Interaction of MTHFR 1298C with ACE D Allele Augments the Risk of Diabetic Nephropathy in Western Iran

Abstract

The aim of the current study was to examine the influence of interaction between polymorphisms of methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C with angiotensin converting enzyme insertion/deletion (ACE I/D) polymorphism on the risk of diabetic nephropathy (DN). In a case control study using polymerase chain reaction (PCR)- and PCR-restriction fragment length polymorphism (RFLP), the presence of three polymorphisms in 140 patients with type 2 diabetes mellitus (T2DM) with nephropathy including patients with micro- and macro-albuminuria and 72 patients with normoalbuminuria from Western Iran were investigated. In the presence of both MTHFR 677 T and ACE D alleles, there was a trend toward increased risk of DN 2.68-fold (p=0.054). The possession of both MTHFR 677 T and ACE D alleles increased the risk of macro-albuminuria four times (p=0.035). The concomitant presence of both MTHFR 1298 C and ACE D alleles increased the risk of macro-albuminuria 7.8-fold (p=0.012). In addition, the risk of progression from micro- to macro-albuminuria in the presence of both alleles tended to be increased (4.1-fold, p=0.09). Our study for the first time demonstrated a synergistic effect between ACE I/D with either MTHFR C677T or A1298C polymorphism on the increased risk of DN among patients with T2DM. We found that MTHFR 1298 C strongly interacts with the ACE D allele and augments the risk of DN in our population.

Introduction

B oth genetic and environmental factors are involved in the pathogenesis of diabetic nephropathy (DN). The role of hyperhomocysteinemia in the pathogenesis of DN is known (Eroglu et al., 2007). Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in the metabolism of homocysteine. This enzyme catalyzes the remethylation of homocysteine to methionine, and its deficiency is associated with hyperhomocysteinemia (Moczulski et al., 2003). The transition of C to T at nucleotide 677 of the MTHFR gene causes an alanine to valine exchange at position 222 that produces a thermolabile enzyme with reduced catalytic activity (Moczulski et al., 2003; Sun et al., 2004; Eroglu et al., 2007). However, a different polymorphism in the MTHFR gene, the A1298C point mutation, may affect enzyme regulation. (Moczulski et al., 2003; Sun et al., 2004; Mtiraoui et al., 2007). There are some reports indicating an association between MTHFR polymorphisms and DN. (Moczulski et al., 2003; Sun et al., 2004; Mtiraoui et al., 2007; Zintzaras et al., 2007; Ukinc et al., 2009). However, other studies failed to demonstrate any association between these polymorphisms and DN (Teh et al., 2004; Eroglu et al., 2007; Maeda et al., 2008).

Angiotensin converting enzyme (ACE) polymorphism is due to the presence (insertion [I] allele) or absence (deletion [D] allele) of a 287 bp Alu repeat sequence within intron 16 resulting in three genotypes DD and II homozygotes, and ID heterozygotes (Arfa et al., 2008; Glenn et al., 2009). The highest serum ACE activity is observed in individuals with the DD genotype, whereas the lowest ACE expression is found in subjects with the II genotype. (Jacobsen, 2005). A role for this polymorphism in the pathogenesis of obesity and insulin resistance has been suggested (Akin et al., 2010). There are controversial repots related to the role of ACE I/D polymorphism in the predisposition to DN and its progression in various populations (Ruggenenti et al., 2008; Ahluwalia et al., 2009; Palomo-Pinon et al., 2009).

Previously, we reported the lack of significant association between DN and ACE I/D polymorphism in Western Iran (Felehgari et al., 2011; Rahimi et al., 2011). However, we reported a significant association between MTHFR variants and risk of macro-albuminuria (Rahimi et al., 2010). Since hyperhomocysteinemia could be involved in the formation of glomerular lesions through accelerating the atherosclerotic and thrombotic process in the vascular wall (Sun et al., 2004) and the ACE I/D polymorphism affects the blood pressure through plasma ACE activity, the synergism between variants of MTHFR and ACE genes might be associated with predisposition and progression of DN. To our knowledge, there is no report of the influence of interaction between MTHFR and ACE variants on the risk and progression of DN.

