Association Between VHL Single Nucleotide Polymorphism (rs779805) and the Susceptibility to Prostate Cancer in Chinese

Abstract

The Von Hippel-Lindau (VHL) tumor suppressor gene is a crucial regulator of the hypoxia response pathway and plays an important role in tumorigenesis, particularly in tumor growth and vascularization. We hypothesize that polymorphisms in the functional region of VHL may influence susceptibility to prostate cancer (PCa). We genotyped a potentially functional polymorphism (rs779805) in 5′ UTR region of VHL in a case-control study of 665 PCa patients and 715 cancer-free controls in a Chinese population using the Taqman assay. The genetic associations between the incidence and progression of PCa were assessed by logistic regression. We observed that the rs779805 A>G polymorphism was significantly associated with risk for PCa. Compared with the AA genotype, the AG and AG/GG genotypes were associated with decreased risk of PCa (adjusted odds ratio [OR]=0.79, 95% confidence interval [CI]=0.62–0.99, and adjusted OR=0.76, 95% CI=0.61–0.95, respectively). Further, this decreased risk was more pronounced in the subgroups of nonsmokers (OR=0.73, 95% CI=0.54–0.98), nondrinkers (OR=0.70, 95% CI=0.54–0.91) and patients without family history of cancer (OR=0.72, 95% CI=0.57–0.92). In addition, the decreased risk associated with rs779805 variant genotypes (AG/GG) was more pronounced among the prostate specific antigen (PSA)>20 ng/mL subgroup (OR=0.68, 95% CI=0.49–0.95). Our findings suggest that the rs779805 A>G polymorphism in VHL may confer susceptibility to PCa in the Chinese population.

Introduction

P rostate cancer (PCa) is the most commonly diagnosed cancer in Western men and ranks second only to lung cancer in mortality. In 2010, an estimated 217,730 new cases of PCa and 32,050 deaths were predicted in the U.S. (Jemal et al., 2010). The PCa rate is much lower in Asian men. However, in China, as lifestyles become more Westernized, the incidence of PCa has steadily increased in the recent years (McCracken et al., 2007). The mechanisms underlying the occurrence of PCa remain to be identified. Age, racial background, environmental factors, genetic variants, and sex steroid hormone levels are established risk factors for PCa; however, only a fraction of individuals exposed to these factors develop PCa during their lifetimes, suggesting that genetic factors may play a significant role in prostate carcinogenesis (Dianat et al., 2009). Recently, some studies have suggested that genetic polymorphisms of genes involved in prostate hypoxia may impact susceptibility to PCa (Marignol et al., 2008; Lu and Kang, 2010).

Intratumoral hypoxia is a hallmark of the solid cancers (Hill et al., 2009). It has been shown to be correlated with increased tumor pathogenesis, invasiveness, and metastasis (Stewart et al., 2010). The VHL gene known to act is the causal gene for VHL syndrome disease (Latif et al., 1993), which is characterized by the risk factors of a number of different carcinomas in vivo and in vitro (Kim et al., 2010). The VHL gene product, VHL protein (pVHL), interacts with a number of cellular proteins and is implicated in the control of angiogenesis, extracellular matrix formation, cell metabolism, and mitogenesis (Kaelin, 2005). However, the most well-characterized function of pVHL is its role as the substrate recognition submit of an E3 ubiquitin ligase complex and as a master regulator of hypoxia-inducible factor (HIF) activity by targeting the HIF-alpha subunit for ubiquitination and rapid proteasomal degradation under normoxic conditions (Haase, 2009). HIF-1α is rapidly degraded by ubiquitination through the pVHL in the proteasome. Previous studies have demonstrated that the VHL/HIF-1 pathway plays a significant role in tumor progression and metastasis through activation of various genes linked to regulation of angiogenesis, cell survival, energy metabolism and apoptotic and proliferative responses in vivo and in vitro (Semenza, 2003; Vaupel, 2004). With regard to PCa, upregulation of HIF-1 activity has been shown to be an early event in prostate carcinogenesis in animal model studies (Huss et al., 2001). In PCa cell lines, expression of the HIF-1α protein is positively associated with cell growth rate and metastatic potential (Zhong et al., 1998, 2000). A recent immunohistochemical study illustrated that HIF-1α protein levels were upregulated in most prostatic intraepithelial neoplasia and further enhanced in primary and metastatic PCa (Du et al., 2003; Zhong et al., 2004).

