The Response of Type 2 Quorum Sensing in Klebsiella pneumoniae to a Fluctuating Culture Environment

Abstract

Bacterial cells communicate with one another using chemical signaling molecules. This phenomenon is termed quorum sensing (QS). QS in Klebsiella pneumoniae is mediated by the synthesis of interspecies autoinducer 2 (AI-2), a furanosyl borate diester molecule. The response of Type 2 QS to environmental cues such as carbon sources, the initial pH of the medium, and boracic acid was investigated in the present study using a Vibrio harveyi BB170 reporter assay and quantitative reverse transcription–polymerase chain reaction (qRT-PCR) analysis. The results show that glucose can affect AI-2 synthesis to the greatest extent, and 3.0% glucose can stimulate K. pneumoniae to produce more AI-2, with a four times increase in activity compared with that of the control culture. According to our previous research, Type 2 QS in K. pneumoniae is luxS dependent. Therefore, the close relationship between glucose concentration and luxS transcription level was confirmed with qRT-PCR technology. The results show that the response of QS to a fluctuating glucose concentration was observed as a change in the amount of luxS RNA transcripts. A maximum of luxS transcription appeared during the exponential growth phase when the glucose concentration was 30.0 g/L. At the same time, AI-2 production was also slightly impacted by the low initial pH. It is noteworthy that the addition of boracic acid at microdosage (0.1 g/L) can also induce AI-2 synthesis. Presumably, in K. pneumoniae, the 4,5-dihydroxy-2,3-pentanedione cyclizes by the addition of borate and loss of water, is hydrated, and is converted to the final AI-2 signaling molecule.

Introduction

C ell-to-cell communication, also called quorum sensing (QS), allows bacteria to monitor the environment for other bacteria and to alter behavior on a population-wide scale in response to changes in the number and/or species present in a community (Miller and Bassler, 2001). QS process enables a population of bacteria to collectively regulate gene expression and behaviors (Schuster, 2011), including antibiotic production (Slater et al., 2003), extracellular polysaccharide (von Bodman et al., 1998), biofilm differentiation (De Araujo et al., 2010; Dickschat, 2010), sporulation (Li et al., 2011), bioluminescence (Steenackers et al., 2010), virulence (Antunes et al., 2010; Karafyllidis, 2011), swarming motility (Rasmussen et al., 2000), and primary metabolism (Van Houdt et al., 2006). In general, the classes of signaling molecules are oligopeptides in Gram-positive bacteria, N-acyl homoserine lactones (AHL) in Gram-negative bacteria, and a family of autoinducers known as brominated furanone (AI-2) in both Gram-negative and Gram-positive bacteria (Waters and Bassler, 2005). In AI-2 synthesis, the luxS gene product S-ribosylhomocysteinase is the third enzyme required in a three-step conversion of S-adenosylmethionine (SAM) to 4,5-dihydroxy-2,3-pentanedione (DPD). Utilization of SAM as a methyl donor in vital cellular processes yields the toxic metabolic intermediate S-adenosylhomocysteine (SAH), which is catalyzed by the S-adenosylmethionine synthetase. The S-adenosylhomocysteine nucleosidase (Pfs) rapidly hydrolyzes SAH to adenine and S-ribosylhomocysteine (SRH). In the third step, SRH is converted to DPD and homocysteine by LuxS. However, DPD is unstable and it has been proposed that it spontaneously rearranges to form a furanosyl borate diester (Ascenso et al., 2011).

Klebsiella pneumoniae is a Gram-negative anaerobic bacterium and an opportunist pathogen responsible for nosocomial infections. The bacterium contains AHL-lactonase, which is a quorum-quenching enzyme. Therefore, the luxS-dependent QS system (Type II) has been referred to as a communication system in K. pneumoniae. Previous studies on QS in K. pneumoniae established the characterization of Type 2 system and its regulation role in biofilm formation (Balestrino et al., 2005). Currently, there are few papers reporting the effect of environmental cues on the Type II QS. Therefore, in this study, the influence of carbon sources, low pH, and boracic acid on QS in K. pneumoniae was investigated. Results show that glucose can affect the synthesis of AI-2.

