Abstract
NANOG is a critical homeodomain transcription factor responsible for maintaining embryonic stem cell (ESC) self-renewal and pluripotency. In the present study, we isolated, sequenced, and characterized the NANOG gene in buffalo ESC-like cells. Here, we demonstrated that NANOG mRNA is expressed as multiple isoforms and uses four alternative transcriptional start sites (TSSs) and five different polyadenylation sites. The TSSs identified by 5′-RNA ligase-mediated rapid amplification of cDNA ends (RLM-5′-RACE) were positioned at 182, 95, 35, and 17 nucleotides upstream relative to the translation initiation codon. 3′-RACE experiment revealed the presence of tandem polyadenylation signals, which leads to the expression of at least five different 3′-untranslated regions (269, 314, 560, 566, and 829 nucleotides). Expression analysis showed that these alternatively polyadenylated transcripts expressed differentially. Sequence analysis showed that the open reading frame of buffalo NANOG codes for a 300-amino-acid-long protein. Further, results showed that alternative splicing leads to the expression of two types of transcript variants encoded by four and five exons. In silico analysis of cloned 5′-flanking region (3366 nucleotides upstream of translation start codon) identified several putative transcription factors binding sites in addition to a TATA box and CAAT box at −30 and −139 bp (upstream to the distal most TSS), respectively, in the buffalo NANOG promoter.
Introduction
Transcriptional initiation (selection of transcriptional start sites [TSSs]) and mRNA polyadenylation are the integral parts of gene expression and crucial steps in gene regulation. The core promoter is the minimal region of DNA required for RNA polymerase II (Pol II) to assemble with the general transcription factors and form the preinitiation complex for initiation of activator-independent (basal) transcription (Gross and Oelgeschlager, 2006). At the center of the core promoter is the initiator (INR) sequence that contains the TSS, which is defined as the most 5′-nucleotide of mRNA transcribed by Pol II (Gross and Oelgeschlager, 2006; Sandelin et al., 2007). During the maturation of most eukaryotic mRNA, a polyadenine [poly(A)] tail is added to the cleaved 3′-end of a precursor mRNA (pre-mRNA) post-transcriptionally. Such a modification of mRNA has been shown to affect its stability, translation competence, and nuclear-to-cytoplasmic export (Danckwardt et al., 2008). The post-transcriptional processing of mRNA is an event that has also been found tightly coupled with splicing and transcription termination (Proudfoot et al., 2002; Proudfoot, 2004). Thus, it is an essential and critical processing event as an integral part of gene expression. The polyadenylation process requires two major components: the cis-elements or poly(A) signals of the pre-mRNA, and the trans-acting factors that carry out the cleavage and addition of the poly(A) tail at the 3′-end. These trans-acting factors are a complex of about 25–30 proteins involved in signal recognition, cleavage, and polyadenylation (Proudfoot, 2004).
Despite the advances in the knowledge of the functional role of pluripotency-maintaining factors, very little is known about the transcriptional regulation of NANOG in ESCs. In this study, we sought to characterize and isolate the NANOG gene from ESC-like cells of buffalo, a domestic farm animal. To understand the mechanisms involved in the transcriptional regulation of NANOG, we first characterized the TSSs in buffalo ESC-like cells. Correct identification of the TSS in buffalo ESC-like cells will lead to the location of the NANOG core promoter, including core and cis-acting elements, and provide insights into the molecular mechanisms involved in expression. In addition, NANOG mRNA transcripts resultant of alternative polyadenylation has also been elucidated.
Material and Methods
All the chemicals and media were purchased from Sigma Chemical Co. and the disposable plastic wares were from Nunc unless otherwise indicated.
ESC derivation, maintenance, and characterization
Buffalo ESC-like cells were isolated and characterized as described earlier (Verma et al., 2007; George et al., 2011). Briefly, blastocyst-derived ESC-like cells were cultured onto mitomycin C (10 μg mL−1)-treated buffalo fetal fibroblast feeder layers in ESC medium, which comprised of Knockout DMEM (Invitrogen Corporation)+15% Knockout serum replacer (Invitrogen)+2 mM
RNA isolation and RT-PCR
Total RNA was prepared from cultured buffalo ESC-like cells. Isolation of total RNA was performed with TRI reagent (Ambion) according to the manufacturer's instruction. The cDNA was synthesized using SuperScript III First-Strand Synthesis System (Invitrogen). RT-PCR was performed and amplified PCR products were cloned in pGEM-T Easy vector (Promega) and verified by DNA sequencing.