In the current study, we examined the synergistic effect between MTHFR and ACE variants on the risk of DN in patients with type 2 diabetes mellitus (T2DM) from Western Iran.

Materials and Methods

The studied individuals consisted of 212 unrelated patients with T2DM including 72 patients with micro-albuminuria consisting of 26 men and 46 women with the mean age of 55.3±8.6 years, 68 patients with macro-albuminuria consisting of 33 men and 35 women aged 57.1±8.7 years, and 72 patients without nephropathy that included 23 men and 49 women with the mean age of 54.4±7.9 years as controls. The power of test for studying 210 patients with diabetes in three groups of micro- and macro-albuminuria and normoalbuminuria was 90% with the confidence level of 95%. Patients with micro-albuminuria were age- and sex-matched with patients with macro-albuminuria and with controls. However, patients with macro-albuminuria only were age-matched with controls. All subjects who were admitted to the Taleghani Diabetes Research Center of Kermanshah University of Medical Sciences were from the Kermanshah Province of Iran with a Kurdish ethnic background. World Health Organization (WHO, 1999) criteria were used for diagnosis of T2DM. Demographics, biochemical data, and medical history of each patient were obtained. Informed written consent was obtained from each individual before participation. The study was approved by the Ethics Committee of Kermanshah University of Medical Sciences and was in accordance with the principles of the Declaration of Helsinki II. Defining of micro-albuminuria and macro-albuminuria were according to albumin to creatinine ratio (ACR) of 30–299 mg/g and ≥300 mg/g, respectively, in a random spot collection of urine in three specimens collected within a 3- to 6-month period. The ACR was measured in 24 hours urine collection in those samples with ACR higher than 30 mg/g to confirm the presence of micro- or macro-albuminuria. Patients with diabetes with ACR <30 mg/g comprised the control group (American Diabetes Association, 2004).

DNA was extracted from the leukocyte fraction of the ethylenediaminetetraacetic acid-treated whole blood by using the phenol-chloroform method as previously described (Rahimi et al., 2009).

The genotyping of I/D polymorphism in the ACE gene was performed by polymerase chain reaction (PCR) using the specific primers 5′ CTGGAGACCACTCCCATCCTTTCT 3′ (forward) and 5′ GATGTGGCCATCACATTCGTCAGAT 3′ (reverse) as previously described (Rahimi et al., 2011). For prevention of mistyping of ID as the DD genotype, samples with DD genotype were amplified by allele-specific PCR with forward primer 5′ TCGGACCACAGCGCCCGCCACTAC 3′ and reverse primer 5′ TCGCCAGCCCTCCCATGCCCATAA 3′ as described by Nakhjavani et al. (2007).

The genotyping of MTHFR C677T was done by amplification of a 198 bp region in exon 4 using forward primer 5′ TGAAGGAGAAGGTGTCTGCGGGA 3′ and reverse primer 5′ AGGACGGTGCGGTGAGAGTG 3′. The PCR products were digested with HinfI as described by Frosst et al. (1995).

MTHFR A1298C was detected by amplification of a 163 bp region using forward primer 5′ CTTTGCGGAGCTGAAGGACTACTAC 3′ and reverse primer 5′ CACTTTGTGACCATTCCGGTTTG 3′ and subsequent digestion of PCR products with MboII as previously described (Rahimi et al., 2010). The MTHFR A1298C genotyping of some samples was confirmed by using allele-specific PCR as described by Poduri et al. (2008).

Statistical analysis

The allelic frequencies were calculated by the chromosome counting method. The frequency of genotypes and alleles of MTHFR and ACE in the patients was compared with the controls by using χ ² test. Odds ratios (OR) were calculated as estimates of relative risk for disease, and 95% confidence intervals (CI) were obtained by SPSS logistic regression. The interaction between the ACE I/D polymorphism with either MTHFR C677T or A1298C was determined by using the logistic regression model. Following the analyses of Vaisi-Raygani et al. (2010), four categories were defined by the presence (+) or absence (−) of the ACE or MTHFR allele. Two-tailed Student's t-test and analysis of variance were also used to compare quantitative data. Binary logistic model and multinomial logistic model were used for determination of the effects of concomitant presence of combined genotype in patients with nephropathy and in patients with micro- and macro-albuminuria compared with controls. The generalized OR (OR_G) was calculated to find the association between disease status (disease vs. healthy or disease progression) and genotype according to the method suggested by Zintzaras (2010). Statistical significance was assumed at the p<0.05 level. The SPSS statistical software package version 16.0 was used for statistical analysis.

