Impact of Glutathione Transferase M1,T1,and P1 Gene Polymorphisms in the Genetic Susceptibility of North Indian Population to Renal Cell Carcinoma

Abstract

In this study, we investigated the association of GSTP1, GSTM1, and GSTP1 genetic variants with renal cell carcinoma (RCC) among North Indian patients. The difference in frequency of the GSTT1 null genotype between cases and control subjects was statistically significant (active ver. null, odds ratio [OR]=0.368; confidence intervals [CI] 95%=0.243–0.557, p=0.001). The differences in the frequency of GSTP1 genotypes were statistically significant (AA ver. AG/GG, OR=1.879; CI 95%=0.355–0.797, p=0.002). Higher allelic frequency of the GSTP1 G allele was associated with RCC cases (G ver. A allele, OR=1.534; 95% CI=1.159–2.030, p=0.003). The gene–gene interaction in terms of three-way combination of GSTM1 null, GSTT1 null, and GSTP1 (AG/GG) resulted in 4.5-fold increase in RCC risk (OR=4.452; 95% CI=2.220–9.294). Similarly, our study revealed that GST polymorphism might be a vital determinant of advancement to higher pathological stages and histological grades of RCC. Our findings suggest that genetic variability in members of the GST gene family may be associated with an increased susceptibility to RCC and its progression.

Introduction

I n 2010, ∼58,000 people were diagnosed and about 13,000 died of renal cell carcinoma (RCC) in the United States (Jemal et al., 2010). Worldwide, there were an estimated 270,000 cases and 116,000 deaths in 2008. In India in the year 2010, there were an estimated 9333 incidences of and 6049 mortalities due to kidney cancer (Ferlay et al., 2010). The development of RCC has been linked with many risk factors (Lipworth et al., 2006), out of which smoking, obesity and hypertension are the most well-established. Hereditary xenobiotic metabolizing enzyme variants modifying the risk to RCC has been a controversial one. As differential glutathione-S-transferase (GST) expression markedly influences the anticarcinogenic potential of tissues, GSTs are currently being investigated as biomarkers of risk to various cancers, including RCC. However, results from previous studies of GST polymorphisms and RCC have been inconsistent. Cytosolic GSTs are a superfamily of enzymes that defend normal cells by catalyzing conjugation reactions of electrophilic compounds, including carcinogens, to glutathione adducts. Some GST enzymes possess antioxidant activity against endogenous hydroperoxides. The altered GST activity associated with the polymorphisms is expected to affect cancer risk through decreased protection against DNA damage from reactive electrophiles (Sweeney et al., 2000). GSTs are expressed and have noteworthy activity in the kidney (Brüning et al., 1997; Rowe et al., 1997; Rodilla et al., 1998). Based on their biochemical, immunologic, and structural properties, the mammalian cytosolic GSTs are classified into seven classes, designated Alpha, Mu, Pi, Sigma, Theta, Omega, and Zeta (Hayes et al., 2005). Most of the glutathione transferase isoenzymes are involved in the Phase II detoxification and catalyze conjugation of reduced glutathione with the products of oxidative stress, electrophiles, and DNA-reactive intermediates resulting in detoxification of reactive intermediates (Seidegård et al., 1988). Among them, the GSTM1, GSTT1, and GSTP1 genotypes have been extensively studied for their potential modulating role in individual susceptibility to cancer (McWilliams et al., 1995; Rebbeck, 1997; Taningher et al., 1999).

The glutathione-S-transferase pi gene (GSTP1) is a polymorphic gene encoding active, functionally different GSTP1 variant proteins that are thought to function in xenobiotic metabolism and play a role in susceptibility to cancers. GSTP1 plays a pivotal role in the detoxification of activated forms of polycyclic aromatic hydrocarbon compounds (Hayes and Pulford, 1995). A single nucleotide polymorphism in the GSTP1 gene causes substitution of isoleucine to valine at amino acid codon 105 (Ile105Val) (Zimniak et al., 1994; Hu et al., 1997). This allele variant appears to reduce GSTP1 activity, which could lead to genetic damage and increased cancer risk (Harries et al., 1997). The GSTM1 gene encodes for cytoplasmic glutathione transferase (μ-class). The genes encoding the μ-class (GSTM1) of enzymes are prearranged in a gene cluster on chromosome 1p13.3. These genes are well known for being highly polymorphic in nature. The μ-class enzymes play an important role in the detoxification of electrophilic compounds, polycyclic aromatic hydrocarbons, chemotherapeutic drugs, environmental carcinogens, and reactive oxygen species by conjugation with glutathione (Rebbeck, 1997). GSTM1 enzymes have catalytic activity toward phospholipids, hydroperoxide, substantiating the fact that GSTs may prevent DNA damage from lipid peroxides formed endogenously because of oxidative stress (Hurst et al., 1998; Thier et al., 1998). GSTT1 is located at 22q11.2, and like the GSTM1 deletion polymorphism, produced by a homologous recombination event involving left and right 403 bp repeats resulting in a ∼54-kb deletion containing the entire GSTT1 gene (Parl, 2005). The GSTT1 gene encodes for a class θ-GST that also catalyzes the conjugation of reduced glutathione to electrophilic centers. Substrates of θ-GST include industrial chemicals such as methyl chloride, methyl bromide, dichloromethane, ethylene oxide, and diepoxybutane, a reactive metabolite of 1,3-butadiene (To-Figueras et al., 1997).

Genetic variations can modify an individual's vulnerability to carcinogens and toxins and are expected to affect cancer risk, because of diminished protection against attack of reactive electrophiles on DNA. There are a small number of studies that have considered whether GSTs have a propensity to cause RCC. However, even that paltry number of studies had conflicting reports concerning the role of GSTs in renal carcinogenesis (Brüning et al., 1997; Longuemaux et al., 1999; Sweeney et al., 2003). In addition, a possible role of GST gene polymorphisms in modifying the risk to RCC among the Indian population was not studied. Therefore, to the best of our knowledge, this study is the first to investigate role of GST polymorphisms and their interactions in modifying risk of RCC and its possible correlation with pathological stage and Fuhrman grade in a North Indian population.