Isolation and cloning of open reading frame
The cDNA prepared using ESC-like cells was used for PCR amplification of complete open reading frame (ORF) of NANOG. Primers used for amplification were 5′ TCACA CCCGGAGATCTTCACCTT 3′ (sense primer) and 5′ TTGT ACTTTTGCCCCCTGTGCTT 3′ (antisense primer) based on bovine (GenBank accession No. NM_001025344.1). The PCR products were cloned into the pGEM-T vector and multiple clones were sequenced. Genomic fragments of the coding region were amplified and sequenced to verify the exon–intron boundaries of NANOG in buffalo.
The 5′- and 3′-rapid amplification of cDNA ends
The 5′- and 3′-RNA ligase-mediated rapid amplification of cDNA ends (5′- and 3′-RLM-RACE) was performed with FirstChoice® RLM-RACE Kit (Ambion) according to the manufacturer's protocol. Briefly, 1 μg of total RNA from buffalo ESC-like cells was treated with calf intestinal phosphatase to remove the 5′-phosphates from any degraded or noncapped mRNA, followed by treatment with tobacco acid pyrophosphatase (TAP) to remove the 5′-cap structure from full-length mRNA, leaving a 5′-monophosphate. A 5′-RACE RNA adapter oligonucleotide was ligated to the TAP-treated mRNA using T4 RNA ligase. After adapter ligation, mRNA was reverse-transcribed using moloney murine Leukemia virus (M-MLV) reverse transcriptase and random decamers. The regions corresponding to the legitimate 5′-ends of the capped mRNA species were amplified by two consecutive PCR amplifications. The first round of PCR was performed using a sense FirstChoice 5′-RLM RACE outer primer (5′ GCTGATGGCGATGAAT GAACACTG 3′) and an antisense NANOG-specific primer (5′ GGGACCGTCTCTTCCTTCTC 3′). A nested PCR amplification was carried out using 2 μL outer PCR products as a template DNA with a sense FirstChoice 5′-RLM RACE inner primer (5′ CGCGGATCCGAACACTGCGTTTGCTGGCT TTGATG 3′) and a nested antisense NANOG-specific primer (5′-GGA GGA GGG AAG AGG AGA GA-3′).
To obtain 3′-ends of NANOG, 2 μg total RNA was reverse-transcribed using 3′-RACE adapter primers. After cDNA synthesis, the 3′-end of RNA was obtained by two rounds of PCR amplification. The first round of PCR was performed using an antisense FirstChoice 3′-RACE outer primer (5′ GCGAGCACAGAATTAATACGACT 3′) and a NANOG gene-specific outer sense primer (5′GTTTTGAGGCTTTGCAGCTC 3′). A nested PCR amplification was performed using 1 μL PCR product of first-round amplification, using FirstChoice 3′-RACE inner antisense primer (5′ CGCGGA TCCGAATTAATACGACTCACTATAGG 3′) and NANOG-specific inner sense primer (5′ CACTGATTTATTCCCAAA CTAC 3′). The resulting PCR products of 5′- and 3′-RACE were then fractionated and gel extracted (1.5% agarose gel). The purified PCR products were cloned into the pGEM-T Easy vector (Promega), and ligated products were transformed into One-Shot chemically competent cells (Invitrogen). Recombinant plasmid DNAs were isolated and purified using QIAprep® miniprep system (Qiagen) prior to sequencing.