Results

The characteristics of studied individuals are depicted in Table 1. Considering all patients with micro- and macro-albuminuria as a nephropathic group revealed that the concomitant presence of both MTHFR 677 T and ACE D alleles tended to increase the risk of DN (overall patients with micro- and macro-albuminuria) 2.68-fold (95% CI: 1–7.3, p=0.054) as indicated in Table 2. In Table 3, the synergistic effect of both alleles on the risk of micro- and macro-albuminuria is separately presented. As indicated in Table 3, the presence of both MTHFR 677 T and ACE D alleles significantly increased the risk of macro-albuminuria four times (95% CI: 1.1–14.5, p=0.035).

Table 1.

Demographic and Biochemical Characteristics of Studied Patients

Variables	Normoalbuminuric T2DM (control group) (n=72)	T2DM with micro-albuminuria (n=72)	T2DM with macro-albuminuria (n=68)	p-Value ^a	p-Value ^b	p-Value ^c
Age (years)	54.4±7.9	55.3±8.6	57.1±8.7	0.49	0.05	0.21
Sex (male: female)	23:49	26:46	33:35	0.59	0.045	0.13
BMI (Kg/m²)	26.90±4.13	27.61±4.18	26.61±4.45	0.31	0.68	0.17
Diabetes duration (years)	7.65±5.43	8.58±5.18	11.12±6.43	0.29	0.001	0.011
Mean systolic blood pressure (mmHg)	128.82±20.71	129.58±21.20	141.25±19.74	0.82	<0.001	0.001
Mean diastolic blood pressure (mmHg)	81.04±9.78	80.28±10.13	85.29±9.29	0.64	0.009	0.003
HbA_1C (%)	7.87±1.50	7.94±1.56	7.73±1.69	0.78	0.62	0.47
24 h Urine creatinine excretion (g/24 h)	1.08±0.204	0.96±0.26	0.88±0.20	0.005	<0.001	0.1
24 h Urine albumin excretion (mg/24 h)	24.17±6.74	105.31±44.50	614.70±467.73	<0.001	<0.001	<0.001
ACR (mg/g)	22.98±6.00	109.23±45.02	747.09±626.85	<0.001	<0.001	<0.001
Creatinine (mg/dL)	0.925±0.189	0.97±0.16	2.17±2.45	0.07	<0.001	<0.001
Total cholesterol (mg/dL)	179.78±29.178	178.07±36.67	162.09±33.68	0.75	0.001	0.008
TG (mg/dL)	161.72±56.12	158.51±81.82	157.42±56.47	0.79	0.66	0.92
HDL-C (mg/dL)	43.69±10.58	41.42±9.78	39.19±9.38	0.18	0.009	0.17
LDL-C (mg/dL)	100.31±26.17	101.29±29.22	102.29±28.18	0.83	0.66	0.83
Retinopathy, n (%)	20 (27.8%)	27 (37.5%)	29 (42.6%)	0.21	0.065	0.53
Neuropathy, n (%)	38 (52.8%)	42 (58.3%)	46 (67.6%)	0.5	0.07	0.25
History of CAD, n (%)	14 (19.4%)	16 (22.2%)	23 (33.8%)	0.69	0.054	0.12
Hypertension, n (%)	42 (58.3%)	44 (61.1%)	44 (64.7%)	0.73	0.43	0.66
Lipid lowering drugs users, n (%)	49 (68.1%)	55 (76.4%)	43 (63.2%)	0.26	0.54	0.09

Comparison between micro-albuminuric group and normoalbuminuric group.

Comparison between macro-albuminuric group and normoalbuminuric group.

Comparison between macro-albuminuric group and micro-albuminuric group.

T2DM, type 2 diabetes mellitus; BMI, body mass index; ACR, albumin/creatinine ratio; HDL, high-density lipoprotein; LDL, high-density lipoprotein; CAD, coronary artery disease.

Table 2.