Materials and Methods

Bacterial strains and growth conditions

Vibrio harveyi BB170 (ΔluxN, AI-1⁺, AI-2⁻) (Zhu et al., 2008) was grown at 30°C with shaking at 200 rpm in an autoinducer bioassay (AB) medium containing 0.5% (w/v) casamino acids. K. pneumoniae (Guangdong Culture Collection Center, GIMT1.102) and E. coli DH5α (F⁻, ø80dlacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rK⁻, mK⁺), phoA, supE44, λ−, thi-1, gyrA96, relA1) from Clontech Company were grown in Luria-Bertani (LB) growth medium at 37°C.

Influence of environmental cues on AI-2 production

Effect of carbon source on AI-2 production was studied by adjusting different carbon sources (glucose, sucrose, and glycerol) in LB medium. Effect of glucose on AI-2 production was studied by adjusting the concentration at 0.1%, 0.5%, and 3.0%. Similarly, effect of boracic acid was studied by adding different boracic acid concentrations (0.1‰, 0.5‰, and 1.0‰) to LB medium. The synergistic effect of glucose and pH value on AI-2 production was studied by adjusting the production medium pH to 5.0 and 7.0.

Preparation of cell-free culture supernatant and AI-2 bioassay

Cell-free conditioned culture supernatant (CFS) was prepared by centrifuging K. pneumoniae cultures at 10,000 g and passing the supernatant through a Millipore membrane filter (pore size, 0.22 μm). The detection of AI-2 in culture supernatants using V. harveyi BB170 (sensor 1⁻, sensor 2⁺) was performed as previously reported (Zhu et al., 2008). Briefly, the V. harveyi reporter strain was grown for ∼16 h at 30°C at 200 rpm in AB medium. Cells were diluted 1:5,000 in fresh AB medium, which reduced the level of endogenous AI-2 below the threshold required for luminescence, and CFS samples were assayed at 10% (vol/vol) with the V. harveyi reporter strain BB170 (ΔluxN) at a final volume of 100 μL. The plates were then incubated with shaking at 30°C. Luminescence values were measured every 4 h in a SpectraMax M2^e (Molecular Devices) and reported as the fold induction of luminescence by the reporter strain above the negative medium control.

Quantitative reverse transcription–polymerase chain reaction

Analysis of qRT-PCR was carried out to confirm the changes in luxS transcription level during growth in LB medium with or without glucose. First, the luxS gene was cloned from genomic DNA of K. pneumoniae by PCR using primer pairs FluxS1 (5′ CGGAATTCATGGAAGCCCCAGCGGTGC 3′; underlined nucleotides are the recognition site of EcoR I) and RluxS2 (5′ CCCAAGCTTCTAGATGTGCAGTTCCTGC 3′; underlined nucleotides are the recognition site of Hind III), and then the cloned fragment was ligated to plasmid pUC18 (pBR322-derived cloning vector, Lac⁺, Ap^r) obtained from MBI Fermentas. Finally, the constructed recombinant pUC18-luxS vector (pUC18-based cloning vector with luxS gene, Ap^r) was identified with restriction enzyme digestion, PCR, and DNA sequencing. To generate an external plasmid standard curve, plasmid pUC18-luxS was serially (1:10) diluted over the appropriate concentration range (usually 10⁵−10⁹). To achieve a reliable standard curve for each measured parameter, the plasmid pUC18-luxS was PCR-amplified with primer pairs FluxS3 (5′ ATGGAAGCCCCAGCGGTGC 3′) and RluxS4 (5′ CTAGATGTGCAGTTCCTGC 3′) in five replicates for each standard dilution point over the complete standard-curve range. Figure 4A shows the standard curve for plasmid pUC18-luxS, which was used for the determination of luxS transcription. After preparing the standard, total RNA isolated from K. pneumoniae sampled every 4 h during growth in LB medium with or without glucose was reverse-transcribed and the obtained cDNA was directly subjected to real-time PCR with primer pairs FluxS3 and RluxS4.