Materials and Methods

Subjects

The present case–control study was carried out from December 2008 to February 2011. In this study, a total of 196 (138 males and 58 females) newly diagnosed RCC patients from the North Indian population (from the states of Delhi, Uttar Pradesh, Punjab, Haryana, Rajasthan, and Uttaranchal) registered in the Department of Urology, All India Institute of Medical Sciences (AIIMS), New Delhi, India, were recruited. Patients were recruited after radiologic and histologic diagnosis of RCC. The control group included 250 healthy volunteers (172 men and 78 women), chosen at the same time that were free of any chronic diseases, having no history of any cancer and living in the same geographical area. They were matched with cases by age and sex. Smoking and hypertension were also evaluated during the recruitment of cases and control subjects by means of a patient case record form and a questionnaire respectively. Histopathologic staging and grading was done after nephrectomy and followed the tumor-node-metastasis (TNM) classification of the American Joint Committee on Cancer 6th edition (Greene, 2002). All patients received a patient information sheet and signed a consent form, approved by the Institutional Committee on Human Ethics (ICHE proposal no. P-18/1.09.08). Likewise, control subjects received a volunteer information sheet and signed consent. About 5 mL of peripheral blood was collected from both the patients and healthy volunteers for DNA extraction and then processed for genotyping. To validate the findings of multiplex PCR and RFLP, the analysis of all mutant homozygous samples and 20% of heterozygotes was duplicated and confirmed by direct sequencing with 100% concordance.

DNA isolation

Genomic DNA samples were obtained from blood lymphocytes using a genomic DNA extraction kit (Bioserve biotechnologies Pvt. Ltd.). Isolated DNA was resuspended in Tris EDTA buffer (pH 8.0) and stored at ±20°C until use.

GSTP1 genotyping

The GSTP1 exon 5 Ile105Val polymorphisms were determined by PCR and restriction fragment length polymorphism according to the method of Harris et al. with some modifications (Harries et al., 1997). The PCR amplification was carried out with, 50 ng DNA in 10 mM Tris–HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl₂, 0.3 mM deoxyribonucleotide triphosphates (Fermentas life sciences, Inc.), 200 ng of each primer, and 1.0 U of Taq polymerase (Fermentas life sciences, Inc) in a total volume of 25 μL. Amplification was performed with an initial denaturation step at 95°C for 12 min, followed by 35 cycles at 94°C for 30 s, 54°C for 30 s, and 72°C for 45 s and a final extension at 72°C for 10 min.

The amplification product (20 μL) was digested with 5U of BsmAI (New England Biolabs) in 50 mM NaCl, 10 mM Tris–HCl, 10 mM MgCl₂ and 1 mM dithiothreitol, and then incubated at 55°C for 16 h. The fragments were analyzed on a 3.5% agarose gel with ethidium bromide (0.5 μg/mL). When a BsmAI restriction site was present, the 176 bp fragment was digested into two 91 and 85 bp fragments. Electrophoresis of the digested PCR products showed individuals homozygous (Ile/Ile) for the GSTP1 BsmAI polymorphism as one band of 176 bp. Heterozygotes (Ile/Val) for the polymorphism showed three bands of 176, 91, and 85 bp. Homozygotes (Val/Val) showed two bands of 91 and 85 bp.

GSTM1 and GSTT1 genotyping

GSTM1 and GSTT1 genotyping for gene deletions was carried out by Multiplex PCR as described by Lin et al. (1998) with minor modifications. DNA samples were amplified with the primers as stated by Lin et al., for GSTM1, which produced a 219 bp product; 5′ TCACCGGATCATGGCCAGCA 3′ and 5′ TTCCTTACTGGTCCTCACATCTC 3′ (Clonitec) for GSTT1, which produced a 459 bp product. Amplification of beta actin gene with the primers 5′ GCCCTCTGCTAACAAGTCCTAC 3′ (Clonitec) and 5′ GCCCTAAAAAGAAAATCCCCAATC 3′ (Clonitec) was used as an internal control and produced a 350 bp product. PCR was performed in a final volume of 25 μL, consisting of DNA (0.1 μg), dNTP (0.2 mM each) (Fermentas life sciences, Inc.), MgCl₂ (1.5 mM), each primer (1.0, 0.3, and 0.2 μM for GSTM1, GSTT1, and beta actin, respectively), Taq polymerase (1.25 U) (Fermentas life sciences, Inc.), reaction buffer, and 2% dimethylsulphoxide. Amplification was performed with an initial denaturation at 95°C for 12 min, followed by 35 cycles of amplification, which was performed at 94°C for 45 s, 62°C for 45 s, and 72°C for 45 s and a final extension at 72°C for 10 min, using a Biorad minithermocylcler. The amplified product was observed in an ethidium bromide-stained 1.5% agarose gel. If the study subject is null for the gene, no PCR product is present, but the beta actin gene fragment acts as a positive PCR control. Previously sequenced samples were used as negative and positive controls.

Statistical analysis

Differences in genotype of various isoforms of GST genes between the RCC cases and the control subjects were studied. The chi-square test was performed to verify whether genotypic distribution followed the Hardy–Weinberg law of equilibrium. The associations between the genotypes and the clinicopathologic characteristics at the time of diagnosis of the RCC patients were also assessed for statistical significance using the chi-square test (Fisher's exact test when expected frequencies were small) and chi-square test for trend. Odds ratio (OR) at 95% confidence intervals (95% CI) and p-values were computed by binary logistic regression, and all results were adjusted for age, sex, hypertension, smoking, and body mass index (BMI). The independent sample student t-test was applied to check association between cases and control subjects. p-values < 0.05 were considered statistically significant. All analyses were performed using the statistical package SPSS version 16 (SPSS).

