

Hvid

, Baczynska

, Deleuran

, Fedder

, Knudsen

H.J.

, Christiansen

, Birkelund

2007. Interleukin-1 is the initiator of Fallopian tube destruction during Chlamydia trachomatis infection. Cell Microbiol, 9:2795–2803.

27.

Ikeda-Dantsuji

, Konomi

, Nagayama

2007. Effects of levofloxacin and doxycycline on interleukin-6 production of Chlamydia trachomatis-infected human synovial fibroblasts. Chemotherapy, 53:332–337.

28.

Ikegaya

, Inai

, Iwasaki

, Naiki

, Ueda

2009. Azithromycin reduces tumor necrosis factor-alpha production in lipopolysaccharide-stimulated THP-1 monocytic cells by modification of stress response and p38 MAPK pathway. J Chemother, 21:396–402.

29.

Jasper

M.J.

, Tremellen

K.P.

, Robertson

S.A.

2006. Primary unexplained infertility is associated with reduced expression of the T-regulatory cell transcription factor Foxp3 in endometrial tissue. Mol Hum Reprod, 12:301–308.

30.

Katz

B.P.

, Caine

V.A.

, Batteiger

B.E.

, Jones

R.B.

1991. A randomized trial to compare 7- and 21-day tetracycline regimens in the prevention of recurrence of infection with Chlamydia trachomatis. Sex Transm Dis, 18:36–40.

31.

Kawasaki

, Takizawa

, Ohtoshi

, Takeuchi

, Kohyama

, Nakamura

, Kasama

, Kobayashi

, Nakahara

, Morita

, Yamamoto

1998. Roxithromycin inhibits cytokine production by and neutrophil attachment to human bronchial epithelial cells in vitro. Antimicrob Agents Chemother, 42:1499–1502.

32.

Khair

O.A.

, Devalia

J.L.

, Abdelaziz

M.M.

, Sapsford

R.J.

, Davies

R.J.

1995. Effect of erythromycin on Haemophilus influenzae endotoxin-induced release of IL-6, IL-8 and sICAM-1 by cultured human bronchial epithelial cells. Eur Respir J, 8:1451–1457.

33.

Khan

A.A.

, Slifer

T.R.

, Araujo

F.G.

, Remington

J.S.

1999. Effect of clarithromycin and azithromycin on production of cytokines by human monocytes. Int J Antimicrob Agents, 11:121–132.

34.

Kinnunen

, Surcel

H.M.

, Halttunen

, Tiitinen

, Morrison

R.P.

, Morrison

S.G.

, Koskela

, Lehtinen

, Paavonen

2003. Chlamydia trachomatis heat shock protein-60 induced interferon-gamma and interleukin-10 production in infertile women. Clin Exp Immunol, 131:299–303.

35.

Labro

M.T.

1998. Anti-inflammatory activity of macrolides: a new therapeutic potential? J Antimicrob Chemother, 41,Suppl B:37–46.

36.

, Liang

2000. [Determination of tumor necrosis factor-alpha and interleukin-6 levels of the tubal fluids in patients with infertility caused by infection of Chlamydia trachomatis] Zhonghua Fu Chan Ke Za Zhi, 35:411–412.

37.

Livak

K.J.

, Schmittgen

T.D.

2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25:402–408.

38.

Meyer

, Huaux

, Gavilanes

, van den Brule

, Lebecque

, Lo Re

, Lison

, Scholte

, Wallemacq

, Leal

2009. Azithromycin reduces exaggerated cytokine production by M1 alveolar macrophages in cystic fibrosis. Am J Respir Cell Mol Biol, 41:590–602.

39.

Oriel

J.D.

1982. Epidemiology of genital chlamydial infections. Infection, 10,Suppl 1:S32–S39.

40.

Ossewaarde

J.M.

, Plantema

F.H.

, Rieffe

, Nawrocki

R.P.

, de Vries

, van Loon

A.M.

1992. Efficacy of single-dose azithromycin versus doxycycline in the treatment of cervical infections caused by Chlamydia trachomatis. Eur J Clin Microbiol Infect Dis, 11:693–697.

41.

Patton

D.L.

, Askienazy-Elbhar

, Henry-Suchet

, Campbell

L.A.

, Cappuccio

, Tannous

, Wang

S.P.

, Kuo

C.C.

1994. Detection of Chlamydia trachomatis in fallopian tube tissue in women with postinfectious tubal infertility. Am J Obstet Gynecol, 171:95–101.

42.

Patton

D.L.

, Sweeney

Y.T.

, Stamm

W.E.

2005. Significant reduction in inflammatory response in the macaque model of chlamydial pelvic inflammatory disease with azithromycin treatment. J Infect Dis, 192:129–135.

43.

Rasmussen

S.J.

, Eckmann

, Quayle

A.J.

, Shen

, Zhang

Y.X.

, Anderson

D.J.

, Fierer

, Stephens

R.S.

, Kagnoff

M.F.

1997. Secretion of proinflammatory cytokines by epithelial cells in response to Chlamydia infection suggests a central role for epithelial cells in chlamydial pathogenesis. J Clin Invest, 99:77–87.

44.

Reddy

B.S.

, Rastogi

, Das

, Salhan

, Verma

, Mittal

2004. Cytokine expression pattern in the genital tract of Chlamydia trachomatis positive infertile women—implication for T-cell responses. Clin Exp Immunol, 137:552–558.

45.

Reveneau

, Crane

D.D.

, Fischer

, Caldwell

H.D.