Results

Effect of different carbon sources on AI-2 production

The effect of carbon source on AI-2 production was characterized using three different carbon sources at 10.0 g/L concentration during growth in LB medium. The following carbohydrates were tested: monosaccharides (glucose), disaccharides (sucrose), and glycerol. As illustrated in Figure 1, the growth of K. pneumoniae was not affected and AI-2 production profiles were significantly different when carbon supplements were used in LB medium. AI-2 production reached its maximum at the mid-exponential phase of growth in the presence of glucose as a carbon source. Compared with glucose, for cultivation using sucrose as a carbon source, there is a lag time before AI-2 production reached maximum, which presumably is due to the time required for sucrose hydrolysis. AI-2 production is maximal after 4 h of growth using glycerol as a carbon source. This may be due to the different metabolic pathways that utilize glucose and glycerol. In all cases, AI-2 quorum signal degradation appears after entry stationary phase or after the carbohydrates are used up.

FIG. 1.

Effect of different carbon sources on cell growth and AI-2 production by Klebsiella pneumoniae. The growth conditions were LB medium plus a 1.0% concentration of one of the following carbohydrates: glucose, sucrose, and glycerol. (A) Cell density measured in terms of OD₆₀₀; (B) AI-2 activity of cultures assayed using Vibrio harveyi BB170 reporter strain on CFS. Data are the mean of three repeats. AI-2, autoinducer 2; LB, Luria-Bertani; OD, optical density; CFS, cell-free conditioned culture supernatant.

Effect of glucose concentration and pH value on AI-2 production

As shown in Figure 2, the levels of AI-2 activity are dramatically affected by growth in changing glucose concentrations, and at 3.0% glucose concentration, AI-2 production is maximal, with four times increased activity compared with that of the control culture. As the glucose concentration is decreased, there is a gradual decrease in AI-2 production by K. pneumoniae. Bacterial growth is not affected by glucose over the range used. Further, AI-2 activity increases when cell density increases during the exponential growth phase. However, the effect of glucose on AI-2 activity is greater than that of cell density when entering stationary phase. In fermentation of K. pneumoniae, glucose is oxidized to small molecule organic acids, which leads to a fall in pH. Therefore, the synergy of glucose and pH on AI-2 production was further investigated. As illustrated in Figure 3, both glucose and low pH can improve AI-2 activity. The response of QS in K. pneumoniae to glucose is more obvious, which is consistent with the above result.

FIG. 2.

Effect of different glucose concentrations on cell growth and AI-2 production by K. pneumoniae, which was grown in LB medium supplemented with 0.1%, 0.5%, and 3.0% glucose. (A) Cell density measured in terms of OD₆₀₀; (B) AI-2 activity of cultures assayed using V. harveyi BB170 reporter strain on CFS. Data are the mean of three repeats.

FIG. 3.

Synergy of glucose and pH value on AI-2 production. K. pneumoniae was grown in LB medium without added glucose (pH 5.0 and 7.0) and with added glucose at concentrations of 10.0 g/L (pH 7.0). Experiments were performed three times.

Analysis of response of QS in K. pneumoniae to glucose by qRT-PCR

According to our previous research, the Type 2 QS system in K. pneumoniae is luxS dependent. Therefore, changes in luxS transcription were analyzed by qRT-PCR when the glucose concentration was changing during growth. RNA from K. pneumoniae was isolated every 4 h during growth in LB medium with or without glucose and then subjected to qRT-PCR. As shown in Figure 4B, the amount of luxS RNA transcripts observed is dependent on the availability of glucose in the growth medium. Further, luxS expression profiles are qualitatively similar. Maximum luxS transcription was detected during the exponential growth phase when the glucose concentration is 30.0 g/L.