Relative expression analysis of alternative polyadenylation transcripts
Relative expression of transcripts with alternative polyadenylation was performed by real-time PCR. Briefly, around 50-passage ESC-like cells were washed in PBS and total RNA was isolated by TRI reagent (Ambion). After first-strand cDNA synthesis, RNase H treatment was performed. Primers were designed using poly(A) tail region in antisense primers to avoid overlapped amplification. The primer pairs used to amplify specific transcript (amplified PCR product size in brackets) were BbuNANOG1 (GenBank accession No. JN231312; sense, 5′ GTGTCAATTTGAGGGAAGGG 3′; antisense, 5′ TTTTTTTTTGCCCCCTGTGCT 3′ [177 bp]), BbuNANOG2 (GenBank accession No. JN231313; sense, 5′ GGG AGGTCAACATGGAAATG 3′; antisense, 5′ TTTTTTTTT ACTCACTTCTAGTC 3′ [91 bp]), BbuNANOG3 (GenBank accession No. JN231316; sense, 5′ GGGAGGTCAACATG GAAATG 3′; antisense, 5′ TTTTTTTTTACAATGGCTATTT 3′ [59 bp]), BbuNANOG4 (GenBank accession No. JN231315; sense, 5′ GGGAGGTCAACATGGAAATG 3′; antisense, 5′ TTTTTTTTTAAATGTAAAATGG 3′ [59 bp]), BbuNANOG5 (GenBank accession No. JN231314; sense, 5 GGGAGGTCAA CATGGAAATG 3′; antisense, 5′ TTTTTTTTTAAAATGGCT ATTTTT 3′ [59 bp]), and GAPDH gene as an internal control (sense, 5 TTTGTGATGGGCGTGAACC 3′; antisense, 5′ ACA GTCTTCTGGGTGGCAGT3′ [173 bp]). The annealing temperature was 60°C for all PCRs. The cDNA sample was amplified in triplicate using SYBR Green Master Mix (Bio-Rad). PCR was run using MJ minithermal cycler (Real-time PCR; Bio-Rad). PCR program was 95°C for 10 min followed by 40 cycles of 10 s at 95°C, 10 s at 60°C, and 30 s at 72°C. A melt curve verified individual PCR amplicons. Results are presented as means±standard error of the mean (n=3). The CPs determined for the different polyadenylation transcripts were normalized with the housekeeping GAPDH gene. The lowest expression was set as 1, and differences of other are expressed by the x-fold difference.
Gene expression analysis
RNA was extracted from fetal tissues (liver and heart), adult tissues (liver, brain, and heart), two-cell, eight-cell, morula, and blastocyst stages, and 10th and 60th passages of ESC-like cells. Briefly, 1 μg of total RNA was reverse-transcribed using SuperScript III First-Strand Synthesis System (Invitrogen). PCR was run using MJ minithermal cycler (Bio-Rad) and the cycling parameters were 95°C for 5 min followed by 25 cycles of 30 s at 95°C, 30 s at 60°C, and 30 s at 72°C. Five microliters of PCR products were analyzed on 2% agarose gel.
Isolation and cloning of 5′-flanking region of buffalo NANOG
A genomic region of the buffalo NANOG promoter was cloned using PCR-based strategy. The overlapping primers were designed based on closely related species bovine; genomic assembly was accessed from Ensemble database (

Schematic representation of the strategy used to determine the structural organization of the buffalo NANOG gene. The 5′-flanking region of NANOG (3427 nt) was isolated and cloned using overlapping PCR fragments as illustrated by the closed and open boxes for the sense and antisense primers, respectively. The coding region was amplified using cDNA by RT-PCR. The genomic DNA is depicted with exons as rectangular boxes and the introns as a solid line; 5′- and 3′-UTRs were determined by RLM 5′-RACE and 3′-RACE; primer positions for RACE are shown by arrows. The exon–intron boundaries were determined by PCR amplification and sequencing. RT-PCR, reverse transcription–polymerase chain reaction; UTRs, untranslated regions; 5′- and 3′-RLM-RACE, 5′- and 3′-RNA ligase-mediated rapid amplification of cDNA ends.
In silico analysis: comparative genomics
Nucleotide sequence data reported here are available in GenBank database under the following accession numbers: HM585138, HM585139, HM585140, HM585144, HM585145, HM585146, DQ126153, JN231312, JN231313, JN231314, JN231315, JN231316, JN231317, JN231318, JN231319, JN231320, JN231321, JN231322, JN231323, JN231324, JN231325, JN231326, and JN231327. The comparative analysis of buffalo sequences and other mammals were carried out by alignment using ClustalW2 program. Pairwise comparison of nucleotide sequences was performed on EMBOSS Pairwise Alignment Algorithms program. The GC-rich regions were identified by using Gene Runner (Version 3.0) software (Hastings Software, Hudson). The 5′-flanking region of buffalo NANOG (promoter) was analyzed using TRANSFAC software (
Results
Cloning and 5′- and 3′-RACE
The overall strategy used to clone and characterize the buffalo NANOG gene is shown in Figure 1. The 5′-flanking region was amplified from genomic DNA using overlapping PCR and the coding region was amplified from cDNA using RT-PCR followed by cloning. TSSs (5′-untranslated region [5′-UTR]) and polyadenylation sites (3′-UTR) were determined by RLM-RACE. The RLM 5′-RACE analysis identified the presence of multiple amplicons on gel (Fig. 2). The sequence analysis of independent clones of RLM-RACE products identified four transcripts with different TSS. The different 3′-UTRs of NANOG are shown in Figure 3. The location of TSSs are represented in Figure 4. For the verification of different TSS, 22 clones were sequenced, and each TSS was found to be supported by at least three sequenced clones.