Results

Characteristics associated with increased RCC risk included smoking, high BMI, and hypertension as mentioned in Table 1. Demographic characteristics and exposure histories of cases and control subjects were similar. We examined 196 cases and 250 control subjects for GSTP1, GSTT1, and GSTM1 genotypes. The numbers of patient distribution among different histopathologic subtype of RCC were: Clear RCC–176, Papillary RCC–14, chromophobe RCC–4, and unclassified RCC–2. We performed Pearson's chi-square test of our control population for GSTP1 genotypic distribution. GSTP1 genotypic distribution was according to Hardy–Weinberg equilibrium, with p-value of 0.993.

Table 1.

Associations Between Cigarette Smoking, Body Mass Index, and Hypertension in Renal Cell Carcinoma

Parameter	Cases (n=196)	Control (n=250)	OR	95% (CI)	p-value ^a
Age (yrs) (mean±S.E)	54.21±0.967	54.01±0.916	—	—	0.883^b
Sex
Male	138 (70.4%)	172 (68.8%)	1.079		0.714
Female	58 (29.6%)	78 (31.2%)	1.0 (reference)	0.718–1.621
Hypertension
Present	66 (33.7%)	130 (16.0%)	2.665		0.000
Absent	40 (66.1%)	210 (84.0%)	1.0 (reference)	1.700–4.178
Smoking
Yes	54 (27.6%)	32 (12.8%)	2.591		0.000
No	142 (72.4%)	218 (87.2%)	1.0 (reference)	1.594–4.210
BMI (mean±S.E)	23.67±0.164	22.76±0.126	—	—	0.000^b
Low	69 (35.2%)	115 (46.0%)	1.0 (reference)
Middle	61 (31.1%)	82 (32.8%)	1.2398	0.793–1.936	0.008
High	66 (33.7%)	53 (21.2%)	2.0755	1.298–3.316

p-value (two sided) Pearson Chi-square test.

p-value of t-test for independent samples.

OR, crude odds ratio calculated at 95% confidence interval (95% CI); BMI, body mass index.

According to Table 1, the mean age was matched with 54.21±0.967 and 54.01±0.916 years, in cases and control subjects, respectively, with a p-value=0.883. Among the cases 70 (35.7%) were in stage I, 60 (30.6%) in stage II, and 66 (33.7%) were in stage III+IV, whereas among the cases 42 (21.4%), 122 (33.7%), and 130 (16.3%) were in grades I, II, and III+IV, respectively. The sex ratio was similar in cases and control (p=0.714) (Table 1). Hypertension was present in 66 (33.9%) and 130 (16.0%) of cases and control, respectively, which was significant (p<0.001) with an OR 2.665 (95% CI, 1.700–4.178). Smoking was associated more strongly (p<0.001) with cases 54 (27.6%) than control subjects 142 (12.8%) with an OR of 2.591 (95% CI, 1.594–4.210). Table 1 shows significant difference (p=0.008) in mean BMI, which was 23.67±0.164 and 22.76±0.126 in cases and control subjects, respectively. The high BMI group has higher risk to RCC with an OR=2.075 (95% CI, 1.298–3.316) than low BMI group.

The GSTT1 active genotype was present in 71 (36.2%) and 144 (57.6%) of cases and control subjects, respectively, the difference in their frequency was statistically significant (GSTT1 active ver. null, OR=0.418, 95% CI; 0.285–0.612, p=0.001) as shown in Table 2. Multivariate logistic regression analysis was performed to adjust for age (continuous variable), sex, hypertension, smoking, and BMI (continuous variable). After adjusting for the said parameters, higher frequency of GSTT1 null genotype was strongly associated with cases (GSTT1 active ver. null, OR=0.368; 95% CI, 0.243–0.614; p=0.001). GSTM1 active genotype was present in 94 (48.0%) and 134 (53.6%) of cases and control subjects, respectively, which was not statistically significant (GSTM1 active ver. null, OR=0.798, 95% CI; 0.549–1.160, p=0.253,). Even after adjusting for age (continuous variable), sex, hypertension, smoking, and BMI (continuous variable) in multivariate logistic regression model, the GSTM1 null genotype did not influence overall RCC risk (GSTM1 active ver. null, OR=0.867, 95% CI; 0.582–1.291, p=0.482). Table 2 reveals that GSTP1 GG was significant at approximately twofold higher risk for RCC (OR=2.197, 95% CI; 1.153–4.185, p=0.011) than the GSTP1 AA genotype. Similarly, the GSTP1 AG genotype was at a significantly higher risk for RCC (OR=1.705, 95% CI; 0.973–3.807, p=0.008) than the GSTP1 AA genotype. After adjusting for age (continuous variable), sex, hypertension, smoking, and BMI (continuous variable) both the AG genotype (AG ver. AA, OR=1.924, 95% CI; 0.973–3.807, p=0.060) and GG genotype (GG ver. AA, OR=1.024, 95% CI; 0.519–2.021 p=0.945) did not differ among cases and control subjects significantly. Moreover, univariate analysis revealed that AG and GG combined had a higher risk for RCC than AA genotype (OR=1.789, 95% CI; 1.220–2.622, p=0.002). Table 2 further shows that G allele frequency (38.52%) was higher in RCC cases than control subjects (G allele ver. A allele, OR=1.534, 95% CI; 1.159–2.030, p=0.003) than. Table 3 shows numbers of cases and control subjects according to combined genotypes for GSTT1, GSTM1, and GSTP1. The cumulative effects of combined genotypes were calculated using OR with GSTT1 present, GSTM1 present, and GSTP1 AA as the reference category. Although CIs were large due to the small number of subjects in some categories, there was increased risk associated with GSTT1 null genotype in combination with either of the GSTP1 and GSTM1 genotypes. There was highest risk among the group with GSTM1 null, GSTT1 null and GSTP1 AG or GG genotype with an OR=4.452 (CI 95%, 2.220–9.294).

