BMP15 Gene Is Activated During Human Amniotic Fluid Stem Cell Differentiation into Oocyte-Like Cells

Abstract

The generation of oocyte-like cells (OLCs) from stem cell differentiation in vitro provides an optimal approach for studying the mechanism of oocyte development and maturation. The aim of this study was to investigate the activation of bone morphogenetic protein 15 gene (BMP15) during the differentiation of human amniotic fluid stem cells (hAFSCs) into OLCs. After 15 days of differentiation, OLCs with a diameter of 50–60 μm and zona pellucida (ZP)-like morphology were observed. Reverse transcription-polymerase chain reaction (RT-PCR) analysis showed the BMP15 was activated from approximately day 10 of differentiating hAFSCs and thereafter. The reporter construct pBMP15-enhanced green fluorescent protein (EGFP) was transiently transfected into the differentiated hAFSCs and the EGFP expression driven by the BMP15 promoter was positive in the OLCs. Moreover, RT-PCR analysis showed that the oocyte-specific markers including ZP1, ZP2, ZP3, and c-kit were expressed in the differentiated hAFSCs, and the immunofluorescence assay confirmed that the ZP2 was detected in the OLCs. Quantitative RT-PCR revealed that ZP2 and ZP3 were significantly elevated in the differentiated hAFSCs. Further, in the OLCs derived from hAFSCs, the BMP15 promoter directing the EGFP reporter was colocalized with ZP2. Together, these results illustrated that the BMP15 could be used as an oogenesis marker to track hAFSCs differentiation into the OLCs.

Introduction

T he generation of oocytes in vitro can facilitate the study of oogenesis mechanism and shed new light on the clinical fertility therapy. Previous reports have demonstrated that embryonic stem cells (ESCs) are capable of differentiating into primordial germ cells (PGCs) through the embryoid body (EB) method, and subsequently generating oocyte-like cells (OLCs) and male gametes (Hubner et al., 2003; Toyooka et al., 2003; Geijsen et al., 2004; West et al., 2006; Yu et al., 2009). The spontaneous germ line potential of ESCs has also been confirmed through the detection of specific expression profiles of germ cells and meiosis (Clark et al., 2004; Chen et al., 2007). In addition to the generation of putative gametes, the ESCs could further generate follicle-like ovarian structures, which developed into blastocyst-like embryos by the parthenogenic activation (Lacham-Kaplan et al., 2006). Recent studies have shown that putative germ cells could also be derived from somatic stem cells other than ESCs. For instance, fetal porcine skin stem cells that were induced in the conditional medium were able to form both PGCs and OLCs (Dyce et al., 2006; Linher et al., 2009), and pancreatic stem cells could differentiate into the VASA and growth and differentiation factor-9 (GDF9) positive OLCs from tissue-like structures (Danner et al., 2007). However, human amniotic fluid stem cells (hAFSCs) that have the capacity of differentiating into all three germ layers (De Coppi et al., 2007) have not been investigated for the potential of generating female gametes.

To track and identify specific stages of female gamete induction, reporter constructs have been generated by linking the promoter of germ cell markers with enhanced green fluorescent protein (EGFP), such as Oct4-EGFP (Hubner et al., 2003), GDF9-EGFP (Salvador et al., 2008), and Dazl-EGFP (Linher et al., 2009). However, no report has so far used the bone morphogenetic protein 15 (BMP15) gene as the marker. BMP15 is an oocyte-specific gene that shares high homology with GDF9 (Wu and Matzuk, 2002), and plays crucial roles in both oocyte maturation and fertilization (Pennetier et al., 2004). Further, BMP15 is essential for the granulosa cell development and oocyte function (Su et al., 2004). Therefore, BMP15 is a potential marker to monitor the oogenesis development.

In this study, we demonstrated that hAFSCs, containing extensive self-renewal ability and remaining highly viable in long-term cultures, differentiated into putative female gametes when hAFSCs were induced in the medium supplemented with porcine follicular fluid. The EGFP driven by the promoter of BMP15 gene was observed in the OLCs that were differentiated from hAFSCs, indicating that the BMP15 reporter vector could be used as a marker of studying oocyte differentiation.