Carrier Odds Ratios Interaction Between MTHFR 677 T and ACE D Alleles in Patients with T2DM with Nephropathy Compared with Patients with Normoalbuminuria

MTHFR 677 T	ACE D	T2DM Patients with nephropathy, n=140 n (%) [OR (95% CI, p)]	Patients with normoalbuminuria (control group), n=72 n (%)
−	−	11 (7.9%) Reference group	9 (12.5%) Reference group
+	−	8 (5.7%) [1.31 (0.32–5.4, p=0.71)]	5 (6.9%)
−	+	49 (35%) [1.11 (0.42–2.97, p=0.83)]	36 (50%)
+	+	72 (51.4%) [2.68 (1–7.3, p=0.054)]	22 (30.6%)

MTHFR, methylenetetrahydrofolate reductase; ACE D, angiotensin converting enzyme deletion polymorphism; OR, odds ratio; CI, confidence interval.

Table 3.

Carrier Odds Ratios Interaction Between MTHFR 677T and ACE D Alleles in Patients with T2DM Macro-albuminuria Compared with Patients with Normoalbuminuria and Micro-albuminuria

MTHFR 677T	ACE D	Patients with micro-albuminuria, n=72 n (%) [OR (95% CI, p)]	Patients with macro-albuminuria, n=68 n (%) [OR (95% CI, p)]	Patients with normoalbuminuria (control group), n=72 n (%)
−	−	7 (9.7%) Reference group	4 (5.9%) Reference group	9 (12.5%) Reference group
+	−	6 (8.3%) [1.54 (0.33–7.2, p=0.58)]^a [0.58 (0.08–4.38, p=0.6)]^b	2 (2.9%) [0.9 (0.12–6.8, p=0.92)]^a	5 (6.9%)
−	+	26 (36.1%) [0.93 (0.3–2.8, p=0.89)]^a [1.55 (0.4–5.9, p=0.52)]^b	23 (33.8%) [1.44 (0.4–5.2, p=0.58)]^a	36 (50%)
+	+	33 (45.8%) [1.93 (0.63–5.94, p=0.25)]^a [2.07 (0.56–7.7, p=0.27)]^b	39 (57.4%) [4.0 (1.1–14.5, p=0.035)]^a	22 (30.6%)

Interaction between MTHFR 677 T and ACE D alleles in micro- and macro-albuminuric groups compared with normoalbuminuric group.

Interaction between MTHFR 677 T and ACE D alleles in micro-albuminuric group compared with macro-albuminuric group.

Combined effect of both MTHFR 1298 C and ACE D alleles resulted in 3.33 times increased risk of DN (95% CI: 1.2–9.5, p=0.02) (Table 4). In Table 5, the strong synergistic effect between MTHFR 1298 C and ACE D alleles is demonstrated with a 7.8-fold increased risk of macro-albuminuria (95% CI: 1.56–38.8, p=0.012). In addition, according to the frequency of alleles, we hypothesized that there was a trend toward increased risk of progression from micro- to macro-albuminuria in the presence of both alleles 4.1-fold (95% CI: 0.77–21.6, p=0.09).

Table 4.

Carrier Odds Ratios Interaction Between MTHFR 1298 C and ACE D Alleles in Patients with T2DM Nephropathy Compared with Patients with Normoalbuminuria

MTHFR 1298C	ACE D	Patients with T2DM nephropathy, n=140 n (%) [OR (95% CI, p)]	Patients with normoalbuminuria (control group), n=71 n (%)
−	−	8 (5.7%) Reference group	9 (12.7%) Reference group
+	−	11 (7.9%) [3.09 (0.7–13.7, p=0.13)]	4 (5.6%)
−	+	44 (31.4%) [1.55 (0.54–4.4, p=0.41)]	32 (45.1%)
+	+	77 (55%) [3.33 (1.2–9.5, p=0.02)]	26 (36.6%)

Table 5.