Table 2.

Multivariate Logistic Regression Model for Association of GST M1, T1, and P1 Polymorphisms and Renal Cell Carcinoma Risk

Genotype	Cases (%)	Control (%)	OR^a	CI (95%)^a	p-value ^a	OR ^b	CI (95%) ^b	p-value ^b
GSTT1
Null	125 (63.8%)	106 (42.4%)	1.0 (ref.)		<0.001	1.0 (ref.)		<0.001
Present	71 (36.2%)	144 (57.6%)	0.418	(0.285–0.614)		0.368	(0.243–0.557)
GSTM1
Null	102 (52.0%)	116 (46.4%)	1.0 (ref.)		0.253	1.0 (ref.)		0.482
Present	94 (48.0%)	134 (53.6%)	0.798	(0.549–1.160)		0.867	(0.582–1.291)
GSTP1
AA	71 (36.2%)	126 (50.4%)	1.0 (ref.)		0.008	1.0 (ref.)		0.060
AG	99 (50.5%)	103 (41.2%)	1.705	(1.142–2.546)	0.011	1.924	(0.973–3.807)	0.945
GG	26 (13.3%)	21 (8.4%)	2.197	(1.153–4.185)		1.024	(0.519–2.021)
AA	71 (36.2%)	126 (50.4%)	1.0 (ref.)		0.002	1.0 (ref.)		0.002
AG/GG	125 (63.8)	124 (49.6%)	1.789	(1.220–2.622)		1.879	(0.355–0.797)
A Allele	241 (61.47%)	355 (71.0%)	1.0 (ref.)		0.003
G Allele	151 (38.52%)	145 (29.0%)	1.534	(1.159–2.030)

p-value (two sided) Fisher's exact test, OR^a: Crude odds ratio calculated at 95% confidence interval (95% CI) of unadjusted multivariate model.

p-value value (two sided) Fisher's exact test, OR^b: Crude odds ratio calculated at 95% confidence interval (95% CI) for adjusted model for sex (categorical), hypertension (categorical), smoking (categorical) and BMI (continuous).

Table 3.

Combined GSTT1, GSTM1, and GSTP1 Genotypes and Renal Cell Carcinoma Risk

	GSTT1 active				GSTT1 null
	Cases	Control subjects	OR	95% CI	Cases	Control subjects	OR	95% CI
GSTM1 present, GSTP1 AA	19	44	1.0	1.0 (ref.)	22	20	2.547	1.133–5.726
GSTM1 present, GSTP1 AG or GG	21	38	1.279	0.600–2.729	32	32	2.315	1.118–4.794
GSTM1 null, GSTP1 AA	10	34	0.681	0.280–1.653	20	28	1.654	0.753–3.632
GSTM1 null, GSTP1 AG or GG	21	28	1.736	0.795–3.791	51	26	4.542	2.220–9.294

OR, crude odds ratio at 95% confidence interval (95% CI).

Interaction among the genotypes was tested in the logistic regression model adjusted for age (continuous variable), sex, smoking, hypertension, and BMI (continuous variable). There was significant statistical significance of interaction between GSTT1 and GSTM1 (active ver. null, OR=0.735; CI 95% CI; 0.616–0.876, p=0.001), GSTT1 active and GSTP1 AA (GSTT1 active, GSTP1 AA ver. GSTT1 null, GSTP1 AG/GG, OR=0.638; 95% CI; 0.535–0.762, p<0.001), between combined GSTT1 active, GSTM1 active, and GSTP1 AG or GG genotypes (OR=0.815, 95% CI; 0.744–0.893, p<0.001).

We also compared the various risk factors with RCC Fuhrman nuclear grade and histopathological stage of RCC. Among the various risk factors, presence of active GSTT1 genotype (51.1%, 27.7%, and 21.3% for stage I, II, and III+IV, respectively) was associated with decreasing stages of RCC (p ^trend=0.003). Similarly, the presence of active GSTM1 allele (51.1%, 30.9%, and 18.1% for stage I, II, and III+IV, respectively) was associated with decreasing stages of RCC (p ^trend<0.001) as shown in Table 4. The decrease in the frequency of GSTP1 AA genotype (52.1%, 35.2%, and 12.7% for stage I, II, and III+IV, respectively) was significantly associated with decreasing stage of RCC (p ^trend<0.001). Higher BMI was significantly associated with higher stages of RCC (Table 4).

Table 4.

Association of Clinicopathological Parameters and Genotypes with Different Cancer Stages

Parameters	Stage I	Stage II	Stage III+IV	p-value ^a
Hypertension
Present	21 (31.8%)	18 (27.3%)	27 (40.9%)	0.184
Absent	49 (37.7%)	42 (32.3%)	39 (30.0%)
Smoking
Yes	13 (24.1%)	20 (37.0%)	21 (38.9%)	0.081
No	57 (40.1%)	40 (28.2%)	45 (31.7%)
BMI
Low	30 (43.5%)	18 (26.1%)	21 (30.4%)	0.024
Middle	23 (37.7%)	23 (37.7%)	15 (24.6%)
High	17 (25.8%)	19 (28.8%)	30 (45.5%)
GSTT1
Null	20 (26.0%)	24 (31.2%)	33 (42.9%)	0.003
Present	24 (51.1%)	13 (27.7%)	10 (21.3%)
GSTM1
Null	22 (21.6%)	31 (30.4%)	49 (48.0%)	<0.001
Present	48 (51.1%)	29 (30.9%)	17 (18.1%)
GSTP1
AA	37 (52.1%)	25 (35.2%)	09 (12.7%)	<0.001
AG+GG	33 (26.4%)	35 (28.0%)	57 (45.6%)

Chi-square test for trend.