Recently, several genetic association studies have suggested that polymorphisms in HIF1A (encoding HIF-1alpha) influence the susceptibility of PCa, although the results remained inconclusive (Chau et al., 2005; Li et al., 2007; Orr-Urtreger et al., 2007; Foley et al., 2009). We hypothesized that VHL, a crucial regulator of HIF-1, may have potentially functional polymorphisms that might play a role in the development of PCa. Many epidemiological studies have investigated the association between genetic variations in VHL and susceptibility and progression of various cancers, including pheochromocytoma (Waldmann et al., 2009), gastric cancer (Cao et al., 2008), and ovarian cancer (Goode et al., 2011). In our previous study, we observed no association between this SNP (rs779805) and renal cancer (Qin et al., 2011). To the best of our knowledge, there is no epidemiological report regarding the role of any of the VHL gene polymorphisms in PCa in the Chinese population. VHL SNPs were selected based on HapMap data (http://hapmap.ncbi.nlm.nih.gov/). Overall, there polymorphisms were identified in Chinese population in the functional region of VHL (rs779803 in the 5′ flanking region, rs779805 in the 5′UTR region, and rs1462742 in the 3′UTR region) with MAF>5%. However, the three polymorphisms were in complete linkage disequilibrium (r²=1), thus only rs779805 was selected for genotyping.

Materials and Methods

Study subjects

The analysis included 665 patients with diagnosed and histologically confirmed PCa and 705 cancer-free control subjects. All subjects were genetically unrelated and age matched (mean±5 years) ethnic Han Chinese recruited in an ongoing study that began in September 2003 and lasted until January 2010 at The First Hospital of Nanjing Medical University, Nanjing, China. Before recruitment, all subjects were interviewed face-to-face to collect individual demographic data and exposure information, including age, race, history of tobacco and alcohol use, and family history of cancer. Those subjects who had been smoking daily for more than 1 year were defined as smokers and the rest as nonsmokers. Individuals who had imbibed alcohol at least three times per week for at least 6 months prior to the study were defined as drinkers, and the others were considered as nondrinkers. Family history of cancer was defined as any cancer in first-degree relative (parents, siblings, or children). Disease stage was determined by pathologic findings, pelvic computed tomography, magnetic resonance imaging, and radio-nucleotide bone scans. All cases were classified according to World Health Organization criteria. Clinical stage was divided into localized and advanced cancer based on the TNM classification system promulgated by the American Joint Committee on Cancer (Wittekind et al., 2002). Localized PCa was defined as cancer that was detectable upon clinical examination but had not spread outside the prostate (T_1–2N₀M₀). Advanced cancer was defined as the cancer had spread through the prostatic capsule (T_3–4N_XM_X or T_XN₁M_X or T_XN_XM₁). The Gleason score was evaluated by pathologists working at the hospital using the Gleason scoring system (Epstein et al., 2005). Prostate-specific antigen (PSA) is a protein produced by cells of the prostate gland. Based on the EAU Guidelines on PCa and D'Amico's Risk-Based management of PCa, serum PSA value was dimidiated into two groups PSA>20 ng/mL and PSA≤20 ng/mL (Heidenreich et al., 2008; D'Amico, 2011), predicting the likelihood of progression of PCa. After completion of the interview, each subject provided written informed consent and donated 5 mL of blood for genomic DNA extraction. The research protocol was approved by the institutional review board of Nanjing Medical University.

