The IL-8 Gene Polymorphisms and the Risk of the Hepatitis B Virus/Infected Patients

Abstract

Interleukin-8 (IL-8) belongs to the superfamily of CXC chemokines, contributing to human cancer progression through potential mitogenic, angiogenic, and motogenic functions. We hypothesize that the functional polymorphism of IL-8 may influence the inflammatory process during pathological stage from hepatitis to hepatocellular carcinoma (HCC). Two polymorphisms in the IL-8 gene (−251A/T and +781C/T) were examined in 160 cases of chronic hepatitis B, 80 cases of hepatitis B virus (HBV)–related liver cirrhosis (LC), 150 cases of HBV-related HCC, and 150 healthy controls using polymerase chain reaction–restriction fragment length polymorphism method and DNA sequencing. In the LC group, the AA genotypes were associated with a significantly decreased risk of LC compared with the TT genotype (OR=0.14, 95% CI 0.02–0.87, p=0.035). The data also revealed that subjects with the A allele appeared to have lower susceptibility to LC than those with the T allele (OR=0.48, 95% CI 0.25–0.92, p=0.027). The +781C/T polymorphism of IL-8 was not found relevant to the liver diseases. This study indicated that the IL-8 gene −251 AA genotype might be a protect factor for LC.

Introduction

H epatocellular carcinoma (HCC) ranks as the fifth most common cancer around the world (Llovet et al., 2003). It is also the second most common cause of cancer death in China (Poon et al., 1999). More than half of the HCC cases worldwide occur in Southeast Asia and sub-Saharan Africa (Shih et al., 2009), where it is attributed to the hepatitis B virus (HBV) that was recognized as a established risk factor for HCC development. Although HBV is known as a major cause of HCC, only a few of patients with chronic HBV infection develop HCC during their lifetime, revealing that genetic and environmental factors are important in determining individuals' susceptibility to HCC (Wu and Lin, 2007).

Recently, increased production of proinflammatory cytokines and chemokines, such as tumor necrosis factor-α (TNF-α) (Park et al., 2010), interleukin-1β (IL-1β) (Okamoto et al., 2010), and interleukin-8 (IL-8) (Wei et al., 2007), interleukin-10 (IL-10) (Shin et al., 2003), interleukin-18 (IL-18) (Kim et al., 2009) have been reported to be associated with tumor and chronic inflammatory disease. These cytokines are produced by immune cells including various populations of lymphocytes, macrophages, and other cells. The IL-8 belongs to a superfamily of CXC chemokines, contributing to human cancer progression through potential mitogenic, angiogenic, and motogenic functions (Kubo et al., 2005).

To test the hypothesis that the functional polymorphism of IL-8-251A/T and +781C/T, relating to inflammatory cytokine production, may influence the inflammatory process from hepatitis to HCC, the present study was conducted on a population of visitors to First Affiliated Hospital of Guangxi Medical University.

Materials and Methods

Study population

A total of 540 subjects were periodically consented and enrolled between September 2009 and September 2010 at the First Affiliated Hospital of Guangxi Medical University, including 390 patients with chronic HBV infection and 150 healthy controls with no evidence of recent or remote HBV infection (Table 1). The patients were divided into three groups: 160 cases of chronic hepatitis B (CHB), 80 cases of liver cirrhosis (LC), and 150 cases of HCC. All the patients were positive for both hepatitis B surface antigen (HBsAg) and anti-hepatitis B core antibody immunoglobulin G >6 months. CHB is defined as positivity for HBsAg for a period of at least 6 months, elevated alanine aminotransferase (ALT) or aspartate aminotransferase (AST) (>40 IU/mL). LC was diagnosed based on pathologic exams, or typical morphologic findings from computed tomography (CT) or ultrasonography, and the laboratory features. Only newly diagnosed HCC patients were included, meanwhile the patients with a medical history of HCC or other cancers were excluded. The diagnosis of HBV-related HCC was based on either histological or cytological findings, or on elevated serum alpha fetoprotein (AFP) levels >400 ng/mL combined with at least one positive liver image on CT, magnetic resonance imaging, or ultrasonography. The control group comprised 150 healthy volunteers who have a routine physical examination at the First Affiliated Hospital of Guangxi Medical University. Selection criteria for controls were no evidence of any personal or family history of cancer or other serious illness. All subjects were Chinese with written informed consent and the study was performed with the approval of the ethics committee of the First Affiliated Hospital of Guangxi Medical University.