RNA ligase-mediated 5′-RACE analysis of NANOG. Lanes 1 and 2 are 1-kb DNA marker and products of the inner PCR for 5′-RACE, respectively. RLM 5′-RACE revealed that the buffalo NANOG uses at least four TSSs. TSSs, transcription start sites.

Structure of the buffalo NANOG 3′-UTR. The 3′ portions of NANOG gene leading to alternative poly(A) site selection are shown. Five alternative poly(A) sites present in buffalo NANOG are diagrammed here for comparison.

Structural organization of the buffalo NANOG gene. The cDNA and genomic region is depicted; the protein coding regions with the nucleotides in italics show genomic sequences at the junctions of the exon and intron. Typically, buffalo NANOG is encoded by four exons (NANOG splice variant type I; GenBank accession Nos. JN231313–16) and a splice variant encoded by five exons (NANOG splice variant type II; GenBank accession No. JN231312). In the splice variant type II, the first three exons remained the same, but from the fourth exon an additional intron is spliced out during maturation of transcript (shown by underline) to form a 1354-bp-long transcript. The invariant dinucleotides of the 5′-donor site and 3′-acceptor site are double underlined. The numbers refer to the nucleotide position with reference to translation initiation site as a +1. The positions of the 5′-UTRs (TSS) are located at 182, 95, 35, and 17 nt upstream to translation initiation codon (ATG). The buffalo NANOG gene encodes at least five alternative transcripts due to alternative use of polyadenylation signals in 3′-UTR. The longest buffalo NANOG cDNA transcript is 1914 bp long and encodes a 300-amino-acid protein shown here for comparison (GenBank accession No. JN231314). The translation initiation codon (ATG), the stop codon (TAA), and the polyadenylation signal (AATAAA) are shown in bold.
Analysis of 3′-UTR/polyadenylation
In addition to TSS selection, alternative polyadenylation contributes to transcript miscellany. As the structure of 3′-UTR of NANOG gene have not been characterized in any species, we decided to investigate the formation of 3′-ends of this gene or whether alternative polyadenylation occurs. To investigate this, we performed RLM 3′-RACE. The results of 3′-RACE are shown in Figure 3. Figure 3A shows alternate splicing resulting in transcript variants having different poly(A) signals present in NANOG 3′-UTR. Sequencing results of 3′-RACE experiment identified five different NANOG transcripts with different 3′-UTR lengths of 269, 314, 560, 566, and 829 bp (Fig. 3B). The gel analysis of RLM 3′-RACE showed multiple bands (Fig. 3C). However, one transcript was not shown to have a canonical poly(A) signal (AAUAAA) in upstream to cleavage/polyadenylation site but an AU-rich region present in upstream. The AU-rich region can act as a polyadenylation signal (Fig. 3D). The polyadenylation for NANOG gene could be an AAUAAA-dependent or -independent process in ESC-like cells.