Polymorphism genotyping

The rs779805 A>G polymorphism was genotyped using predesigned TaqMan MGB SNP genotyping assays (Applied Biosystems, Foster City, CA). The primer sequences for the rs779805 A>G polymorphism was as follows: forward primer, 5′ GGAAATACAGTAACGAGTTGGCCTA 3′ and reverse primer, 5′ CGCTCGGTAGAGGATGGAAC 3′. Amplification was performed by using TaqMan Universal Master Mix, 80X SNP Genotyping AssayMix, Dnase-free water, and 10-ng genomic DNA in a final volume of 5 μL per reaction, under the following conditions: with an initial 2 min at 50°C, 10 min at 95°C, followed by 40 cycles of 95°C for 15 sec, and 60°C for 1 min. According to the manufacturer's instructions, amplifications and analysis were performed in the 384-well ABI 7900HT Real Time PCR System (Applied Biosystems) and the Sequence Detection Systems software (SDS 2.3; Applied Biosystems) were used to automatically collect and analyze the data and to generate the genotype calls. Four negative controls were included in each plate to ensure accuracy of the genotyping. For quality control, genotyping was performed by two people independently in a blinded fashion. About 5% of the samples were randomly selected for repeated genotyping, and the results were 100% concordant.

Statistical analysis

The χ² test (for categorical variables) and the student's t-test (for continuous variables) were used to compare the differences in frequency distributions of selected demographic variables, smoking status, alcohol use, family history of cancer in addition to each allele and genotype of the VHL (rs779805) polymorphism between the cases and controls. The associations between the VHL polymorphism and risk of PCa were estimated by ORs at 95% CIs from unconditional univariate and multivariate logistic regression models with the adjustment for age, smoking status, drinking status, and family history of cancer. The statistical power was calculated by using the PS software (http://biostat.mc.vanderbilt.edu/twiki/bin/view/Main/PowerSampleSize). All analyses were performed with the SAS 9.1.3 software (SAS Institute, Cary, NC) with two-sided p values and p<0.05 was considered to be statistically significant. Potential modification of the effect of polymorphism on the risk and progression of PCa was assessed for the above confounding factors by addition of interaction terms in the logistic model and by separate analyses of subgroups of individuals determined by these factors. SNP allele frequencies were tested against departure from Hardy-Weinberg equilibrium using a goodness-of-fit χ² test before analysis.

Results

Characteristics of the study population

The frequency distributions of selected characteristics of the cases and controls are presented in Table 1. There was no significant age difference between the cases and controls (p=0.727). However, there were more smokers and drinkers among the cases than among the controls, and these differences were found to be statistically significant (p=0.023 and p=0.049 for smoking and drinking status, respectively). Further, the frequency of first degree relatives with cancer among the cases was higher than among the controls (p<0.001). Within the PCa group, approximately 58.8% of patients were at the localized stage and 41.2% of patients were in advanced stage; 394 (59.1%) of patients had a high serum PSA level (over 20 ng/mL).

Table 1.

Frequency Distribution of Selected Variables between the Prostate Cancer Cases and Controls

	Case (n=665)		Control (n=715)
Variables	n	%	n	%	p^a
Age (years) (mean±SD)	71.4±8.1		71.2±7.2		0.727
≤71	312	46.9	363	50.8	0.153
>71	353	53.1	352	49.2
Smoking status
No	283	42.6	348	48.7	0.023
Yes	382	57.4	367	51.3
Drinking status
No	468	70.4	537	75.1	0.049
Yes	197	29.6	178	24.9
Family history of cancer
No	539	81.0	663	92.7	<0.001
Yes	126	19.0	52	7.3
Clinical stage
Localized	391	58.8
Advanced	274	41.2
Gleason score
<7	225	33.8
=7	222	33.4
>7	218	32.8
PSA
≤20	271	40.9
>20	394	59.1

t-test for age distributions between the cases and controls; two-sided χ² test for others selected variables between the cases and controls.

Association between VHL rs779805 polymorphism and risk of PCa

Allele frequencies and genotype distributions of VHL rs779805 polymorphism are shown in Table 2. All observed genotype frequencies in both cases and controls conformed to Hardy-Weinberg equilibrium (p=0.36, and p=0.37 for cases and controls respectively). The frequencies of the AA, AG, and GG genotypes in cases were 68.4%, 28.0%, and 3.6%, respectively, and 62.2%, 32.6%, and 5.2%, respectively, in the controls (p=0.042). When we used the most common genotype (rs779805 AA) as a reference, we found that AG and AG/GG genotypes were associated with a statistically significantly decreased risk of PCa (adjusted odds ratio [OR]=0.79, 95% confidence interval [CI]=0.62–0.99 and adjusted OR=0.76, 95% CI=0.61–0.95, respectively). Further, the rs779805 G allele frequency was 17.6% in the cases and 21.6% in the controls. The difference was statistically significant (p=0.012).