FIG. 4.

Determination of luxS transcription in K. pneumoniae grown with glucose by qRT-PCR. The experiment was performed in triplicate. Copy numbers were calculated from the equation of the straight line in A, which is the qRT-PCR standard curve for the luxS gene. The logarithms (base 10) of concentrations were plotted against crossing points in B. qRT-PCR, quantitative reverse transcription–polymerase chain reaction; QS, quorum sensing.

Effect of boracic acid on AI-2 production

Production of AI-2 by K. pneumoniae was studied in the presence of various concentrations of boracic acid. As shown in Figure 5, the addition of boracic acid at a microdosage (0.1 g/L) could also induce the synthesis of AI-2. Therefore, according to this result and published reports, we presume that in K. pneumoniae, DPD, which is the core molecule from which all AI-2s are derived, cyclizes by the addition of borate and loss of water, is hydrated, and is converted to the final AI-2 signaling molecule. However, the growth of K. pneumoniae was suppressed by the addition of too much boracic acid, wherein AI-2 activity was lower than that of the negative control.

FIG. 5.

Effect of different concentrations of boric acid on cell growth and AI-2 production by K. pneumoniae. The maximal AI-2 activity is depicted as the fold induction of luminescence by V. harveyi BB170 above the negative control.

Discussion

QS is the regulation of gene expression in response to fluctuations in cell population density. QS bacteria produce and release chemical signaling molecules called autoinducers that increase in concentration as a function of cell density. K. pneumoniae, a Gram-negative anaerobic bacterium, produces a nonhomoserine lactone autoinducer AI-2 during the growth period. AI-2 is a furanosyl borate diester and its formation is catalyzed by LuxS, which converts SRH to DPD. CFS from K. pneumoniae strain GIMT1.102 can induce luminescence in V. harveyi BB170. BB170 can only exhibit bioluminescence in response to AI-2 or an AI-2-like molecule due to deficiency in the luxN-encoded AI-1 sensor. Environmental cues, such as different carbon resources, low pH value, and boracic acid, were found to influence AI-2 production (Figs. 1, 3, and 5). Glucose affects AI-2 synthesis to the greatest extent, and 3.0% glucose can stimulate K. pneumoniae to produce four times more AI-2 activity compared with that of the control culture (Fig. 2). The concentration of signaling molecule decreased gradually, which may be attributed to a fall in pH due to cell metabolism. An extremely low pH value may lead to opening of the five-membered ring when cell density is high.

According to our previous research, the Type II QS system in K. pneumoniae is luxS dependent. Therefore, on the basis of the above experimental results, study on the response of luxS transcription in K. pneumoniae to glucose was carried out using qRT-PCR. Results showed that, in the presence of glucose, intracellular luxS mRNA increased sharply during the exponential growth and decreased abruptly after the late exponential phase (Fig. 4B). The large drop in luxS transcription began before the glucose supply to cells decreased or the growth rate declined. Probably, AI-2 activity in K. pneumoniae acts as a signal for adjusting cell physiology and metabolism in response to environmental conditions. Apart from glucose, the addition of boracic acid at 0.1 g/L could also induce the synthesis of AI-2 (Fig. 5). In many bacteria, DPD, which is the core molecule from which all AI-2s are derived, cyclizes by the addition of borate and loss of water, is hydrated, and then converted to the final AI-2 signaling molecule (Galloway et al., 2011). In conclusion, the present study shows a response of Type 2 QS to environmental changes by transcriptional regulation of luxS.

Footnotes

Acknowledgments

This work was supported by the Research Fund for the Doctoral Program of Higher Education of China (No. 200804251510), Shandong Provincial Natural Science Foundation of China (No. ZR2010CL006), and the Fundamental Research Funds for the Central Universities (No. 27R0904083A).

Disclosure Statement

No competing financial interests exist.

References

Antunes

L.C.