Carrier Odds Ratios Interaction Between MTHFR 1298 C and ACE D Alleles in Patients with T2DM Macro-albuminuria Compared with Patients with Normoalbuminuria and Micro-albuminuria

MTHFR 1298 C	ACE D	Patients with micro-albuminuria, n=72 n (%) [OR (95% CI, p)]	Patients with macro-albuminuria, n=68 n (%) [OR (95% CI, p)]	Patients with normoalbuminuria (control group), n=71 n (%)
−	−	6 (8.3%) Reference group	2 (2.9%) Reference group	9 (12.7%) Reference group
+	−	7 (9.7%) [2.63 (0.53–13.1, p=0.24)]^a [1.71 (0.22–12.9, p=0.6)]^b	4 (5.9%) [4.5 (0.57–35.5, p=0.15)]^a	4 (5.6%)
−	+	27 (37.5%) [1.27 (0.4–4.0, p=0.69)]^a [1.89 (0.34–10.5, p=0.46)]^b	17 (25%) [2.39 (0.46–12.3, p=0.29)]^a	32 (45.1%)
+	+	32 (44.4%) [1.9 (0.6–6.04, p=0.27)]^a [4.1 (0.77–21.6, p=0.09)]^b	45 (66.2%) [7.8 (1.56–38.8, p=0.012)]^a	26 (36.6%)

Interaction between MTHFR 1298 C and ACE D alleles in micro- and macro-albuminuric groups compared with normoalbuminuric group.

Interaction between MTHFR 1298 C and ACE D alleles in micro-albuminuric group compared with macro-albuminuric group.

The binary logistic model indicated that in patients with nephropathy compared with controls, the presence of MTHFR 677 CT+TT versus CC genotype and MTHFR 1298 AC+CC versus AA genotype resulted in OR=2.58 (95% CI: 1.4–4.8, p=0.002) and OR=2.59 (95% CI: 1.4–4.7, p=0.002), respectively. For ACE ID+DD genotype versus II genotype, the obtained OR was 1.16 (95% CI: 0.51–2.6, p=0.71).

Using the multinomial logistic model, we compared the presence of combined genotype (wild vs. heterozygous+ homozygous genotype) in patients with micro- and macro-albuminuria versus controls, and the obtained ORs were 1.29 (95% CI: 0.64–2.6, p=0.47), 2.21 (95% CI: 1.08–4.5, p=0.029), and 2.14 (95% CI: 0.75–6.1, p=0.15) for MTHFR C677T, A1298C, and ACE I/D polymorphisms, respectively.

Previously, we reported the OR_G of 2.17 (95% CI: 1.24–3.98) and 2.08 (95% CI: 1.29–4.14) for associations of MTHFR C677T and A1298C with DN, respectively (Jafari et al., 2011). The OR_G of 1.4 (95% CI: 0.96–2.05) was found for association of ACE I/D polymorphism and DN. In the current study, the OR_G for the association of combined presence of the MTHFR 677 T and ACE D alleles and DN was 2.46 (95% CI: 1.08–5.58). In addition, the OR_G for the association of concomitant presence of the MTHFR 1298 C and ACE D alleles and DN was 3.54 (95% CI: 1.48–8.43). For any two subjects, with or without nephropathy, the probability of having nephropathy is 254% higher (relative to the probability of lacking of nephropathy) in the presence of both MTHFR 1298C and ACE D alleles.

Discussion

Previously, we indicated that the presence of the ACE D allele non-significantly increased the risk of macro-albuminuria and progression from micro- to macro-albuminuria by 1.6- and 1.3-fold, respectively (Felehgari et al., 2011; Rahimi et al., 2011). In individuals carrying the D allele, the systemic and renal ACE levels are increased, whereas those with the I allele have the lowest ACE expression (Jacobsen, 2005). The lower ACE activity could be one of the mechanisms underlying the protective effect of the ACE II genotype against nephropathy (Wang et al., 2005). In the presence of both ID and DD genotypes, the glomerular filtration rate increased in correlation with ACE plasma levels (Marre et al., 1999). Coexistence of hypertension and T2DM increases the risk of kidney damage. In patients with end-stage renal disease, a positive association between ACE D allele and vascular disease has been reported (Tang et al., 2008).