Table 2.

Genotype and Allele Frequencies of the VHL rs779805 Polymorphism Among the Prostate Cancer Cases and Controls

	Cases (n=665)		Controls (n=715)
Polymorphisms	n	%	n	%	p^a	Adjusted OR (95% CI)^b
VHL (rs779805)
AA	455	68.4	445	62.2	0.042	1.00 (reference)
AG	186	28.0	233	32.6		0.79 (0.62–0.99)
GG	24	3.6	37	5.2		0.63 (0.37–1.08)
AG+GG	210	31.6	270	37.8	0.016	0.76 (0.61–0.95)
A	1096	82.4	1123	78.5	0.010
G	234	17.6	307	21.5
p_trend					0.012

Two-sided χ² test for the either genotype distributions or allele frequencies between the cases and controls.

Adjusted for age, smoking status, drinking status, and family history of cancer in logistic regression model.

OR, odds ratio; CI, confidence interval.

Stratified analysis of rs779805 polymorphism and risk of PCa

We then evaluated the effect of the rs779805 polymorphism on PCa risk stratified by age, smoking status, drinking status, and family history of cancer. As shown in Table 3, the association between rs779805 polymorphism and the risk of PCa appeared stronger in the subgroups of nonsmokers (OR=0.73, 95% CI=0.54–0.98), nondrinkers (OR=0.70, 95% CI=0.50–0.91), and individuals without any family history of cancer (OR=0.72, 95% CI=0.57–0.92). However, the association between rs779805 polymorphism and PCa risk did not vary by age. Taken together, the rs779805 polymorphism is an independent risk factor for PCa in the Chinese population with the potential confounding factors having no significant modification.

Table 3.

Stratification Analyses between VHL rs779805 Polymorphism and Risk of Prostate Cancer

		Genotypes (cases/controls)
		AA		AG+GG
Variables	Cases/Controls	n	%	n	%	p^a	Adjusted OR ( 95% CI) ^b AG+GG versus AA
Total	665/715	455/445	68.4/62.2	210/270	31.6/37.8	0.016	0.76 (0.61–0.95)
Age
≤71	312/363	214/228	68.6/62.8	98/135	31.4/37.2	0.115	0.77 (0.56–1.06)
<71	353/352	241/217	68.3/61.7	112/135	31.7/38.4	0.065	0.76 (0.55–1.03)
p_interaction							0.879
Smoking status
No	382/367	266/229	69.6/62.4	116/138	30.4/37.6	0.037	0.73 (0.54–0.98)
Yes	283/348	189/216	66.8/62.1	94/132	33.2/37.9	0.219	0.81 (0.58–1.12)
p_interaction							0.607
Drinking status
No	468/537	322/327	68.8/60.9	146/210	31.2/39.1	0.009	0.70 (0.54–0.91)
Yes	197/178	133/118	67.5/66.3	64/60	32.5/33.7	0.802	0.95 (0.62–1.47)
p_interaction							0.254
Family history of cancer
No	539/663	371/407	68.8/61.4	168/256	31.2/38.6	0.007	0.72 (0.57–0.92)
Yes	126/52	84/38	66.7/73.1	42/14	33.3/26.9	0.402	1.47 (0.71–3.04)
p_interaction							0.100

Two-sided χ² test for the distributions between the cases and controls.

Adjusted for age, smoking status, drinking status, and family history of cancer in logistic regression model.

Association between VHL polymorphism and clinicopathological characteristics of PCa patients

We also assessed the effects of the AG/GG genotypes on the severity of PCa, and investigated the association between the rs779805 polymorphism and clinicopathological characteristics of the PCa patients. As shown in Table 4, the genotypes of AG/GG occurred less frequently in patients with PSA≥20 ng/mL (adjusted OR=0.68, 95% CI=0.49–0.95). There were no other significant associations between the genotypes and clinical stage and Gleason score among the PCa patients.

Table 4.