BMI, tertile- low, middle and high.

Table 5 reveals that the GSTT1 active genotype (31.0%, 64.8%, and 11.3% in Fuhrman's grade 1, 2, and 3+4, respectively) was significantly associated with increase in Fuhrman's grade (p ^trend=0.012). The decrease in GSTP1 AA genotype (33.8%, 53.5%, and 12.7% in Fuhrman's grade 1, 2, and 3+4, respectively) showed significant increase (p ^trend=0.012) with higher Fuhrman's grade. Hypertension was also significantly associated with higher nuclear grade (p ^trend=0.005). The patients with higher tertile of BMI showed a trend toward higher Fuhrman's grade (p ^trend=0.012).

Table 5.

Association of Clinicopathological Parameters and Genotypes with Fuhrman's Grade

Parameters	Fuhrman's Grade 1	Fuhrman's Grade 2	Fuhrman's Grade 3+4	p-value ^a
Hypertension
Present	06 (9.1%)	46 (69.7%)	14 (21.2%)	0.005
Absent	36 (27.7%)	76 (58.5%)	18 (13.8%)
Smoking
Yes	10 (18.5%)	39 (72.2%)	05 (9.3%)	0.559
No	32 (22.7%)	83 (58.5%)	27 (19.0%)
BMI
Low	22 (31.9%)	40 (58.0%)	07 (10.1%)	0.012
Middle	09 (14.8%)	41 (67.2%)	11 (18.0%)
High	11 (16.7%)	41 (62.1%)	14 (21.2%)
GSTT1
Null	20 (16.0%)	41 (57.7%)	24 (19.2%)	0.012
Present	22 (31.0%)	18 (64.8%)	8 (11.3%)
GSTM1
Null	17 (16.7%)	67 (65.7%)	18 (17.6%)	0.148
Present	25 (26.6%)	55 (58.5%)	14 (14.9%)
GSTP1
AA	24 (33.8%)	38 (53.5%)	09 (12.7%)	0.012
AG+GG	18 (14.4%)	84 (67.2%)	23 (18.4%)

Chi-square test for trend.

Discussion

Tobacco smoking, obesity, and hypertension are established risk factors for RCC and account for about half of the diagnosed cases in the United States (Sweeney et al., 2003; Lipworth et al., 2006). In this study we observed an increase in prevalence of RCC among individuals with hypertension, higher BMI and smoking habits as observed previously (Yuan et al., 1998; Shapiro et al., 1999; Bjørge et al., 2004). The exact reason for the association between obesity and RCC is not known, but investigators have hypothesized that it might be secondary to hormonal changes (increased levels of IGF or oestrogen), decreased immune function, or associated hypertension/diabetes mellitus in obese patients (Moyad, 2001). The frequencies of the GSTM1, GSTT1, and GSTP1 genotypes among control subjects in this study were comparable with previously reported study populations from India (Pandey et al., 2006; Sharma et al., 2006; Singh et al., 2008) and abroad (Harries et al., 1997; Ryberg et al., 1997; Lecomte et al., 2006). Our study showed an increased frequency of the GSTT1 null genotype in RCC cases compared to control subjects. Our findings of an increased incidence of GSTT1 null genotypes among RCC cases suggest that activity of the GSTT1 enzyme protects against development of RCC. The GSTP1 AA genotype was found to be associated with lower risk for RCC compared to GSTP1 AG or GG genotypes. Similarly, our study has shown individuals with the GSTP1 G allele had ∼1.5-fold increased risk compared with the A allele for RCC, which was very significant (p=0.003). In multivariate statistical analysis, age, sex, hypertension, smoking, and BMI-adjusted ORs for GSTT1 and GSTM1 genotypes were similar to crude ORs. The gene–gene interaction analysis showed a cumulative effect, with 4.5-fold increased risk to RCC among the individuals with a combination of GSTT1 null, GSTM1 null, and GSTP1 AG/GG genotype.

The results of our study and other reports suggest that polymorphic variations in the GSTs are associated with cancer susceptibility. It is assumed that the high inter-individual variability of carcinogen-metabolizing enzymes in human kidneys may be involved in the regulation of local levels of carcinogens and mutagens and may underlie inter-individual differences in cancer susceptibility. The plausible explanation of our results may be that renal cells have high metabolic rate and oxygen demand, leading to enhanced endogenous formation of reactive oxidants metabolites. Elevated levels of somatic mutations in kidney were found when compared with other organs (Martin et al., 1996). GST enzyme catalyze conjugation of glutathione with a broad range of substrates including lipid peroxides formed endogenously because of oxidative stress (Hayes and Pulford, 1995). This conjugation of foreign compounds with glutathione leads to the formation of less reactive products that are readily excreted. Association between the GSTT1 null genotype and an inefficient GSTP1 mutant (Ile/Val or Val/Val) and increased RCC risk within Indian RCC patients may be due to the weak protection against the endogenous reactive metabolites and PAHs present in the heavily polluted North Indian environment.

Our study is the first of its kind to report significant increase in risk to advanced RCC stages with GSTM1 null, GSTT1 null, and GSTP1 AG or GG genotype and advanced nuclear grade with GSTT1 null and GSTP1 AG or GG genotype. A study conducted recently in Spain also reported GSTT1 deletion but not GSTM1 deletion to be associated with advanced stages of RCC (Salinas-Sánchez et al., 2011). There was also trend of higher cancer stage and grade with higher BMI. This association may be attributed to compromised protection of less efficient variants of these GST genotypic isoforms of an individual from both environmental and endogenous reactive species. This compromised protection against various toxicants makes patients with RCC more susceptible of progression toward higher stages of cancer.