Previously, we indicated (Rahimi et al., 2010) that the presence of either MTHFR 677 T or 1298 C allele significantly increased the risk of macro-albuminuria in patients with T2DM by 4.1 and 5.5 times, respectively. Hyperhomocysteinemia has been observed in individuals with MTHFR 677 TT genotype compared with MTHFR 677 CT and CC genotypes (Frosst et al., 1995; Maeda et al., 2008). In addition, association between hyperhomocysteinemia and DN in patients with diabetes has been reported (Buysschaert et al., 2000; Vaccaro et al., 2000; Maeda et al., 2008). It has been suggested that the hyperhomocysteinemia could be involved in the formation of glomerular lesions through accelerating the atherosclerotic and thrombotic process in the vascular wall (Sun et al., 2004).

ACE regulates microcirculation within the kidney and in the presence of D allele, the glomerular filtration rate increases in correlation with ACE plasma levels (Marre et al., 1999). On the other hand, MTHFR variants through hyperhomocysteinemia increase the glomerular lesions, and an association between progressive renal failure and elevation of serum homocysteine level has been suggested (Eriksson et al., 1995; Sun et al., 2004). So, it is predicted that the combined presence of both ACE and MTHFR variants would be associated with increased risk of macro-albuminuria as observed in our study. We found an interaction between MTHFR variants and ACE I/D polymorphism, which increased the risk of DN. Although in the presence of either the ACE D or MTHFR 677 T allele, the risk of macro-albuminuria was 1.44- and 0.9-fold, that did not reach a statistical significance. The synergistic effect of both alleles increased the risk of macro-albuminuria to a significant level of four times. A strong association between MTHFR 1298 C and ACE D alleles was observed with 7.8 times increased risk of macro-albuminuria. The concomitant presence of both alleles tended to elevate the risk of progression from micro- to macro-albuminuria. Unlike macro-albuminuria, micro-albuminuria does not necessarily reflect structural kidney damage and may not be affected by ACE I/D polymorphism (Ruggenenti et al., 2008). In addition, it has been suggested that there is a moderate hyperhomocysteinemia from the early stages of renal failure which increases in parallel with deterioration of renal function; and in end-stage renal disease, the 677 TT genotype of MTHFR produces a 40%–100% increase in total homocysteine level compared with a 25% increase in normal renal function (Canepa et al., 2003). Absence of association between MTHFR and ACE variants in our patients with micro-albuminuria can be explained by the mild effects of MTHFR and ACE variants on the increase in the level of homocysteine and kidney damage.

Our results revealed that the presence of variations in more genes instead of a single genetic defect play a role in the susceptibility to DN. It seems that the concomitant presence of both MTHFR variants and ACE I/D polymorphism could augment the risk of DN through elevation of serum homocystein level, hypertension, increasing glomerular filteration rate, and accelerating atherosclerosis process in the vascular wall. According to the literature, there is no report that examines the influence of interaction between ACE and MTHFR variants on the risk of DN among Iranians. However, in a few reports, the presence of higher ACE activity in patients with T2DM nephropathy and who are carriers of D allele and the association between D allele and progression of albuminuria have been demonstrated among Iranians (Nikzamir et al., 2008, 2009).

In summary, our study for the first time demonstrated that the concomitant presence of ACE I/D polymorphism with either MTHFR C677T or A1298C polymorphism is associated with an increased risk of DN among patients with T2DM. We observed that the MTHFR 1298 C allele strongly interacts with the ACE D allele and augments the risk of DN in our population.

Limitations of the Study

One of the limitations of our study was studying the influence of the concomitant presence of polymorphisms of ACE and MTHFR on the risk of DN in a relatively small sample size of patients with diabetes with and without nephropathy. The other limitation of the current study was that the progression of DN needed to be determined in a prospective study, and the results of the progression of DN obtained in our study were based on the prevalence of findings. Further prospective investigations with a larger number of individuals with and without DN are required to support our findings.

Footnotes

Acknowledgment

This work was financially supported by a grant from the Vice Chancellor for Research of Kermanshah University of Medical Sciences, Kermanshah Iran.

Disclosure Statement

No competing financial interests exist for all authors.

References

Ahluwalia

T.S.

, Ahuja

, Rai

T.S.

et al. 2009. ACE variants interact with the RAS pathway to confer risk and protection against type 2 diabetic nephropathy. DNA Cell Biol, 28:141–150.

Akin

, Turgut

, Bastemir

et al. 2010. Angiotensin-converting enzyme gene polymorphism in overweight and obese Turkish patients with insulin resistance. DNA Cell Biol, 29:207–212.