VHL rs779805 Polymorphism and Clinicopathological Characteristics in Patients with Prostate Cancer

	Genotypes, n (%)
Variables	AA	AG+GG	p^a	Adjusted OR (95% CI)^a AG+GG versus AA
Clinical Stage^b			0.550
Localized	264 (67.5)	127 (32.5)		1.00 (reference)
Advanced	191 (69.7)	83 (30.3)		0.90 (0.64–1.25)
Gleason Score			0.340
<7	162 (72.0)	63 (28.0)		1.00 (reference)
=7	146 (65.8)	76 (34.2)		1.32 (0.88–1.99)
>7	147 (67.4)	71 (32.6)		1.26 (0.84–1.90)
PSA (ng/mL)			0.023
≤20	172 (63.5)	99 (36.5)		1.00 (reference)
>20	283 (71.8)	111 (28.2)		0.68 (0.49–0.95)

The p value and ORs were calculated and adjusted for age, smoking, drinking, and family history of cancer in logistic regression model.

Localized: T_1–2N₀M₀; Advanced: T_3–4N_xM_x or T_xN₁M_x or T_xN_xM₁. Clinical staging according to the international TNM system for PCa.

Discussion

In the current study, we assessed the association between the rs779805 A>G polymorphism and the risk of occurrence and progression of PCa in the Chinese population. Compared with individuals with the rs779805 A allele, we observed that individuals carrying G allele were significantly associated with the decreased risk for PCa, and individuals with variant genotypes were associated with low serum PSA (PSA≤20 ng/mL). To the best of our knowledge, this is the first study on the genetic association between the VHL polymorphism and the risk of PCa to confirm the initial hypothesis that genetic variations in VHL play a role in the pathogenesis of this malignancy.

Although hypoxia is emerging as a common feature of PCa and the development of hypoxia-targeted therapies is becoming more common, their clinical potential still appears to have been underestimated. The VHL/HIF-1α pathway plays a central role in adaptation to hypoxic environments. Previous investigators have observed that high HIF-1α levels were associated with tumor progression and poor prognosis (Lu and Kang, 2010). Zhong et al. (1999) suggested that HIF-1α was upregulated in primary PCa relative normal prostate epithelium. They confirmed that the overexpression of HIF-1α is an early event in prostate carcinogenesis (Zhong et al., 2004). High levels of HIF-1α protein have many possible causes. One possible explanation is aberration of VHL expression, which can lead to overexpression of HIF-1. Accumulation studies have suggested that SNPs in the functional region may influence the expression and functions of these genes (Putra et al., 2011; Theodoropoulos et al., 2011). Additionally, according to the web-based SNP analysis tool, TFSEARCH 1.3, we speculate that the rs779805 SNP might disrupt the predicted transcription factors binding site of c-Myb. Therefore, SNPs in functional region of VHL might also impact the expression of VHL. In the present study, we observed individuals carrying G allele were significantly associated with decreased risk for PCa. Given the location of this polymorphism and in silico predictions, the genetic association between rs779805 A>G and PCa is biologically plausible. One possible mechanism is that the A to G substitution of this polymorphism may increase the transcription and expression of VHL, which then plays a protective role in PCa carcinogenesis by downregulating expression of HIF-1. However, according to the HapMap database, it should be noted that the other two polymorphisms of VHL (rs779803 and rs1642742) are in complete linkage disequilibrium with rs779805. An in silico analysis of the VHL sequence predicted that rs779803 G>A polymorphism in the 5′ region of VHL generated a latent seed site for oct-1. These polymorphisms may also individually or jointly influence the expression of VHL by altering the affinity of transcription factor binding to the promoter or mRNA stability, which may further affect the expression level of HIF-1α.

In the current study, our results showed that smoking and drinking status were risk factors for PCa. In stratified analysis, we found that the decreased risk associated with VHL polymorphism was more pronounced in nonsmokers and nondrinkers, suggesting genetic effects might be overwhelmed by environmental effects. We also observed the effect of rs779805 polymorphism on the risk of PCa was more predominant among people without family history of cancer, suggesting that the polymorphism effect might be overwhelmed by the effect of other inherited genetic factors.