Table 1.

Characteristics of Study Subjects

Groups	Healthy controls (n=150)	CHB (n =160)	LC (n=80)	HCC (n=150)
Gender (M/F)	117/33	128/32	64/16	121/29
Age (years) (X±SD)	43.5±9.63	44.2±13.52	43.9±12.13	44.5±12.95

CHB, chronic hepatitis B; HCC, hepatocellular carcinoma; LC, liver cirrhosis.

DNA extraction and genotyping of defined single-nucleotide polymorphisms

Blood samples were collected in ethylenediaminetetraacetic acid anticoagulated tubes. Genomic DNA was extracted from white blood cell fractions using QIAamp DNA blood mini kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions. Polymorphism (−251A/T and +781C/T) genotypes were performed using polymerase chain reaction–restriction fragment length polymorphism method. In addition, to confirm the real genotype, 10% of the PCR-amplified DNA samples were examined by DNA sequencing in an ABI PRISM 3730 (Figs. 1 and 2). The reaction conditions are listed in Table 2.

FIG. 1.

−251A/T genotyping by direct sequencing: (a) AA genotype; (b) AT genotype; (c) TT genotype.

FIG. 2.

+781C/T genotyping by indirect sequencing: (a) CC genotype; (b) CT genotype; (c) TT genotype.

Table 2.

Primer Sequence and the Reaction Condition for Genotyping IL-8 Polymorphisms

Polymorphism	Primer sequence	Annealing temperature (°C)	Restriction enzyme	Product size (bp)
−251A/T	F:CCATCATGATAGCATCTGT	58.0	AseI	173
	R:CCACAATTTGGTGAATTATTA
+781C/T	F:CTCTAACTCTTTATATAGGAATT	52.0	EcoRI	203
	R:GATTGATTTTATCAACAGGCA

Statistical methods

Demographic and clinical data among groups were compared by χ² test for continuous variables and by Student's t-test for categorical variables. Hardy–Weinberg equilibrium (HWE) was tested with χ² test with one degree of freedom to compare the observed genotype frequencies with the expected genotype frequencies among the subjects. Genotype and allele frequencies of IL-8 were compared among different groups using the χ² test and Fisher's exact test when appropriate. Odds ratio (OR) and 95% confidence intervals (CIs) were calculated using binary logistic regression and adjusted for age and gender, to assess the relative risk conferred by a particular allele and genotype. All tests were two tailed; p<0.05 was considered statistically significant. The statistical power was calculated by using the PS Software (http://biostat.mc.vanderbilt.edu/twiki/bin/view/Main/PowerSampleSize). The SPSS 13.0 was applied for all of the statistical analysis.

Results

Table 1 provides a description of relevant demographic of all groups. The genotype frequencies of each of the IL-8 gene polymorphisms were categorized in groups, as shown in Tables 3 –5. Furthermore, a HWE test was performed for all investigated single-nucleotide polymorphisms (SNPs). According to the HWE test, the distributions of the observed genotypes were not significantly different from the expected distributions.

Table 3.

Genotype and Allele Frequencies of Three Single-Nucleotide Polymorphisms in the IL-8 Gene Between Chronic Hepatitis B Patients and Healthy Controls

Polymorphisms	Healthy controls (n=150) (%)	CHB (n=160) (%)	OR (95% CI) ^a	p^a
−251A/T
Genotypes
AA	25 (16.8)	21 (12.9)	0.30 (0.08–1.18)	0.086
AT	84 (55.8)	85 (53.5)	0.83 (0.30–2.25)	0.708
TT	41 (27.4)	54 (33.7)	1.00
A allele	134 (44.7)	127 (39.6)	0.62 (0.38–1.02)	0.060
T allele	166 (55.3)	193 (60.4)	1.00
+781C/T
Genotypes
CC	57 (37.9)	65 (40.6)	0.66 (0.14–3.06)	0.598
CT	80 (53.7)	79 (49.5)	0.52 (0.13–2.10)	0.357
TT	13 (8.4)	16 (9.9)	1.00
C allele	194 (64.7)	209 (65.3)	1.37 (0.82–2.30)	0.233
T allele	106 (35.3)	111 (34.7)	1.00

Adjusted for sex and age by the logistic regression model.

CI, confidence interval; CT, computed tomography; OR, odds ratio.

Table 4.