Materials and Methods

Cell culture and differentiation

The protocols of handling human and animal specimens in this study were approved by the Ethical Review Board in the hospital of Xi'an Jiaotong University and the Ethics Committee of Northwest A&F University (Xi'an, China). hAFSCs were isolated from human amniotic fluid of the second trimester of gestation as previously described (Wang et al., 2008). Briefly, human amniotic fluid samples were centrifuged at 500 g for 8 min, and the pellets were washed three times with phosphate-buffered saline (PBS). The cell pellets were resuspended and plated onto a six-well culture plate (Costar) containing the alpha modified minimum essential medium (α-MEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS; Gibco), 1% glutamine, and antibiotics (100 U/mL penicillin, 100 μg/mL streptomycin). When the cells came to 80% confluence, the cells were harvested by trypsinization and subcultured at 37°C in 5% CO₂ incubator.

To perform the differentiation, hAFSCs in the passage 10 were dissociated and plated onto a cell plate with the induction medium which consisted of α-MEM supplemented with 5% FBS, 0.1 mM nonessential amino acids, 2 mM l-glutamine (Gibco), and 0.1 mM β-mercaptoethanol and 5% porcine follicular fluid which was twice filtered to exclude cells existing in the follicular fluid. Cells were maintained in the culture medium by replacing half the medium every 3 days. Along with the formation of cell aggregates, some large round cells detached from the surface of plate. Then the resulting culture medium was centrifuged at 500 g for 5 min and the pelleted cells were replated in the fresh induction medium. The induced cells at different time points were trypsinized and collected for the analysis. The karyotype analysis of hAFSCs was performed as previously reported (He et al., 2009). Briefly, hAFSCs were trypsinized, spun down, and then incubated in 0.04 M KCl at 37°C for 20 min. Cells were fixed with ice-cold acetic acid/methanol (1:3). The dispersed cell suspension was smeared on a cold slide, stained with Giemsa, and observed with a microscope.

Plasmid pBMP15-EGFP construction and transfection

The 1137 base pair fragment of human BMP15 promoter region (−1136 to +1 with respect to the start codon) was amplified from genomic DNA of hAFSCs by (PCR) using the primers listed in Table 1. The PCR product was cloned into pMD18-T vector and confirmed by sequencing. The BMP15 fragment was subcloned into the promoterless GFP reporter vector pEGFP1. Positive clones were confirmed by restriction enzyme digestion and named pBMP15-EGFP. The construct was transfected into the induced and uninduced hAFSCs using the Lipofectamin 2000 (Invitrogen) according to the manufacturer's protocol. Six hours after the transfection, the medium was replaced with fresh culture medium. Hoechst 33342 staining was employed to detect the nuclear DNA at 24 h after the transfection. The images were obtained by an Olympus BX-UCB microscope.

Table 1.

The Primers Used for Reverse Transcription-Polymerase Chain Reaction and Quantitative Reverse Transcription-Polymerase Chain Reaction

Gene	DNA sequence	Size (bp)
BMP15-promoter	CTCGAGAGCCTGACTCATCATCTC	1137
	CCGCGGTCTTGAAAGGCTTAGTGT
BMP15	CTGCGGTACATGCTGGAGTTG	298
	AAGGGA AGTGGTTGGTTGGGT
GDF9	ATTACTACCGTTGAACACTTAC	467
	ACAGGATAGGCAGACAGAC
CD117	GGCAGCCAGAAATATCCTCCTTAC	423
	TACCACGGGCTTCTG TCGGTTGG
ZP1	CGCCATGTTCTCTGTCTCAA	218
	CGTTTGTTCACATCCCAGTG
ZP2	CAGACCACCTTCCATCCAGT	365
	ACCTCCTCCCCTGTTTCACT
ZP3	GGCATGTGACAGAAGAAGCA	150
	AGAGTCAGGGACACCACCAC
GAPDH	ACAACTTTGGTATCGTGGAA	456
	AAATTCGTTGTCATACCAGG
ZP2 ^a	TCGACATGCCGAACTGCAC	131
	GGCAGCACTGTTGTTCATGACTC
GAPDH ^a	GCACCGTCAAGGCTGAGAAC	138
	TGGTGAAGACGCCAGTGGA

Primers were used for real-time reverse transcription-polymerase chain reaction.