Transcript variants and organization of buffalo NANOG gene
Sequence analysis based on the coding region, 5′-RACE, and 3′-RACE showed the presence of a splice variant of NANOG (Figs. 3 and 4). However, most of NANOG transcripts span four exons. The results of the present study showed that, in addition, an alternatively spliced variant coexists with these transcripts, consisting of five exons (GenBank accession No. JN_231312). Sequence alignment of this transcript variant with other transcripts revealed that a 290 bp long intron was further spliced out from exon 4. Splice junctions between the first four exons were in agreement with the GT-AG splicing rule, but exon 5 did not follow this rule as shown in Figure 4. The overall organization of buffalo NANOG gene spans ∼6 kb. The first splice variant is separated by three intronic DNAs. The first exon comprised of the variable 5′-UTR followed by 136 bp that encode part of the protein. The second and third exons contain protein-coding sequence of 263 and 87 bp, respectively. The fourth exon contains the stop codon and the variable 3′-UTR (Fig. 4). The locations of the intron was confirmed by sequence analysis. As shown, the exon–intron boundaries conform to classical splice donor and acceptor consensus sequences. The exon sequence agreed with that determined for the cDNA, indicating that the obtained cDNA was free of PCR artifacts. The buffalo NANOG transcripts differ in size because of alternative usages of TSSs and alternative polyadenylation sites. At least five different transcripts occur because of usage of alternative polyadenylation, which contains 269, 314, 560, 566, and 829-bp-long 3′-UTR. The longest transcript of buffalo NANOG spans 1914 bp and includes a 930-bp ORF that encodes for 300 amino acids. The coding region of buffalo NANOG showed 96% identity to the bovine at nucleotide and amino acid levels.
Expression of NANOG transcripts in ESC-like cells
To investigate whether the 3′-UTR variants of the buffalo NANOG express differentially, we did transcript specific RT-PCR. The analysis of expression of transcripts with different poly(A) signals showed that the transcript variant using pA1 site for polyadenylation was expressed at a higher level. This transcript represents a splicing variant containing five exons. In addition, another transcript that uses pA4 site for polyadenylation was also expressed at a higher level in buffalo ESC-like cells when compared with other variants (Fig. 5). The longest transcript was found to be expressed at the lowest level (Fig. 5). Similarly, overall expression of NANOG in buffalo ESC-like cells and other tissues was checked. Results showed that NANOG, a pluripotency gene, was found to be expressed in ESC-like cells and two-cell, eight-cell, morula, and blastocyst stages but not in other fetal and adult tissues studied (Fig. 6). The expression of NANOG was found to be higher in ESC-like cells when compared with two-cell, eight-cell, morula, and blastocyst stages and remained stable in ESC-like cells after several passages (Fig. 6).

Differential expression of the buffalo NANOG variants. Relative expression of three NANOG variants in buffalo ESC-like cells was determined by real-time PCR. The experiments were performed in triplicate and the results are expressed as mean±standard deviation. RNA samples representing 60th-passage buffalo ESC-like cells. GAPDH mRNA expression was used to normalize their expression. The expression of different transcripts varies significantly. A splice variant containing five exons is expressed more abundantly (GenBank accession No. JN231312). In the other splice variant, a transcript with a medium-length 3′-UTR (1651 bp; GenBank accession No. JN231315) was found to be expressed at a relatively high level when compared with other transcripts. ESC, embryonic stem cell.

Expression of the buffalo NANOG gene. NANOG expression was assessed by RT-PCR. Upper panel shows expression of NANOG in ESC-like cells and two-cell, eight-cell, morula, and blastocyst stages, but no detectable expression was seen in the fetal and adult tissues. RNAs were from FL, fetal liver; FH, fetal heart; FF, fetal fibroblast cells; 2-C, two-cells embryo; 8-C, eight-cells embryo; M, morula; B, blastocysts; E10, ESC-like cells of 10th passage; E60, ESC-like cells of 60th passage; AL, adult liver; AB, adult brain; AH, adult heart. M, DNA marker; NTC, no template control. GAPDH was used as an internal control and expression is shown in the lower panel.
Structure of NANOG 3′-UTR and in silico analysis
Analysis of the 3′-UTR of NANOG showed that there were two splice variants and the overall structure of NANOG 3′-UTRs is shown in Figure 7. Splice variant type 1, encoded by four exons, contains four cleavage sites. The 3′-UTR of longest transcript was further analyzed for putative regulatory regions (1914 bp; GenBank accession No. JN_231314) in silico (Fig. 7A). The putative downstream polyadenylation signal was composed of a hexanucleotide sequence (AAUAAA) present at 525 and 769 bp downstream of the coding region (for polyadenylation at pA1, pA3, pA4, and pA5). Sequence analysis revealed that a NANOG transcript (GenBank accession No. JN_231313) lacks the canonical hexanucleotide sequences, A(A/U)UAAA, as a polyadenylation signal sequence, but an AU-rich sequence present in upstream to cleavage/polyadenylation site pA2 could be a putative polyadenylation signal element for polyadenylation. Splice variant type 2, encoded by five exons, contains a single cleavage site (pA1). The canonical hexanucleotide (AAUAAA) signal for polyadenylation was found to be positioned 239 bp downstream of the coding region (GenBank accession No. JN_231312). The sequence analysis of NANOG mRNA 3′-UTR revealed the existence of several conserved motifs such as U-rich elements (UREs), AU-rich elements (AREs), and GU-rich elements (GREs) and cytoplasmic polyadenylation elements (CPEs).