In addition, we did not find any association between polymorphism and pathological stage of PCa. However, we did observe that rs779805 AG./GG genotypes had a significant protective role in the patients with PSA over 20 ng/mL. The finding may arise from the significant relationship between serum PSA and hypoxia (Pipinikas et al., 2008). The clinical link between PSA levels and hypoxic fraction remains to be determined. One plausible mechanism is that hypoxia may enhance PSA expression, and increase the transcriptional activity of androgen receptors and PSA through HIF (Park et al., 2006; Horii et al., 2007; Mitani et al., 2010). Taken together, our results indicate that there might be different mechanisms underlying the early development and subsequent progression of PCa, and the SNP (rs779805) in the VHL gene may contribute to the progression of PCa.

Some limitations of the study should be addressed. First, our sample size is moderate and the statistical power of the study is limited, especially regarding stratification and interaction analysis. However, our post hoc power calculation suggests that we had an 81% power to detect an OR of 1.42 or greater and a minimal OR of 0.68 with an exposure frequency of 22% at the current sample size. Second, our controls were recruited from the hospital, so we could not exclude the inherent selection bias for any particular genotype. However, the genotype distributions of the controls in our study were similar to distributions reported to as typical for Asian population in other studies and conformed to Hardy-Weinberg Equilibrium (Droma et al., 2008; Qin et al., 2011). Third, ethnic variation is known to be a major risk for PCa. We found that genotype frequencies of rs779805 were different from the data population-wide genotype distribution reported in the NCBI dbSNP database. In our study with 715 control subjects, the frequencies of the AA, AG, and GG genotypes were 62.2%, 32.6%, and 5.2%, respectively, compared with 42.3%, 47.7%, and 9.9% in ss1596002 European samples (HapMap-CEU, n=222). Although the vital association between VHL and susceptibility to PCa came from a biologically based a priori hypothesis, our findings should be independently verified in other populations with a higher incidence, particularly in Caucasian. Last, the lack of detailed information on risk factors such as dietary habits, occupational exposures, and physical activity may limit the statistical power of our research. Therefore, a well-designed study involving the collection of more detailed information from more populations is warranted to confirm our finding.

Conclusions

Our present study revealed the association between the rs779805 polymorphism of VHL and susceptibility to PCa. We found that the variant G allele of rs779805 is associated with decreased risk of PCa. These findings suggest the rs779805 polymorphism may be a marker for genetic susceptibility to PCa. Further study is needed to investigate the relationship between VHL polymorphisms and the regulation of expression and function of VHL. A survey of the interactions between genetic and nongenetic risk factors including dietary habit and environmental factors must be performed to evaluate their contribution to the risk of PCa in the Chinese population.

Footnotes

Acknowledgments

We thank all the people who helped in this study. This study was partly supported by the Program for Development of Innovative Research Team in the First Affiliated Hospital of Nanjing Medical University, Provincial Initiative Program for Excellency Disciplines, Jiangsu Province and the National Natural Science Foundation of China (81171963).

Disclosure Statement

No competing financial interests exist.

References

Cao

, Song

J.H.

, Kim

C.J.

, Cho

Y.G.

, Kim

S.Y.

, Nam

S.W.

et al. 2008. Genetic and epigenetic analysis of the VHL gene in gastric cancers. Acta Oncol, 47:1551–1556.

Chau

C.H.

, Permenter

M.G.

, Steinberg

S.M.

, Retter

A.S.

, Dahut

W.L.

, Price

D.K.

et al. 2005. Polymorphism in the hypoxia-inducible factor 1alpha gene may confer susceptibility to androgen-independent prostate cancer. Cancer Biol Ther, 4:1222–1225.

D'Amico

A.V.

2011. Risk-based management of prostate cancer. N Engl J Med, 365:169–171.

Dianat

S.S.

, Margreiter

, Eckersberger

, Finkelstein

, Kuehas

, Herwig

et al. 2009. Gene polymorphisms and prostate cancer: the evidence. BJU Int, 104:1560–1572.

Droma

, Ota

, Hanaoka

, Katsuyama

, Basnyat

, Neupane

et al. 2008. Two hypoxia sensor genes and their association with symptoms of acute mountain sickness in Sherpas. Aviat Space Environ Med, 79:1056–1060.