Reverse transcription-PCR and quantitative reverse transcription-PCR

Total RNA was isolated from cells at different days of differentiation with Trizol (Invitrogen) according to the manufacturer's protocol. One microgram of total RNA was reverse transcribed into cDNA using the oligo-dT primers and RevertAid™ reverse transcriptase (Fermentas). The PCR programs were as follows: the initial denaturation at 95°C for 5 min, 35 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 60 s, and a final extension step at 72°C for 10 min. The expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. Sequences of primers were listed in Table 1. Relative mRNA levels were evaluated by real-time reverse transcription-PCR that was carried out on a programmed thermal cycler (LineGene 9600; BIOER) by using the SYBR Premix Ex Taq^™ II kit (TaKaRa). Generally, the reaction mixture consisted of 2 μL of cDNA, 0.8 μL of forward and reverse primers (10 μM), 10 μL of 2×SYBR Premix Ex Taq, and RNase-free H₂O to make a final volume of 20 μL. The PCR programs contained the initial denaturation at 95°C for 3 min and 40 cycles at 94°C for 15 s and 60°C for 25 s. Relative mRNA levels were determined using the 2^−ΔΔCt method and normalized to GAPDH.

Western blotting

To examine the expression level of VASA, both induced and uninduced hAFSCs were collected and treated with RIPA lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM ethylenediaminetetraacetic acid, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS]). Protein was collected by centrifugation (10 min, 12,000 g, 4°C) and then stored in −80°C. The same amount of protein sample was added into each well and separated on 10% SDS-polyacrylamide gel electrophoresis at 80 V for 2 h. After the electrophoresis, proteins were transferred onto the nitrocellulose membrane that was then blocked by 1% bovine serum albumin (BSA) for 2 h. The membranes were incubated with either polyclonal rabbit anti-human DDX4 (also called Vasa in human) antibody (ab13840, Abcam; 1:1000) or anti-beta actin antibody (ab8229, Abcam; 1:1000) for 2 h, and followed by incubation with HRP-conjugated secondary antibody. Immunoreaction was detected using the ECL kit (Pierce).

Immunofluorescence

To conduct the immunofluorescence, cells were washed twice with PBS and fixed in 4% paraformaldehyde in PBS for 20 min. Fixed cells were washed twice, incubated in PBS containing 0.2% Triton X-100 for 10 min, and then washed three times. Cells were blocked with BSA-blotting buffer (1% BSA, 0.1% Tween 20 in PBS) for 30 min, and then incubated with BSA-blotting buffer plus anti-ZP2 (SC-30222, Santa Cruz; 1:500) antibody overnight at 4°C. After washing three times with PBS, cells were incubated with TRITC conjugated anti-rabbit IgG (Santa Cruz; 1:200) for 45 min at room temperature, and visualized by the fluorescence microscope.

Results

Cell morphology changes during hAFSC differentiation

hAFSCs derived from human amniotic fluid, with the fibroblastic morphology (Fig. 1B1), have been propagated in vitro for more than 45 passages (Wang et al., 2008). The hAFSC cell line hAF-07, which maintained the normal female karyotype (46, xx) and showed the optimal growth potential (Wang et al., 2008), was selected for the induction experiments (Fig. 1A). When hAFSCs were induced in the medium supplemented with 5% porcine follicular fluid for 5 days, a subpopulation of round cells were observed in culture plates (Fig. 1B2). After differentiating hAFSCs for 10 days, cell aggregates were formed and the large extruded cells were observed with a diameter of 30–40 μm (Supplementary Fig. S1A; Supplementary Data are available online at www.liebertonline.com/dna). After 15 days (D15) of differentiation, some of round cells gradually detached from the surface of culture plate and grew bigger in suspension culture (Supplementary Fig. S1B). These cells were surrounded by a structure resembling a zona pellucida (ZP), which was similar to the morphology of oocytes (Fig. 1B3). A few OLCs seemed to develop into the morphology similar to the parthenogenetic embryo during long-term differentiation (D25) (Fig. 1B4). In addition, under the present induction condition, we observed OLCs of various sizes. Some of OLCs floated in the medium and some of them spontaneously developed into multicell clusters similar to an embryo at an early morula stage (Fig. 1B5, B6). Two-cell stage embryos to four-cell stage embryos were observed, which were stained by Hoechst 33342 (Supplementary Fig. S1). These results indicated that hAFSCs could differentiate into OLCs in vitro when hAFSCs were cultured in the conditional medium.