Schematic representation of NANOG mRNA 3′-UTR. NANOG mRNA 3′-UTR sequences were from two splice variants.
NANOG 5′-flanking region
The 5′-flanking region (−3366/+61) of the buffalo NANOG gene was cloned by employing PCR-based amplification and cloning method as shown in the schematic representation (Fig. 1). As shown in Figure 8, the cloned 5′-flanking region contained a portion of the first exon and the adjoining upstream region. In silico analysis using TRANSFAC and TFSEARCH software identified putative transcription factor binding sites. The analysis revealed a classical TATA box (TATAAA) and a CAAT box (CAATGG). In addition, another TATA box was located −3108 nucleotides upstream to translational start site. Analysis showed that apart from these sites the 5′-flanking region of NANOG also contains recognition sequences for several transcription factors including a potential cis-acting DNA element, GC box (Sp1) centered at two positions (−263 and −244), and multiple binding sites for OCT4 and SOX2 within 3.4 kb of the NANOG 5′-flanking region. There were four composite sites for OCT4 and SOX2 binding centered at position −208, −329, −1046, and −1095; one more site was present for Octamer binding centered at −2439; four more sites were present for Sox binding at −929, −1898, −3166, and −3350. Similarly, consensus sites for binding of many other transcription factors were identified as highlighted in Figure 8.

Nucleotide sequence of the 5′-flanking region of the buffalo NANOG gene. The nucleotide sequence contains 3366 nt 5′ to the translation start site. The translational start site was designated as +1. The TSSs are underlined and indicated by arrows (positions −182, −95, −35, and −17). The sequence was analyzed for regulatory elements that share homology to known transcription factor binding sites, using the TFSEARCH program. Putative transcription and regulatory elements are highlighted in gray boxes. Putative TATA box and CAAT box are double underlined. Four Oct-Sox composite sites are highlighted in gray and dark gray boxes.
Discussion
NANOG is a critical transcription factor in the regulation of cell fate of the pluripotent ICM during embryonic development, maintaining the pluripotent epiblast and preventing differentiation to primitive endoderm (Mitsui et al., 2003; Hamazaki et al., 2004). To understand the transcriptional regulation of the NANOG gene in buffalo ESC-like cells, in this present study, we isolated and characterized NANOG gene and its 5′-flanking region.
5′-RACE analysis identified four transcription initiation sites (TSSs), including three novel initiation sites located in exon 1 of the gene expressed by buffalo ESC-like cells. A distal most TSS was located at position −182 nucleotides upstream to translation start site. The presence of multiple transcriptional initiation sites is a typical feature of genes having TATA-less promoters (Frith et al., 2008). In mice, previous study showed that the NANOG gene promoter lacks a TATA box and CAAT box (Wu and Yao, 2005). In contrast, in buffalo, the 5′-flanking region of NANOG contained both a TATA box and CAAT box upstream of the distal most TSS. Therefore, in buffalo, it could be interesting to study whether these TATA and CAAT boxes are functional. However, because of experimental limitations with buffalo ESC-like cells, we could not perform deletion analysis in the present study. Many genes have multiple TSSs located in close proximity to each other and the rules for start site selection are fundamentally different for different promoters. A TSS is defined as a unique nucleotide that is the first to be transcribed, whereas the core promoter is defined as a genomic region that spans this and close TSSs (Frith et al., 2008). We identified the four TSSs (−17, −35, −95, and −182) that are responsible for transcription initiation of the NANOG gene. Interestingly, our observation for NANOG gene expression supports that two different strategies are used by Pol II for transcription initiation. The first strategy is “focused initiation” in which a single TSS and the core promoter contain a TATA box and other core promoter elements (INR, downstream promoter element [DPE], and transcription factor IIB (TFIIB) recognition element [BREd]) (Juven-Gershon et al., 2006). On the other hand, in the second strategy, multiple weak TSSs are dispersed over DNA regions of ∼50–150 bp, and it is thereby dubbed “dispersed initiation” (Juven-Gershon et al., 2006). NANOG appeared to use the second strategy for its expression in ESC-like cells. The mechanisms of dispersed initiation are not clear but probably involve selective usage of numerous upstream and downstream recognition and promoter elements.