American Diabetes Association. 2004. Nephropathy in diabetes. Diabetes Care, 27:S79–S83.

Arfa

, Abid

, Nouira

et al. 2008. Lack of association between the angiotensin-converting enzyme gene (I/D) polymorphism and diabetic nephropathy in Tunisian type 2 diabetic patients. J Renin Angiotensin Aldosterone Sys, 9:32–36.

Buysschaert

, Dramais

A.S.

, Wallemacq

P.E.

et al. 2000. Hyperhomocysteinemia in type 2 diabetes: relationship to macroangiopathy, nephropathy, and insulin resistance. Diabetes Care, 23:1816–1822.

Canepa

, Carrea

, Caridi

et al. 2003. Homocysteine, folate, vitamin B12 levels, and C677T MTHFR mutation in children with renal failure. Pediatr Nephrol, 18:225–229.

Eriksson

, Kallin

, van 't Hooft

F.M.

, Båvenholm

, Hamsten

1995. Allele-specific increase in basal transcription of the plasminogen-activator inhibitor 1 gene is associated with myocardial infarction. Proc Natl Acad Sci USA, 92:1851–1855.

Eroglu

, Erdogan

, Tetik

et al. 2007. The relationship of the methylenetetrahydrofolate reductase C677T gene polymorphism in Turkish type 2 diabetic patients with and without nephropathy. Diabetes Metab Res Rev, 23:621–624.

Felehgari

, Rahimi

, Mozafari

et al. 2011. ACE gene polymorphism and serum ACE activity in Iranians type II diabetic patients with macroalbuminuria. Mol Cell Biochem, 346:23–30.

10.

Frosst

, Blom

H.J.

, Milos

et al. 1995. A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet, 10:111–113.

11.

Glenn

K.L.

, Du

Z.O.

, Eisenmann

J.C.

et al. 2009. An alternative method for genotyping of the ACE I/D polymorphism. Mol Biol Rep, 36:1305–1310.

12.

Jacobsen

P.K.

2005. Preventing end stage renal disease in diabetic patients: genetic aspect (part I) J Renin Angiotensin Aldosterone Syst, 6:1–14.

13.

Jafari

, Rahimi

, Vaisi-Raygani

et al. 2011. Interaction of eNOS polymorphism with MTHFR variants increase the risk of diabetic nephropathy and its progression in type 2 diabetes mellitus patients. Mol Cell Biochem, 353:23–34.

14.

Maeda

, Yamamoto

, Fukuda

et al. 2008. MTHFR gene polymorphism is susceptible to diabetic retinopathy but not to diabetic nephropathy in Japanese type 2 diabetic patients. J Diabet Complications, 22:119–125.

15.

Marre

, Bouhanick

, Berrut

et al. 1999. Renal changes on hyperglycemia and angiotensin-converting enzyme in type 1 diabetes. Hypertension, 33:775–780.

16.

Moczulski

, Fojcik

, Zukowska-Szczechowska

et al. 2003. Effects of the C677T and A1298C polymorphisms of the MTHFR gene on the genetic predisposition for diabetic nephropathy. Nephrol Dial Transplant, 18:1535–1540.

17.

Mtiraoui

, Ezzidi

, Chaieb

et al. 2007. MTHFR C677T and A1298C gene polymorphisms and hyperhomocysteinemia as risk factors of diabetic nephropathy in type 2 diabetes patients. Diabetes Res Clin Pract, 75:99–106.

18.

Nakhjavani

, Esfahnian

, Jahanshahi

et al. 2007. The relationship between the insertion/deletion polymorphism of the ACE gene and hypertension in Iranian patients with type 2 diabetes. Nephrol Dial Transplant, 22:2549–2553.

19.

Nikzamir

, Nakhjavani

, Esteghamati

, Rashidi

2008. Correlates of ACE activity in macroalbuminuric type 2 diabetic patients treated with chronic ACE inhibition. Nephrol Dial Transplant, 23:1274–1277.

20.

Nikzamir

, Esteghamati

, Feghhi

, Nakhjavani

, Rashidi

, Reza

. 2009. The insertion/deletion polymorphism of the angiotensin-converting enzyme gene is associated with progression, but not development, of albuminuria in Iranian patients with type 2 diabetes. J Renin Angiotensin Aldosterone Sys, 10:109–114.