FIG. 1.

Human amniotic fluid stem cells (hAFSCs) differentiated into oocyte-like cells (OLCs). (A) The cytogenetic analysis of hAFSCs revealed a normal female karyotype (46, XX). (B) hAFSCs were induced in the conditional medium supplemented with porcine follicular fluid. (1) The morphology of hAFSCs in the passage 10; (2) cells were induced for 5 days; (3) cells induced for 15 days, showing the OLCs with the structure of zona pellucida; (4) cells were induced for 25 days, representing the early embryo-like morphology; (5, 6), a floating multiple-cell stage embryo with bright-field image (5) or stained with Hoechst 33342 (6).

Construction of pBMP15-EGFP vector

Originally we planned to use GDF9, a member of transforming growth factor beta superfamily and an oocyte specific marker previously reported (Salvador et al., 2008), as the reporter to monitor hAFSCs differentiation. However, the semi-quantitative RT-PCR result showed that GDF9 gene was constitutively expressed in hAFSCs, irrespective of the differentiation status (Fig. 2A). On the other hand, BMP15 that is highly homologous with GDF9 (Wu and Matzuk, 2002) and an oocyte-specific gene was activated from day 10 (D10) of differentiation and thereafter (Fig. 2B), suggesting that BMP15 could be a potential reporter for screening OLCs. Therefore we constructed the BMP15 reporter plasmid pBMP15-EGFP that contained the 1137 base pair BMP15 promoter region that was ligated into the promoterless EGFP reporter vector pEGFP1. The schematic representation of pBMP15-EGFP was shown in Figure 2C.

FIG. 2.

Construction of pBMP15-enhanced green fluorescent protein (EGFP) vector. (A, B) hAFSCs were induced for 0–15 days, and the gene expressions of GDF9 (A) and BMP15 (B) were detected by the semi-quantitative reverse transcription (RT)-polymerase chain reaction (PCR) analysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. D0–D15, induced hAFSCs from day 0 to day 15. (C) The schematic representation of pBMP15-EGFP vector. The EGFP expression is driven by the BMP15 promoter. The construct also contains the neomycin resistant gene driven by the SV40 promoter.

Activation of BMP15 gene in OLCs

The pBMP15-EGFP plasmid was transiently transfected into the induced and uninduced hAFSCs. The EGFP fluorescence signal was observed in the differentiated round cells at D10, but was absent in uninduced hAFSCs cells (Fig. 3A), indicating that BMP15 gene was activated during hAFSCs differentiation. By extending the duration of induction (D15), the OLCs with a diameter of 50–60 μm were formed, and the EGFP expression driven by BMP15 promoter was positive in OLCs (Fig. 3B1, B2). This observation plus the previous RT-PCR result (Fig. 2B) further confirmed that BMP15 gene was activated in OLCs and could be used as the marker to monitor the oocyte development in vitro.

FIG. 3.

BMP15 is activated during hAFSCs differentiation into OLCs. (A) The pBMP15-EGFP plasmid was transiently transfected into hAFSCs (1, 2) and 10-day induced cells (3, 4), respectively. After 24 h, the cell nuclei were stained by Hoechst 33342 and the images were documented by the fluorescent microscope. (1 and 3) EGFP images; (2 and 4) merged Hoechst 33342 staining and fluorescent images. Arrows indicate the round OLCs. (B) The pEGFP-BMP15 plasmid was transfected into OLCs that were induced from hAFSCs for 15 days. (1) Bright-field image; (2) fluorescent image. Color images available online at www.liebertonline.com/dna