, Fujiyama

, Chen

, Masaki

2003. Expression of hypoxia-inducible factor 1alpha in human normal, benign, and malignant prostate tissue. Chin Med J (Engl), 116:1936–1939.

Epstein

J.I.

, Allsbrook

W.C.

Jr. , Amin

M.B.

, Egevad

L.L.

2005. The 2005 International society of urological pathology (ISUP) consensus conference on gleason grading of prostatic carcinoma. Am J Surg Pathol, 29:1228–1242.

Foley

, Marignol

, Thomas

A.Z.

, Cullen

I.M.

, Perry

A.S.

, Tewari

et al. 2009. The HIF-1alpha C1772T polymorphism may be associated with susceptibility to clinically localised prostate cancer but not with elevated expression of hypoxic biomarkers. Cancer Biol Ther, 8:118–124.

Goode

E.L.

, Maurer

M.J.

, Sellers

T.A.

, Phelan

C.M.

, Kalli

K.R.

, Fridley

B.L.

et al. 2011. Inherited determinants of ovarian cancer survival. Clin Cancer Res, 16:995–1007.

10.

Haase

V.H.

2009. The VHL tumor suppressor: master regulator of HIF. Curr Pharm Des, 15:3895–3903.

11.

Heidenreich

, Aus

, Bolla

, Joniau

, Matveev

V.B.

, Schmid

H.P.

et al. 2008. EAU guidelines on prostate cancer. Eur Urol, 53:68–80.

12.

Hill

R.P.

, Marie-Egyptienne

D.T.

, Hedley

D.W.

2009. Cancer stem cells, hypoxia and metastasis. Semin Radiat Oncol, 19:106–111.

13.

Horii

, Suzuki

, Kondo

, Akimoto

, Nishimura

, Yamabe

et al. 2007. Androgen-dependent gene expression of prostate-specific antigen is enhanced synergistically by hypoxia in human prostate cancer cells. Mol Cancer Res, 5:383–391.

14.

Huss

W.J.

, Hanrahan

C.F.

, Barrios

R.J.

, Simons

J.W.

, Greenberg

N.M.

2001. Angiogenesis and prostate cancer: identification of a molecular progression switch. Cancer Res, 61:2736–2743.

15.

Jemal

, Siegel

, Xu

, Ward

2010. Cancer statistics, 2010. CA Cancer J Clin, 60:277–300.

16.

Kaelin

W.G.

2005. The von Hippel-Lindau tumor suppressor protein: roles in cancer and oxygen sensing. Cold Spring Harb Symp Quant Biol, 70:159–166.

17.

Kim

J.J.

, Rini

B.I.

, Hansel

D.E.

2010. Von Hippel Lindau syndrome. Adv Exp Med Biol, 685:228–249.

18.

Latif

, Duh

F.M.

, Gnarra

, Tory

, Kuzmin

, Yao

et al. 1993. von Hippel-Lindau syndrome: cloning and identification of the plasma membrane Ca (++)-transporting ATPase isoform 2 gene that resides in the von Hippel-Lindau gene region. Cancer Res, 53:861–867.

19.

, Bubley

G.J.

, Balk

S.P.

, Gaziano

J.M.

, Pollak

, Stampfer

M.J.

et al. 2007. Hypoxia-inducible factor-1alpha (HIF-1alpha) gene polymorphisms, circulating insulin-like growth factor binding protein (IGFBP)-3 levels and prostate cancer. Prostate, 67:1354–1361.

20.

, Kang

2010. Hypoxia and hypoxia-inducible factors: master regulators of metastasis. Clin Cancer Res, 16:5928–5935.

21.

Marignol

, Coffey

, Lawler

, Hollywood

2008. Hypoxia in prostate cancer: a powerful shield against tumour destruction? Cancer Treat Rev, 34:313–327.

22.

McCracken

, Olsen

, Chen

M.S.

Jr. , Jemal

, Thun

, Cokkinides

et al. 2007. Cancer incidence, mortality, and associated risk factors among Asian Americans of Chinese, Filipino, Vietnamese, Korean, and Japanese ethnicities. CA Cancer J Clin, 57:190–205.