Several studies have suggested that the GSTM1 and GSTT1 null genotypes are risk factors for bladder, breast, oral, lung, head, and neck cancers (Schnakenberg et al., 2000; Mitrunen et al., 2001; Buch et al., 2002; Hung et al., 2003; Matthias et al., 2003; Burim et al., 2004). Polymorphisms of the GSTP1 gene were first reported by Board et al. (1989). They consisted of an A→G transition of nucleotide 313 in exon 5 involving the substitution of amino acids in the enzyme active site, Ile→Val. These allele variants appear to reduce GSTP1 activity, which could lead to genetic damage and increased cancer risk (Harries et al., 1997; Ryberg et al., 1997). Many studies have been carried out in India also, reporting the role of GST enzyme variants as a risk factor to different diseases. These studies suggested an increase in cancer risk associated with GSTT1 null genotype in oral cancer (Buch et al., 2002; Sharma et al., 2006; Chatterjee et al., 2009), prostate cancer (Mittal et al., 2004), cervical cancer (Singh et al., 2008), and leukemia (Bajpai et al., 2007), in line with the current findings. Similarly, the GSTP1 G allele was also seen to be associated with higher risk than the A allele in some of these studies, matching the results of this study. In most of the mentioned studies in India, the combination of GSTT1 null with GSTM1 null or GSTP1 AG/GG genotypes had an additive risk to cancer compared with each separately.

There have been conflicting reports from other regions t regarding the role of GSTT1, GSTM1, and GSTP1 in RCC. Case–control studies in France (Rodilla et al., 1998) and Spain (Salinas-Sánchez et al., 2011) reported no association between RCC and GSTT1 genotype. Another study in France, a hospital-based case control study, found no association between GSTM1 null, GSTT1 null, or GSTP1 polymorphisms and RCC risk (Longuemaux et al., 1999). The study by Sweeney et al. reported increased risk of RCC with GSTT1 null genotype and thus our results strongly support their claim (2003). On the contrary, in a study done in Germany and a recent study from Serbia, GSTT1 null genotypes were associated with reduced risk of RCC (Brüning et al., 1997; ori et al., 2010). Our results are contrary to Buzio et al. (2003) and Karami et al. (2008), where they reported an increased risk of RCC in participants occupationally exposed to pesticides with active GSTT1 genotype. These conflicting reports may be attributed to demographic variation among the different populations of the world. Another possible explanation of the discrepancy in results from the studies in Europe and India is that the environmental toxins to which people are exposed are different. In the Karami et al. study, pesticide exposure was an important risk factor, and it was only in the patients with documented exposure to pesticides that the active GSTT1 was associated with greater risk of RCC (Karami et al., 2008). As mentioned above, majority of case–control studies in the Indian population have shown strong association of genetic variations to the etiology of different type of cancers. Our results are the first one to reveal the role of polymorphism of GSTs among Indian RCC patients. Our study strongly supports the claim of earlier studies that active GSTT1 genotype and GSTP1 wildtype genotype are important as xenobiotic metabolizing enzymes are required for modulating the effect of exposure to toxicants. In renal cells, these enzymes have an important role in the detoxification of a variety of endogenous and environmental toxicants, thus protecting the DNA from damage that leads to genetic mutation and ultimately to RCC.

Conclusion

In summary, our data suggest that host metabolic variability within the GSTT1, GSTM1, and GSTP1 enzymes may significantly modify the risk of development of RCC and its advancement to higher cancer stages. Moreover, our results suggest that persons with smoking habits, hypertension, and high BMI are more susceptible to developing RCC. This study represents an initial effort to understand the role of genetic variation in xenobiotic metabolizing enzymes in the development of RCC among the Indian population. However, future studies must confirm our findings and define the underlying mechanisms on the molecular level. Studies with larger populations are warranted to replicate and extend this report.

Footnotes

Acknowledgments

The authors are thankful to the Indian Council of Medical Research (ICMR), New Delhi, India, for providing the funds to carry out this research. The authors thank Dr. Guresh Kumar, Department of Biostatistics, AIIMS, New Delhi, India, for providing assistance in the statistical analysis and interpretation of the data.

Disclosure Statement

The authors of this work do not have any conflict of interest with its presentation.

References

Bajpai

, Tripathi

A.K.

, Agrawal

2007. Increased frequencies of glutathione-S-transferase (GSTM1 and GSTT1) null genotypes in Indian patients with chronic myeloid leukemia. Leuk Res, 31:1359–1363.

Bjørge

, Tretli

, Engeland

2004. Relation of height and body mass index to renal cell carcinoma in two million Norwegian men and women. Am J Epidemiol, 160:1168.

Board

P.G.

, Webb

G.C.

, Coggan

1989. Isolation of a cDNA clone and localization of the human glutathione S-transferase 3 genes to chromosome bands 11q13 and 12q13-14. Ann Hum Genet, 53:205–213.

Brüning

, Lammert

, Kempkes

, Thier

, Golka

, Bolt

H.M.

1997. Influence of polymorphisms of GSTM1 and GSTT1 for risk of renal cell cancer in workers with long-term high occupational exposure to trichloroethene. Arch Toxicol, 71:596–599.

Buch

S.C.

, Notani

P.N.

, Bhisey

R.A.

2002. Polymorphism at GSTM1, GSTM3 and GSTT1 gene loci and susceptibility to oral cancer in an Indian population. Carcinogenesis, 23:803.

Burim

R.V.

, Canalle

, Martinelli

A.L.C.

, Takahashi

C.S.