21.

Palomo-Pinon

, Gutierrez-Rodrigues

M.E.

, Diaz-Flores

et al. 2009. DD genotype of angiotensin-converting enzyme in type 2 diabetes mellitus with renal disease in Mexican Mestizos. Nephrology, 14:235–239.

22.

Poduri

, Mukherjee

, Sud

, Singh Kohli

, Sakhuja

, Khullar

2008. MTHFR A1298C polymorphism is associated with cardiovascular risk in end stage renal disease in North Indians. Mol Cell Biochem, 308:43–50.

23.

Rahimi

, Hasanvand

, Rahimi

et al. 2010. Synergistic Effects of the MTHFR C677T and A1298C polymorphisms on the increase risk of micro- and macro-albuminuria and progression of diabetic nephropathy among Iranians with type 2 diabetes mellitus. Clin Biochem, 43:1333–1339.

24.

Rahimi

, Felehgari

, Rahimi

et al. 2011. The frequency of factor V Leiden mutation, ACE gene polymorphism, serum ACE activity and response to ACE inhibitor and angiotensin II receptor antagonist drugs in Iranians type II diabetic patients with microalbuminuria. Mol Biol Rep, 38:2117–2123.

25.

Rahimi

, Muniz

, Akramipour

et al. 2009. Haplotype analysis of beta thalassemia in Western Iran. Blood Cells Mol Dis, 42:140–143.

26.

Ruggenenti

, Bettinaglio

, Pinares

et al. 2008. Angiotensin converting enzyme insertion/deletion polymorphism and renoprotection in diabetic and nondiabetic nephropathies. Clin J Am Soc Nephrol, 3:1511–1525.

27.

Sun

, Xu

, Zhu

et al. 2004. Genetic polymorphism of methylenetetrahydrofolate reductase as a risk factor for diabetic nephropathy in Chinese type 2 diabetic patients. J Diabet Complications, 64:185–190.

28.

Tang

F.Y.

, Liu

F.Y.

, Xie

X.W.

2008. Association of angiotensin converting enzyme and endothelial nitric oxide synthase gene polymorphisms with vascular disease in ESRD patients in a Chinese population. Mol Cell Biochem, 319:33–39.

29.

Teh

M.M.

, Brooks

A.P.

, Li Voon Chong

J.S.W.

2004. Methylenetetrahydrofolate reductase gene polymorphism is not related to diabetic nephropathy in Japanese type 2 diabetic patients. Diabet Med, 21:1051–1058.

30.

Ukinc

, Ersoz

H.O.

, Karahan

et al. 2009. Methylenetetrahydrofolate reductase C677T gene mutation and hyperhomocysteinemia as a novel risk factor for diabetic nephropathy. Endocrine, 36:255–261.

31.

Vaccaro

, Pema

A.F.

, Mancini

F.P.

et al. 2000. Plasma homocystein and its determinants in diabetic retinopathy. Diabetes Care 2000;, 23:1026–1027.

32.

Vaisi-Raygani

, Rahimi

, Tavilani

et al. 2010. Butyrylcholinesterase K variant and the APOE-e4 allele work in synergy to increase the risk of coronary artery disease especially in diabetic patients. Mol Biol Rep, 37:2083–2091.

33.

Wang

, Ng

M.C.

, So

W.Y.

et al. 2005. Prognostic effect of insertion/deletion polymorphism of the ace gene on renal and cardiovascular clinical outcomes in Chinese patients with type 2 diabetes. Diabetes Care, 28:348–354.

34.

WHO Study Group Report of a WHO Consultation. 1999. Diagnosis and Classification of Diabetes Mellitus, Part 1. World Health Organization: Geneva.

35.

Zintzaras

2010. The generalized odds ratio as a measure of genetic risk effect in the analysis and meta-analysis of association studies. Stat Appl Genet Mol Biol, 9:1–12.

36.

Zintzaras

, Uhlig

, Koukoulis

G.N.

et al. 2007. Methylenetetrahydrofolate reductase gene polymorphism as a risk factor for diabetic nephropathy: a meta-analysis. J Hum Genet, 52:881–890.