Analysis of oocyte specific gene expression during hAFSC induction

The OLCs derived from hAFSCs were characterized by RT-PCR to determine the expression of female gamete specific markers. In the uninduced hAFSCs, the expressions of oocyte markers including ZP1, ZP3, and c-kit were recognizable, whereas the expression of ZP2 was absent. With extending the differentiation term, ZP2 expression was detected at D10 and D15, and the mRNA level of ZP3 was also noticeably elevated. Compared with that in uninduced hAFSCs, c-kit expression was dramatically reduced in the early induction stage (D5). However, c-kit expression was recovered in the later stages of induction (D10 and D15) (Fig. 4A), which was consistent with previous reports (Hubner et al., 2003). Further, the immunofluorescence assay illustrated that the ZP2 expression was positive in the OLCs derived from hAFSCs at day 15 (Fig. 4B). Also, the induced ZP2 was colocalized with EGFP driven by BMP15 promoter in OLCs (Supplementary Fig. S2). The quantitative RT-PCR analysis verified ZP2 and ZP3 activation during hAFSCs differentiation, though the levels were still lower than those of the ovarian control (Fig. 4C). The VASA protein is specifically expressed in the germ cell lineage in both male and female sexes (Noce et al., 2001). In human, VASA is abundant in oocytes and plays a key role in oocyte function (Castrillon et al., 2000). To detect VASA expression, we conducted the western blotting analysis. The results showed that Vasa was not expressed at the early stage of differentiation, but Vasa protein was detected during the later stage of induction (D15) (Fig. 4D).

FIG. 4.

Determination of oocyte-specific markers in OLCs derived from hAFSCs. The hAFSCs were induced for 15 days, and RNA and protein were isolated from induced cells at different time points. D0–D15, cells induced from day 0 to day 15. (A) Semi-quantitative RT-PCR analysis of ZP1, ZP2, ZP3, and c-kit gene expressions at various time points after the induction. GAPDH was used as the internal control. (B) Immunofluorescence analysis of ZP2 expression in OLCs derived from hAFSCs at day 15. (1) Bright-field image; (2) fluorescent image. (C) The quantitative RT-PCR analysis of ZP2 and ZP3 expression in OLCs during hAFSCs differentiation at day 0 (D0) and day 15 (D15). Human ovarian tissue was used as the positive control. GAPDH was used as internal control. The relative expression was demonstrated as fold change by normalizing the expression of ZP2 in D15 as 1, and ZP3 in D0 as 1, respectively. (D) Western blotting analysis of VASA expression in OLCs. Beta-actin was used as the internal control. Color images available online at www.liebertonline.com/dna

Discussion

Compared with the in vitro generation of oocytes from ESCs, the investigations on derivation of female gametes from somatic stem cells are still preliminary (Aflatoonian and Moore 2006; Chen et al., 2007). Several laboratories reported that OLCs could be differentiated from both mouse ESCs (Hubner et al., 2003; Lacham-Kaplan et al., 2006; Novak et al., 2006) and human ESCs (Clark et al., 2004; Kee et al., 2006; Chen et al., 2007) either through the formation of EBs or through the spontaneous differentiation method by removing the factors which promoted the pluripotency (Marques-Mari et al., 2009). Recent studies have shown that the OLCs could be derived from the somatic stem cells such as the skin-derived stem cells (Dyce et al., 2006; 2011; Linher et al., 2009) and the pancreatic stem cells (Danner et al., 2007). In this study we demonstrate that the OLCs could also be induced from hAFSCs.

Follicular fluid has been reported as one major component that facilitates differentiating stem cells into OLCs (Dyce et al., 2006). In our study we found that porcine follicular fluid in the induction medium was one crucial factor that affected hAFSCs differentiation efficiency. The fluid derived from follicles with a diameter of 2–8 mm was able to generate better results than that from the smaller or larger size of follicles. In addition, follicular fluid contains factors such as GDF9, BMP15, stem cell factor (SCF), basic fibroblast growth factor, and oestrogen (Dyce et al., 2006). These factors, which are secreted from granulosa cells, theca cells, and oocytes, play important roles in regulating the follicular development (Jiang et al., 2003; Webb et al., 2003).