2004. Polymorphisms in glutathione S-transferases GSTM1, GSTT1 and GSTP1 and cytochromes P450 CYP2E1 and CYP1A1 and susceptibility to cirrhosis or pancreatitis in alcoholics. Mutagenesis, 19:291.

Buzio

, De Palma

, Mozzoni

, Tondel

, Buzio

, Franchini

, Axelson

, Mutti

2003. Glutathione S-transferases M1-1 and T1-1 as risk modifiers for renal cell cancer associated with occupational exposure to chemicals. Occup Environ Med, 60:789.

Chatterjee

, Chakrabarti

, Sengupta

, Poddar

, Biswas

, Sengupta

, Talukder

2009. Prevalence of CYP1A1 and GST polymorphisms in the population of Northeastern India and susceptibility of oral cancer. Oncol Res, 17:397–403.

Ferlay

, Shin

H.R.

, Bray

, Forman

, Mathers

, Parkin

D.M.

2010. GLOBOCAN 2002. Int J Cancer, 127:2893–2917.

10.

Greene

F.L.

2002. AJCC Cancer Staging Handbook: from the AJCC Cancer Staging Manual. Springer Verlag: New York, USA.

11.

Harries

L.W.

, Stubbins

M.J.

, Forman

, Howard

G.C.

, Wolf

C.R.

1997. Identification of genetic polymorphisms at the glutathione S-transferase Pi locus and association with susceptibility to bladder, testicular and prostate cancer. Carcinogenesis, 18:641.

12.

Hayes

J.D.

, Flanagan

J.U.

, Jowsey

I.R.

2005. Glutathione transferases. Annu Rev Pharmacol Toxicol, 45:51–88.

13.

Hayes

J.D.

, Pulford

D.J.

1995. The glutathione S-transferase super-gene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol Biol, 30:445–600.

14.

, Xia

, Srivastava

S.K.

, Herzog

, Awasthi

Y.C.

, Ji

, Zimniak

, Singh

S.V.

1997. Activity of four allelic forms of glutathione S-transferase hGSTP1-1 for diol epoxides of polycyclic aromatic hydrocarbons. Biochem Biophys Res Commun, 238:397–402.

15.

Hung

R.J.

, Boffetta

, Brockmoller

, Butkiewicz

, Cascorbi

, Clapper

M.L.

, Garte

, Haugen

, Hirvonen

, Anttila

2003. CYP1A1 and GSTM1 genetic polymorphisms and lung cancer risk in Caucasian non-smokers: a pooled analysis. Carcinogenesis, 24:875.

16.

Hurst

, Bao

, Jemth

, Mannervik

, Williamson

1998. Phospholipid hydroperoxide glutathione peroxidase activity of human glutathione transferases. Biochem J, 332:97.

17.

Jemal

, Siegel

, Xu

, Ward

2010. Cancer statistics, 2010. CA Cancer J Clin, 60:277–300.

18.

Karami

, Boffetta

, Rothman

, Hung

R.J.

, Stewart

, Zaridze

, Navritalova

, Mates

, Janout

, Kollarova

2008. Renal cell carcinoma, occupational pesticide exposure and modification by glutathione S-transferase polymorphisms. Carcinogenesis, 29:1567.

19.

Lecomte

, Landi

, Beaune

, Laurent-Puig

, Loriot

M.A.

2006. Glutathione S-transferase P1 polymorphism (Ile105Val) predicts cumulative neuropathy in patients receiving oxaliplatin-based chemotherapy. Clin Cancer Res, 12:3050.

20.

Lin

D.X.

, Tang

Y.M.

, Peng

, Lu

S.X.

, Ambrosone

C.B.

, Kadlubar

F.F.

1998. Susceptibility to esophageal cancer and genetic polymorphisms in glutathione S-transferases T1, P1, and M1 and cytochrome P450 2E1. Cancer Epidemiol Biomark Prev, 7:1013.

21.

Lipworth

, Tarone

R.E.

, McLaughlin

J.K.

2006. The epidemiology of renal cell carcinoma. J Urol, 176:2353–2358.

22.

Longuemaux

, Delomenie

, Gallou

, Mejean

, Vincent-Viry

, Bouvier

, Droz

, Krishnamoorthy

, Galteau

M.M.

, Junien

, Beroud

, Dupret

J.M.

1999. Candidate genetic modifiers of individual susceptibility to renal cell carcinoma: a study of polymorphic human xenobiotic-metabolizing enzymes. Cancer Res, 59:2903–2908.

23.

Martin

G.M.

, Ogburn

C.E.

, Colgin

L.M.

, Gown

A.M.

, Edland

S.D.

, Monnat

R.J.

1996. Somatic mutations are frequent and increase with age in human kidney epithelial cells. Hum Mol Genet, 5:215.

24.

Matthias

, Jahnke

, Fryer

A.A.

, Strange

R.C.

2003. [First results on the influence of polymorphisms at glutathione S-transferase, cytochrome P450, and tumor necrosis factor gene loci on the development of multiple head and neck cancer] Laryngorhinootologie, 82:25.

25.

McWilliams

J.E.

, Sanderson

B.J.

, Harris

E.L.

, Richert-Boe

K.E.

, Henner

W.D.

1995. Glutathione S-transferase M1 (GSTM1) deficiency and lung cancer risk. Cancer Epidemiol Biomark Prev, 4:589.

26.

Mitrunen

, Jourenkova

, Kataja

, Eskelinen

, Kosma

V.M.

, Benhamou

, Vainio

, Uusitupa

, Hirvonen

2001. Glutathione S-transferase M1, M3, P1, and T1 genetic polymorphisms and susceptibility to breast cancer. Cancer Epidemiol Biomark Prev, 10:229.

27.

Mittal

, Srivastava

D.S.

, Mandhani

, Kumar

, Mittal

2004. Polymorphism of GSTM1 and GSTT1 genes in prostate cancer: A study from North India. Indian J Cancer, 41:115.

28.