23.

Mitani

, Yamaji

, Higashimura

, Harada

, Nakano

, Inui

2010. Hypoxia enhances transcriptional activity of androgen receptor through hypoxia-inducible factor-1alpha in a low androgen environment. J Steroid Biochem Mol Biol, 123:58–64.

24.

Orr-Urtreger

, Bar-Shira

, Matzkin

, Mabjeesh

N.J.

2007. The homozygous P582S mutation in the oxygen-dependent degradation domain of HIF-1 alpha is associated with increased risk for prostate cancer. Prostate, 67:8–13.

25.

Park

S.Y.

, Kim

Y.J.

, Gao

A.C.

, Mohler

J.L.

, Onate

S.A.

, Hidalgo

A.A.

et al. 2006. Hypoxia increases androgen receptor activity in prostate cancer cells. Cancer Res, 66:5121–5129.

26.

Pipinikas

C.P.

, Carter

N.D.

, Corbishley

C.M.

, Fenske

C.D.

2008. HIF-1alpha mRNA gene expression levels in improved diagnosis of early stages of prostate cancer. Biomarkers, 13:680–691.

27.

Putra

A.C.

, Tanimoto

, Arifin

, Hiyama

2011. Hypoxia inducible factor-1alpha polymorphisms are associated with genetic aberrations in lung cancer. Respirology, 16:796–802.

28.

Qin

, Cao

, Ju

, Wang

, Meng

, Zhu

et al. 2011. The polymorphisms in the VHL and HIF1A genes are associated with the prognosis but not the development of renal cell carcinoma. Ann Oncol[Epub ahead of print]10.1093/annonc/mdr325.

29.

Semenza

G.L.

2003. Targeting HIF-1 for cancer therapy. Nat Rev Cancer, 3:721–732.

30.

Stewart

G.D.

, Ross

J.A.

, McLaren

D.B.

, Parker

C.C.

, Habib

F.K.

, Riddick

A.C.

2010. The relevance of a hypoxic tumour microenvironment in prostate cancer. BJU Int, 105:8–13.

31.

Theodoropoulos

G.E.

, Gazouli

, Vaiopoulou

, Leandrou

, Nikouli

, Vassou

et al. 2011. Polymorphisms of Caspase 8 and Caspase 9 gene and colorectal cancer susceptibility and prognosis. Int J Colorectal Dis, 26:1113–1118.

32.

Vaupel

2004. The role of hypoxia-induced factors in tumor progression. Oncologist, 9,Suppl 5:10–17.

33.

Waldmann

, Langer

, Habbe

, Fendrich

, Ramaswamy

, Rothmund

et al. 2009. Mutations and polymorphisms in the SDHB, SDHD, VHL, and RET genes in sporadic and familial pheochromocytomas. Endocrine, 35:347–355.

34.

Wittekind

, Compton

C.C.

, Greene

F.L.

, Sobin

L.H.

2002. TNM residual tumor classification revisited. Cancer, 94:2511–2516.

35.

Zhong

, Agani

, Baccala

A.A.

, Laughner

, Rioseco-Camacho

, Isaacs

W.B.

et al. 1998. Increased expression of hypoxia inducible factor-1alpha in rat and human prostate cancer. Cancer Res, 58:5280–5284.

36.

Zhong

, Chiles

, Feldser

, Laughner

, Hanrahan

, Georgescu

M.M.

et al. 2000. Modulation of hypoxia-inducible factor 1alpha expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/AKT/FRAP pathway in human prostate cancer cells: implications for tumor angiogenesis and therapeutics. Cancer Res, 60:1541–1545.

37.

Zhong

, De Marzo

A.M.

, Laughner

, Lim

, Hilton

D.A.

, Zagzag

et al. 1999. Overexpression of hypoxia-inducible factor 1alpha in common human cancers and their metastases. Cancer Res, 59:5830–5835.

38.

Zhong

, Semenza

G.L.

, Simons

J.W.

, De Marzo

A.M.

2004. Up-regulation of hypoxia-inducible factor 1alpha is an early event in prostate carcinogenesis. Cancer Detect Prev, 28:88–93.