Though the promoter of oocyte-specific gene GDF9 has been applied to monitor the differentiation of mouse ESCs into cells with an oocyte phenotype (Salvador et al., 2008), our data suggest that BMP15 rather than GDF9 is a specific and efficient marker to scrutinize oocyte development in hAFSCs differentiation. BMP15 is produced by oocytes and plays important roles within the ovary, such as promoting early folliculogenesis and enhancing cumulus cell expansion (Peng et al., 2009). Previous reports have revealed that BMP15 prevented precocious oocyte maturation in zebrafish to maintain oocyte quality (Clelland et al., 2006; Peng et al., 2009). In addition, c-kit (also known as CD117) is a member of the tyrosine kinase and the receptor of the SCF. c-kit binding the SCF is critical for the survival, proliferation, and development of the stem cells (Linnekin, 1999). c-kit is also used as a critical marker for identifying AFS cells (Chiavegato et al., 2007; Martin-Rendon et al., 2008; Chen et al., 2011) and an early germ lineage maker (Hubner et al., 2003). During the induction of OLCs, c-kit was dramatically reduced at first but was recovered later, which was accordant with the previous report (Hubner et al., 2003).

There are several similarities between OLCs derived from mouse ESCs (Hubner et al., 2003) and those induced from hAFSCs. For instance, both ESCs- and hAFSCs-derived OLCs can express several oocyte-specific genes such as the VASA, c-kit, ZP2, ZP3, GDF9, and BMP15. Also, both OLCs could be spontaneously activated and developed into parthenogenetic embryos at different stages. In addition, there are differences between ESCs-derived OLCs and hAFSCs-derived OLCs. One major difference is the expression pattern of GDF9 that is constantly expressed in hAFSCs, and therefore this may explain why hAFSCs differentiation into OLCs is easier and needs shorter time. In contrast, GDF9 is only detected in OLCs, but not in mouse ESCs. And BMP15 is not detected in either mouse ESCs or hAFSCs, whereas BMP15 is activated in both mouse ESCs-derived OLCs and hAFSCs-derived OLCs. Thus, we chose BMP15 instead of GDF9 as an oocyte-specific reporter during differentiating hAFSCs into OLCs. Another difference is the expression of ZP gene. The ZP that first appears in multilaminar primary oocyte is a glycoprotein membrane surrounding the plasma membrane of an oocyte. The ZP is composed of three major glycoproteins including ZP1, ZP2, and ZP3. ZP1 serves as a linker for ZP2 and ZP3. ZP2 functions as a secondary sperm receptor during fertilization and ZP3 serves as a primary sperm receptor and acrosome reaction-inducer (Wassarman et al., 2004). In the hAFSC cell line hAF-07, ZP1, and ZP3 mRNA were detectable in uninduced cells, and ZP3 expression level was significantly increased during hAFSCs differentiation into OLCs. Further, the expression of ZP2 was only detected in later induction (D10–D15), but undetectable in both uninduced and in early induced cells (D5). Similar observations were reported by Hubner et al. (2003), whereas ZP1 expression was not thoroughly observed in ESCs-derived OLCs.

In summary, our study investigated the hAFSCs differentiation into OLCs that was monitored by BMP15-EGFP reporter, and showed that OLCs derived from hAFSCs maintained multiple features of oocyte morphologically and biologically. The generation of stably transfected cell line with pBMP15-EGFP reporter is the ongoing study that may facilitate sorting OLCs through the flow cytometry. Meanwhile the physiological function of induced OLCs also needs to be investigated.

Footnotes

Acknowledgments

This work was supported by the Major Project of Chinese National Programs for Fundamental Research and Development (“973” plan, 2009CB941002 and 2011CBA1002).

Disclosure Statement

No competing financial interests exist.

References

Aflatoonian

, Moore

2006. Germ cells from mouse and human embryonic stem cells. Reproduction, 132:699–707.

Castrillon

D.H.

, Quade

B.J.

, Wang

T.Y.

, Quigley

, Crum

C.P.

2000. The human VASA gene is specifically expressed in the germ cell lineage. Proc Natl Acad Sci U S A, 97:9585–9590.

Chen

H.F.

, Kuo

H.C.