Polyadenylation is an integrated step in the maturation of all eukaryotic cellular mRNAs with the exclusion of histone mRNAs. Regulation can also occur after transcription using sequences in the 3′-UTR of the mRNA to affect mRNA stability and/or translation efficacy (de Moor et al., 2005). Alternative polyadenylation generates mRNAs with 3′-untranscribed regions of different lengths, often affecting transcript stability. Because the precise regulation of NANOG expression level is essential for ESC-like cells' pluripotency, we characterized 3′-UTR using 3′-RACE. 3′-RACE experiments showed the presence of tandem polyadenylation signals, which leads to the expression of at least five different 3′-UTRs (269, 314, 560, 566, and 829 nt) (Fig. 3). There are other several examples in which the 3′-UTRs of mRNAs play significant roles in regulating gene expression (Chen and Shyu, 1995; Edwalds-Gilbert et al., 1997; Zhao et al., 1999; Pesole et al., 2001; Zhang et al., 2002). The alternative polyadenylation could also play a role in gene silencing. Messenger RNA (mRNA) 3′-end processing defines the end of the transcript through endonucleolytic cleavage of the precursor transcript, provides a protective polyadenylate tail, and enables subsequent termination of transcription by RNA Pol II. Just as alternative splicing allows enormous diversity of mRNA products from a limited number of genes, in animals and plants it is estimated that >50% of genes have alternative polyadenylation sites. The most common mechanism is one in which alternative polyadenylation is a consequence of tandem arrays of poly(A) signals within a single 3′-UTR. The differential expression of NANOG gene that undergoes alternative poly(A) site choice or polyadenylation/splicing competition could be regulated at the level of amounts and activities of either generic or tissue-specific polyadenylation factors and/or splicing factors. Relative expression analysis of preferential uses of poly(A) signal revealed that the transcript variant using the pA1 site for polyadenylation was expressed at a higher level. In addition, another transcript that uses pA4 site for polyadenylation was also expressed at a higher level in buffalo ESC-like cells when compared with other variants. The longest transcript was found to be expressed at the lowest level (Fig. 5). The 3′-UTR is often the site for RNA elements that regulate various steps in the mRNA-processing pathway, such as mRNA transport, transcript stability, and translation efficiency. The best-studied 3′-UTR element is the group of AU-rich RNA instability elements, often containing multiple copies of AUUUA motifs (Zhang et al., 2002).
Sequence analyses of the NANOG 3′-UTR revealed the existence of several conserved motifs such as UREs, AREs, and GREs and CPEs in 3′-UTR. These types of regulatory sites are functional regulators involved in post-transcriptional regulation of gene expression (Halees et al., 2011). CPEs are usually located 20–30 nucleotides upstream of the AAUAAA element, although several examples of mRNAs with much longer CPE-to-AAUAAA distance have been described. Cytoplasmic polyadenylation is a key mechanism affecting genes that are involved in controlling mRNA translation during early development (de Moor et al., 2005). AREs are well-described sequence elements to which a range of different proteins can bind, for example, AUF1, HuR, and KSRP. AREs and GREs are largely present in the 3′-UTRs of many unstable mammalian mRNAs, responsible for destabilization/degradation of mRNAs. Genome-wide analysis showed that at least 5% of human genes contain GREs in their 3′UTRs, with functional over-representation in genes involved in transcription, nucleic acid metabolism, developmental processes, and neurogenesis. RNA-binding protein CUGBP1 elicits mRNA decay through binding to GREs (Vlasova et al., 2008). NANOG expression is limited to few stages of development or in pluripotent cells; in this way, transitory expression of NANOG mRNA may be regulated post-transcriptionally by these destabilization elements present in the 3′-UTR. NANOG contains multiple regulatory elements or binding sites for many proteins, such as PCBP, poly(c) binding protein (UCCCCU); PTB, polypyrimidine tract-binding protein (UCUUU) and AUBF, adenosine-uridine binding factor (AUUUA), in the 3′-UTR. Conserved AREs have been reported to be mainly present in the 3′-UTR of a variety of mRNAs susceptible to rapid degradation (Winstall et al., 1995; Sully et al., 2004). The cytoplasmic trans-factors interact at or near the AUUUA, and other destabilizing motifs could modulate the degradation of NANOG message accounting for variable message stability.