Moyad

M.A.

2001. Obesity, interrelated mechanisms, and exposures and kidney cancer. Semin Urol Oncol, 19:270–279.

29.

ori

, Plješa-Ercegovac

, Mati

, Krivi

, Šuvakov

, Tuli

, Mimi-Oka

, Simi

2010. The Role of GSTM1 and GSTT1 polymorphism in patients with renal cell carcinoma. J Med Biochem, 29:204–210.

30.

Pandey

S.N.

, Jain

, Nigam

, Choudhuri

, Mittal

2006. Genetic polymorphisms in GSTM1, GSTT1, GSTP1, GSTM3 and the susceptibility to gallbladder cancer in North India. Biomarkers, 11:250–261.

31.

Parl

F.F.

2005. Glutathione S-transferase genotypes and cancer risk. Cancer Lett, 221:123–129.

32.

Rebbeck

T.R.

1997. Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomark Prev, 6:733.

33.

Rodilla

, Benzie

A.A.

, Veitch

J.M.

, Murray

G.I.

, Rowe

J.D.

, Hawksworth

G.M.

1998. Glutathione S-transferases in human renal cortex and neoplastic tissue: enzymatic activity, isoenzyme profile and immunohistochemical localization. Xenobiotica, 28:443–456.

34.

Rowe

J.D.

, Nieves

, Listowsky

1997. Subunit diversity and tissue distribution of human glutathione S-transferases: interpretations based on electrospray ionization-MS and peptide sequence-specific antisera. Biochem J, 325:481.

35.

Ryberg

, Skaug

, Hewer

, Phillips

D.H.

, Harries

L.W.

, Wolf

C.R.

, Ogreid

, Ulvik

, Vu

, Haugen

1997. Genotypes of glutathione transferase M1 and P1 and their significance for lung DNA adduct levels and cancer risk. Carcinogenesis, 18:1285.

36.

Salinas-Sánchez

A.S.

, Sánchez-Sánchez

, Donate-Moreno

M.J.

, Rubio-del-Campo

, Serrano-Oviedo

, Gimenez-Bachs

J.M.

, Martínez-Sanchiz

, Segura-Martín

, Escribano

2011. GSTT1, GSTM1, and CYP1B1 Gene Polymorphisms and Susceptibility to Sporadic Renal Cell Cancer. Elsevier: Amsterdam, Netherlands.

37.

Schnakenberg

, Breuer

, Werdin

, Dreikorn

, Schloot

2000. Susceptibility genes: GSTM1 and GSTM3 as genetic risk factors in bladder cancer. Cytogenet Genome Res, 91:234–238.

38.

Seidegård

, Vorachek

W.R.

, Pero

R.W.

, Pearson

W.R.

1988. Hereditary differences in the expression of the human glutathione transferase active on trans-stilbene oxide are due to a gene deletion. Proc Natl Acad Sci USA, 85:7293.

39.

Shapiro

J.A.

, Williams

M.A.

, Weiss

N.S.

, Stergachis

, LaCroix

A.Z.

, Barlow

W.E.

1999. Hypertension, antihypertensive medication use, and risk of renal cell carcinoma. Am J Epidemiol, 149:521.

40.

Sharma

, Mishra

, Das

B.C.

, Sardana

, Sharma

J.K.

2006. Genetic polymorphism at GSTM1 and GSTT1 gene loci and susceptibility to oral cancer. Neoplasma, 53:309–315.

41.

Singh

, Sachan

, Devi

, Pandey

S.N.

, Mittal

2008. Association of GSTM1, GSTT1, and GSTM3 gene polymorphisms and susceptibility to cervical cancer in a North Indian population. Am J Obstet Gynecol, 198:303.

42.

Sweeney

, Farrow

D.C.

, Schwartz

S.M.

, Eaton

D.L.

, Checkoway

, Vaughan

T.L.

2000. Glutathione S-transferase M1, T1, and P1 polymorphisms as risk factors for renal cell carcinoma: a case-control study. Cancer Epidemiol Biomark Prev, 9:449.

43.

Sweeney

, Nazar-Stewart

, Stapleton

P.L.

, Eaton

D.L.

, Vaughan

T.L.

2003. Glutathione S-transferase M1, T1, and P1 polymorphisms and survival among lung cancer patients. Cancer Epidemiol Biomark Prev, 12:527.

44.

Taningher

, Malacarne

, Izzotti

, Ugolini

, Parodi

1999. Drug metabolism polymorphisms as modulators of cancer susceptibility. Mutat Res, 436:227–261.

45.

Thier

, Wiebel

F.A.

, Schulz

T.G.

, Hinke

, Bruning

, Bolt

H.M.

1998. Comparison of GST theta activity in liver and kidney of four species. Arch Toxicol Suppl, 20:471–474.

46.

To-Figueras

, Gene

, Gomez-Catalan

, Galan

M.C.

, Fuentes

, Ramon

J.M.

, Rodamilans

, Huguet

, Corbella

1997. Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) polymorphisms and lung cancer risk among Northwestern Mediterraneans. Carcinogenesis, 18:1529–1533.

47.

Yuan

J.M.

, Castelao

J.E.

, Gago-Dominguez

, Ross

R.K.

, Yu

M.C.

1998. Hypertension, obesity and their medications in relation to renal cell carcinoma. Br J Cancer, 77:1508–1513.

48.

Zimniak

, Nanduri

, Pikuła

, Bandorowicz-Pikuła

, Singhal

S.S.

, Srivastava

S.K.

, Awasthi

Y.C.

1994. Naturally occurring human glutathione S-transferase GSTP1-1 isoforms with isoleucine and valine in position 104 differ in enzymic properties. Eur J Biochem, 224:893–899.