2005. Bactericidal activity of first-choice antibiotics against gamma interferon-induced persistent infection of human epithelial cells by Chlamydia trachomatis. Antimicrob Agents Chemother, 49:1787–1793.

46.

Ribeiro

C.M.

, Hurd

, Wu

, Martino

M.E.

, Jones

, Brighton

, Boucher

R.C.

, O'Neal

W.K.

2009. Azithromycin treatment alters gene expression in inflammatory, lipid metabolism, and cell cycle pathways in well-differentiated human airway epithelia. PLoS One, 4:e5806.

47.

Schachter

1978. Chlamydial infections (first of three parts) N Engl J Med, 298:428–435.

48.

Schultz

M.J.

, Speelman

, Zaat

, van Deventer

S.J.

, van der Poll

1998. Erythromycin inhibits tumor necrosis factor alpha and interleukin 6 production induced by heat-killed Streptococcus pneumoniae in whole blood. Antimicrob Agents Chemother, 42:1605–1609.

49.

Sendag

, Terek

, Tuncay

, Ozkinay

, Guven

2000. Single dose oral azithromycin versus seven day doxycycline in the treatment of non-gonococcal mucopurulent endocervicitis. Aust NZ J Obstet Gynaecol, 40:44–47.

50.

Shinkai

, Henke

M.O.

, Rubin

B.K.

2008. Macrolide antibiotics as immunomodulatory medications: proposed mechanisms of action. Pharmacol Ther, 117:393–405.

51.

Solomon

, Rosenblatt

, Li

D.Q.

, Liu

, Monroy

, Ji

, Lokeshwar

B.L.

, Pflugfelder

S.C.

2000. Doxycycline inhibition of interleukin-1 in the corneal epithelium. Invest Ophthalmol Vis Sci, 41:2544–2557.

52.

Srivastava

, Jha

H.C.

, Salhan

, Mittal

2009. Azithromycin treatment modulates cytokine production in Chlamydia trachomatis infected women. Basic Clin Pharmacol Toxicol, 104:478–482.

53.

Srivastava

, Jha

, Bas

, Salhan

, Mittal

2008. In infertile women, cells from Chlamydia trachomatis infected sites release higher levels of interferon-gamma, interleukin-10 and tumor necrosis factor-alpha upon heat-shock-protein stimulation than fertile women. Reprod Biol Endocrinol, 6:20.

54.

Srivastava

, Vardhan

, Bhengraj

A.R.

, Jha

, Singh

L.C.

, Salhan

, Mittal

2011. Azithromycin treatment modulates the extracellular signal-regulated kinase mediated pathway and inhibits inflammatory cytokines and chemokines in epithelial cells from infertile women with recurrent Chlamydia trachomatis infection. DNA Cell Biol, 30:545–554.

55.

Stephens

R.S.

2003. The cellular paradigm of chlamydial pathogenesis. Trends Microbiol, 11:44–51.

56.

Suzuki

, Shimomura

, Ikeda

, Furukawa

, Oshima

, Takasaka

1997. Inhibitory effect of macrolides on interleukin-8 secretion from cultured human nasal epithelial cells. Laryngoscope, 107:1661–1666.

57.

Thorpe

E.M.

Jr. , Stamm

W.E.

, Hook

E.W.

3rd , Gall

S.A.

, Jones

R.B.

, Henry

, Whitworth

, Johnson

R.B.

1996. Chlamydial cervicitis and urethritis: single dose treatment compared with doxycycline for seven days in community based practises. Genitourin Med, 72:93–97.

58.

Tuffrey

, Woods

, Inman

, Ward

1994. The effect of a single oral dose of azithromycin on chlamydial infertility and oviduct ultrastructure in mice. J Antimicrob Chemother, 34:989–999.

59.

Van Voorhis

W.C.

, Barrett

L.K.

, Sweeney

Y.T.

, Kuo

C.C.

, Patton

D.L.

1997. Repeated Chlamydia trachomatis infection of Macaca nemestrina fallopian tubes produces a Th1-like cytokine response associated with fibrosis and scarring. Infect Immun, 65:2175–2182.

60.

Whelton

, Blanco

L.J.

, Carter

G.G.

, Craig

T.J.

, Bryant

H.H.

, Herbst

D.V.

, King

T.M.

1980. Therapeutic implications of doxycycline and cephalothin concentrations in the female genital tract. Obstet Gynecol, 55:28–32.

61.

Worm

A.M.

, Osterlind

1995. Azithromycin levels in cervical mucus and plasma after a single 1.0g oral dose for chlamydial cervicitis. Genitourin Med, 71:244–246.

62.

Yang

, Gartner

, Zhu

, Wang

, Brunham

R.C.

1999. IL-10 gene knockout mice show enhanced Th1-like protective immunity and absent granuloma formation following Chlamydia trachomatis lung infection. J Immunol, 162:1010–1017.

Differing Effects of Azithromycin and Doxycycline on Cytokines in Cells from Chlamydia trachomatis –Infected Women

Abstract

Introduction

Materials and Methods

Study population

Collection of Samples

Culture of cervical mononuclear cells

Laboratory diagnosis

Treatment

Antibody assay

Minimum inhibitory concentration determination

Immunofluorescence assay

Reverse transcription-polymerase chain reaction

Quantification of cytokines

RNA extraction and real-time RT-PCR analysis for cytokines

Statistical analysis

Results

Study population

Primary and recurrent infection

Efficacy of Azithromycin and Doxycycline for C. trachomatis infection in women

Quantification of cytokines by ELISA

Cytokine mRNA expression levels

Discussion

Footnotes

Acknowledgments

Disclosure Statement

References