The third important mechanism that generates huge diversity of transcripts is alternative splicing. 3′-RACE revealed that there were two sorts of splicing for premature NANOG mRNA. Two different splice variants were found, one splice variant contains four exons and other has five exons (Fig. 3). Splicing variation occurred in the buffalo NANOG gene because of an additional splicing event in exon 4, giving rise to a distinct variant of buffalo NANOG. Generally, the fourth exon partially codes for NANOG protein and the rest codes for the 3′-UTR. Our results show that a strong conservation of gene structure and sequence exists between buffalo NANOG and its bovine, human, and mouse counterparts and that NANOG is expressed in the buffalo ESC-like cells and in embryonic developmental stages, such as two-cell, four-cell, morula, and blastocyst stages, but not in other somatic tissues of adult or fetus (Fig. 6).
Further, the 5′-flanking sequence of the buffalo NANOG gene contains a consensus TATA box and CAAT box. The 5′-RACE analysis identified multiple transcription initiation sites in exon 1 of the NANOG gene expressed by buffalo ESC-like cells. The presence of multiple transcriptional initiation sites is a typical feature of TATA-less promoter regions. However, the present finding in buffalo reveals the presence of both features, that is, TATA box and CAAT box in upstream of the distal most TSS and multiple TSSs. So it could be interesting to study whether the TATA box and CAAT box are functional or not or whether both strategies can be used for transcription. It is now well documented that TATA-driven transcription preinitiation complex assembly is the exception rather than the rule in eukaryotic transcription, as only 10%–20% of mammalian promoters contain a functional TATA box (Hochheimer and Tjian, 2003). Taken together, in the initial characterization of the promoter of the buffalo NANOG gene, four TSSs were detected and two promoter regions were established. The promoter region and 5′UTR contain multiple potential transcription factor binding sites, including Sp1 (GC-box), a ubiquitously expressed transcription factor belonging to the Sp1-like/KLF family of transcription factors. The role of these two putative Sp1 binding sites located in the NANOG gene 5′-flanking region may participate in the regulation of NANOG gene transcription (Wu and Yao, 2006). The TFSEARCH revealed the presence of multiple binding sites for OCT4 and SOX2 within 3.4 kb of the NANOG 5′-flanking region. NANOG has been reported to be regulated by OCT4 and SOX2 through a cooperative interaction (Rodda et al., 2005). Consensus sites for binding of many other transcription factors including Ap1, myeloid zinc finger (MZF1), CCAAT/enhancer binding protein (C/EBP), ADR1, Bcd, CdxA, GATA1, GATA-2, c-Myb, lymphoid transcription factor (Lyf-1), MyoD, IRF-1, STRE, and NF-Kap were identified (Fig 8).
Conclusion
In conclusion, we cloned, sequenced, and analyzed the buffalo ortholog of the NANOG gene. The present finding demonstrated that in buffalo ESC-like cells the NANOG mRNA was expressed as different isoforms that include alternative transcriptional start, alternative splicing, and alternative polyadenylation sites. Specifically, four TSSs were identified, one corresponding to that previously described in bovine and three that were novel for NANOG. Beside the variants generated by the 5′-UTR, NANOG has five different variants because of the selection of different polyadenylation signals in the 3′-UTR. The combination of alternative 5′- and 3′-UTRs increases the convolution of NANOG expression and the possible roles of RNA isoforms in ESC physiology. Further, analysis of the 5′-flanking region revealed the presence of a TATA box and CAAT box sequence elements in the proximal promoter region; all the TSSs were found to be located within these motifs. The expression analysis of three variants that use alternative polyadenylation signals showed that these transcripts were differentially expressed. Therefore, results showed that alternative NANOG transcripts generated with different 5′- and 3′-UTRs could account for differential expression. However, the functional relevance of different transcripts with alternative transcript start sites and polyadenylation is to be yet studied for this key regulator of ESC pluripotency regulator transcription factor.
Footnotes
Acknowledgments
This work was funded by the National Agriculture Innovative Project (NAIP) grant to M.S.C. (C-2067 and 075), ICAR, New Delhi, India.
Disclosure Statement
No competing financial interests exist.