, Chien

C.L.

, Shun

C.T.

, Yao

Y.L.

, Ip

P.L.

, Chuang

C.Y.

, Wang

C.C.

, Yang

Y.S.

, Ho

H.N.

2007. Derivation, characterization and differentiation of human embryonic stem cells: comparing serum-containing versus serum-free media and evidence of germ cell differentiation. Hum Reprod, 22:567–577.

Chen

, Lu

, Cheng

, Peng

, Wang

2011. Isolation and characterization of porcine amniotic fluid-derived multipotent stem cells. PLoS One, 6:e19964.

Chiavegato

, Bollini

, Pozzobon

, Callegari

, Gasparotto

, Taiani

, Piccoli

, Lenzini

, Gerosa

, Vendramin

, Cozzi

, Angelini

, Iop

, Zanon

G.F.

, Atala

, De Coppi

, Sartore

2007. Human amniotic fluid-derived stem cells are rejected after transplantation in the myocardium of normal, ischemic, immuno-suppressed or immuno-deficient rat. J Mol Cell Cardiol, 42:746–759.

Clark

A.T.

, Bodnar

M.S.

, Fox

, Rodriquez

R.T.

, Abeyta

M.J.

, Firpo

M.T.

, Pera

R.A.

2004. Spontaneous differentiation of germ cells from human embryonic stem cells in vitro. Hum Mol Genet, 13:727–739.

Clelland

, Kohli

, Campbell

R.K.

, Sharma

, Shimasaki

, Peng

2006. Bone morphogenetic protein-15 in the zebrafish ovary: complementary deoxyribonucleic acid cloning, genomic organization, tissue distribution, and role in oocyte maturation. Endocrinology, 147:201–209.

Danner

, Kajahn

, Geismann

, Klink

, Kruse

2007. Derivation of oocyte-like cells from a clonal pancreatic stem cell line. Mol Hum Reprod, 13:11–20.

De Coppi

, Bartsch

Jr. , Siddiqui

M.M.

, Xu

, Santos

C.C.

, Perin

, Mostoslavsky

, Serre

A.C.

, Snyder

E.Y.

, Yoo

J.J.

, Furth

M.E.

, Soker

, Atala

2007. Isolation of amniotic stem cell lines with potential for therapy. Nat Biotechnol, 25:100–106.

10.

Dyce

P.W.

, Liu

, Tayade

, Kidder

G.M.

, Betts

D.H.

, Li

2011. In vitro and in vivo germ line potential of stem cells derived from newborn mouse skin. PLoS One, 6:e20339.

11.

Dyce

P.W.

, Wen

, Li

2006. In vitro germline potential of stem cells derived from fetal porcine skin. Nat Cell Biol, 8:384–390.

12.

Geijsen

, Horoschak

, Kim

, Gribnau

, Eggan

, Daley

G.Q.

2004. Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature, 427:148–154.

13.

Y.L.

, Wu

Y.H.

, He

X.N.

, Liu

F.J.

, He

X.Y.

, Zhang

2009. An immortalized goat mammary epithelial cell line induced with human telomerase reverse transcriptase (hTERT) gene transfer. Theriogenology, 71:1417–1424.

14.

Hubner

, Fuhrmann

, Christenson

L.K.

, Kehler

, Reinbold

, De La Fuente

, Wood

, Strauss

J.F.

3rd , Boiani

, Scholer

H.R.

2003. Derivation of oocytes from mouse embryonic stem cells. Science, 300:1251–1256.

15.

Jiang

J.Y.

, Cheung

C.K.

, Wang

, Tsang

B.K.

2003. Regulation of cell death and cell survival gene expression during ovarian follicular development and atresia. Front Biosci, 8:d222–d237.

16.

Kee

, Gonsalves

J.M.

, Clark

A.T.

, Pera

R.A.

2006. Bone morphogenetic proteins induce germ cell differentiation from human embryonic stem cells. Stem Cells Dev, 15:831–837.

17.

Lacham-Kaplan

, Chy

, Trounson

2006. Testicular cell conditioned medium supports differentiation of embryonic stem cells into ovarian structures containing oocytes. Stem Cells, 24:266–273.