, Ferreira

R.B.

, Buckner

M.M.

, Finlay

B.B.

2010. Quorum sensing in bacterial virulence. Microbiology, 156:2271–2282.

Ascenso

O.S.

, Marques

J.C.

, Santos

A.R.

, Xavier

K.B.

, Ventura

M.R.

, Maycock

C.D.

2011. An efficient synthesis of the precursor of AI-2, the signalling molecule for inter-species quorum sensing. Bioorg Med Chem, 19:1236–1241.

Balestrino

, Haagensen

J.A.

, Rich

, Forestier

2005. Characterization of type 2 quorum sensing in Klebsiella pneumoniae and relationship with biofilm formation. J Bacteriol, 187:2870–2880.

De Araujo

, Balestrino

, Roth

, Charbonnel

, Forestier

2010. Quorum sensing affects biofilm formation through lipopolysaccharide synthesis in Klebsiella pneumoniae. Res Microbiol, 161:595–603.

Dickschat

J.S.

2010. Quorum sensing and bacterial biofilms. Nat Prod Rep, 27:343–369.

Galloway

W.R.

, Hodgkinson

J.T.

, Bowden

S.D.

, Welch

, Spring

D.R.

2011. Quorum sensing in Gram-negative bacteria: small-molecule modulation of AHL and AI-2 quorum sensing pathways. Chem Rev, 111:28–67.

Karafyllidis

I.G.

2011. Regulating the quorum sensing signalling circuit to control bacterial virulence: in silico analysis. IET Syst Biol, 5:103–109.

, Chen

, Vidal

J.E.

, McClane

B.A.

2011. The Agr-like quorum-sensing system regulates sporulation and production of enterotoxin and beta2 toxin by Clostridium perfringens type A non-food-borne human gastrointestinal disease strain F5603. Infect Immun, 79:2451–2459.

Miller

M.B.

, Bassler

B.L.

2001. Quorum sensing in bacteria. Annu Rev Microbiol, 55:165–199.

10.

Rasmussen

T.B.

, Manefield

, Andersen

J.B.

, Eberl

, Anthoni

, Christophersen

et al. 2000. How Delisea pulchra furanones affect quorum sensing and swarming motility in Serratia liquefaciens MG1. Microbiology, 146:3237–3244.

11.

Schuster

2011. Global expression analysis of quorum-sensing controlled genes. Methods Mol Biol, 692:173–187.

12.

Slater

, Crow

, Everson

, Salmond

G.P.

2003. Phosphate availability regulates biosynthesis of two antibiotics, prodigiosin and carbapenem, in Serratia via both quorum-sensing-dependent and -independent pathways. Mol Microbiol, 47:303–320.

13.

Steenackers

H.P.

, Levin

, Janssens

J.C.

, De Weerdt

, Balzarini

, Vanderleyden

et al. 2010. Structure-activity relationship of brominated 3-alkyl-5-methylene-2(5H)-furanones and alkylmaleic anhydrides as inhibitors of Salmonella biofilm formation and quorum sensing regulated bioluminescence in Vibrio harveyi. Bioorg Med Chem, 18:5224–5233.

14.

Van Houdt

, Moons

, Hueso Buj

, Michiels

C.W.

2006. N-acyl-L-homoserine lactone quorum sensing controls butanediol fermentation in Serratia plymuthica RVH1 and Serratia marcescens MG1. J Bacteriol, 188:4570–4572.

15.

von Bodman

S.B.

, Majerczak

D.R.

, Coplin

D.L.

1998. A negative regulator mediates quorum-sensing control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. PNAS, 95:7687–7692.

16.

Waters

C.M.

, Bassler

B.L.

2005. Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol, 21:319–346.

17.

Zhu

, Shen

Y.L.

, Wei

D.Z.

, Zhu

J.W.

2008. Inhibition of quorum sensing in Serratia marcescens H30 by molecular regulation. Curr Microbiol, 56:645–650.