18.

Linher

, Dyce

, Li

2009. Primordial germ cell-like cells differentiated in vitro from skin-derived stem cells. PLoS One, 4:e8263.

19.

Linnekin

1999. Early signaling pathways activated by c-Kit in hematopoietic cells. Int J Biochem Cell Biol, 31:1053–1074.

20.

Marques-Mari

A.I.

, Lacham-Kaplan

, Medrano

J.V.

, Pellicer

, Simon

2009. Differentiation of germ cells and gametes from stem cells. Hum Reprod Update, 15:379–390.

21.

Martin-Rendon

, Sweeney

, Lu

, Girdlestone

, Navarrete

, Watt

S.M.

2008. 5-Azacytidine-treated human mesenchymal stem/progenitor cells derived from umbilical cord, cord blood and bone marrow do not generate cardiomyocytes in vitro at high frequencies. Vox Sang, 95:137–148.

22.

Noce

, Okamoto-Ito

, Tsunekawa

2001. Vasa homolog genes in mammalian germ cell development. Cell Struct Funct, 26:131–136.

23.

Novak

, Lightfoot

D.A.

, Wang

, Eriksson

, Mahdy

, Hoog

2006. Mouse embryonic stem cells form follicle-like ovarian structures but do not progress through meiosis. Stem Cells, 24:1931–1936.

24.

Peng

, Clelland

, Tan

2009. Potential role of bone morphogenetic protein-15 in zebrafish follicle development and oocyte maturation. Comp Biochem Physiol A Mol Integr Physiol, 153:83–87.

25.

Pennetier

, Uzbekova

, Perreau

, Papillier

, Mermillod

, Dalbies-Tran

2004. Spatio-temporal expression of the germ cell marker genes MATER, ZAR1, GDF9, BMP15, and VASA in adult bovine tissues, oocytes, and preimplantation embryos. Biol Reprod, 71:1359–1366.

26.

Salvador

L.M.

, Silva

C.P.

, Kostetskii

, Radice

G.L.

, Strauss

J.F.

3rd . 2008. The promoter of the oocyte-specific gene, Gdf9, is active in population of cultured mouse embryonic stem cells with an oocyte-like phenotype. Methods, 45:172–181.

27.

Y.Q.

, Wu

, O'Brien

M.J.

, Pendola

F.L.

, Denegre

J.N.

, Matzuk

M.M.

, Eppig

J.J.

2004. Synergistic roles of BMP15 and GDF9 in the development and function of the oocyte-cumulus cell complex in mice: genetic evidence for an oocyte-granulosa cell regulatory loop. Dev Biol, 276:64–73.

28.

Toyooka

, Tsunekawa

, Akasu

, Noce

2003. Embryonic stem cells can form germ cells in vitro. Proc Natl Acad Sci, 100:11457–11462.

29.

Wang

, Chen

, Cheng

, Dou

, Wang

2008. Differentiation of human amniotic fluid stem cells into cardiomyocytes through embryonic body formation. Sheng Wu Gong Cheng Xue Bao, 24:1582–1587.

30.

Wassarman

P.M.

, Jovine

, Litscher

E.S.

2004. Mouse zona pellucida genes and glycoproteins. Cytogenet Genome Res, 105:228–234.

31.

Webb

, Nicholas

, Gong

J.G.

, Campbell

B.K.

, Gutierrez

C.G.

, Garverick

H.A.

, Armstrong

D.G.

2003. Mechanisms regulating follicular development and selection of the dominant follicle. Reprod Suppl, 61:71–90.

32.

West

J.A.

, Park

I.H.

, Daley

G.Q.

, Geijsen

2006. In vitro generation of germ cells from murine embryonic stem cells. Nat Protoc, 1:2026–2036.

33.

, Matzuk

M.M.

2002. GDF-9 and BMP-15: oocyte organizers. Rev Endocr Metab Disord, 3:27–32.

34.

, Ji

, Cao

, Zhu

, Li

, Zheng

, Chen

, Feng

2009. Dazl promotes germ cell differentiation from embryonic stem cells. J Mol Cell Biol, 1:93–103.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.14 MB