Genotype and Allele Frequencies of Three Single-Nucleotide Polymorphisms in the IL-8 Gene Between Liver Cirrhosis Patients and Healthy Controls

Polymorphisms	Healthy controls (n=150) (%)	LC (n=80) (%)	OR (95% CI) ^a	p^a
−251A/T
Genotypes
AA	25 (16.8)	9 (11.5)	0.14 (0.02–0.87)	0.035
AT	84 (55.8)	43 (53.8)	0.58 (0.17–1.95)	0.374
TT	41 (27.4)	28 (34.6)	1.00
A allele	134 (44.7)	62 (38.5)	0.48 (0.25–0.92)	0.027
T allele	166 (55.3)	98 (61.5)	1.00
+781C/T
Genotypes
CC	57 (37.9)	37 (46.2)	0.44 (0.06–3.09)	0.412
CT	80 (53.7)	37 (46.2)	0.35 (0.06–2.24)	0.270
TT	13 (8.4)	6 (7.7)	1.00
C allele	194 (64.7)	111 (69.2)	1.54 (0.77–3.08)	0.218
T allele	106 (35.3)	49 (30.8)	1.00

Adjusted for sex and age by the logistic regression model.

Table 5.

Genotype and Allele Frequencies of Three Single-Nucleotide Polymorphisms in the IL-8 Gene Between Hepatocellular Carcinoma Patients and Healthy Controls

Polymorphisms	Healthy controls (n=150) (%)	HCC (n=150) (%)	OR (95% CI) ^a	p^a
−251A/T
Genotypes
AA	25 (16.8)	22 (14.5)	0.29 (0.08–1.14)	0.075
AT	84 (55.8)	83 (55.5)	0.84 (0.30–2.34)	0.735
TT	41 (27.4)	45 (30.0)	1.00
A allele	134 (44.7)	127 (42.3)	0.73 (0.44–1.20)	0.211
T allele	166 (55.3)	173 (57.7)	1.00
+781C/T
Genotypes
CC	57 (37.9)	64 (42.7)	0.31 (0.07–1.41)	0.129
CT	80 (53.7)	68 (45.5)	0.28 (0.07–1.13)	0.073
TT	13 (8.4)	18 (11.8)	1.00
C allele	194 (64.7)	196 (65.5)	1.04 (0.61–1.75)	0.892
T allele	106 (35.3)	104 (34.5)	1.00

Adjusted for sex and age by the logistic regression model.

CHB patients versus healthy controls

The genotype and allele frequencies of IL-8 gene polymorphisms between the CHB patients and healthy controls are shown in Table 3. The −251A/T AA and AT genotypes were not associated with risk (p=0.086 and p=0.708). The data also revealed that the +781C/T CC and CT genotypes were not associated with risk (p=0.598 and p=0.357).

LC patients versus healthy controls

The genotype and allele frequencies of IL-8 gene polymorphisms between the LC patients and healthy controls are shown in Table 4. The frequencies of the AA, AT, and TT genotypes of −251A/T were 11.5%, 53.8%, and 34.6% in LC patients, and were 16.8%, 55.8%, and 27.4% in healthy controls, respectively. There were significant differences in the genotype and allele frequencies of IL-8 gene −251A/T polymorphism between the LC patients and healthy controls. The AA genotypes were associated with a significantly decreased risk of LC compared with the TT genotype (OR=0.14, 95% CI 0.02–0.87, p=0.035). The data also revealed that subjects with the A allele appeared to have lower susceptibility to LC than those with the T allele (OR=0.48, 95% CI 0.25–0.92, p=0.027). The +781C/T CC and CT genotypes were not associated with risk (p=0.598 and p=0.357).

HCC patients versus healthy controls

The genotype and allele frequencies of IL-8 gene polymorphisms between the HCC patients and healthy controls are shown in Table 5. The −251A/T AA and AT genotypes were not associated with risk (p=0.075 and p=0.735). The data also revealed that the +781C/T CC and CT genotypes were not associated with risk (p=0.129 and p=0.073).

Haplotype analysis of the IL-8 gene

The haplotype distribution in HCC patients and healthy controls containing the possible four haplotype frequencies is shown in Table 6. By haplotype analyses, we did not found that the haplotype is associated with the risk of HCC. In addition, we compared the frequencies of genotype and allele of these three SNPs in our healthy control group with those from Haplotype Map (HapMap) Project. For −251A/T, the frequencies of allele in Japanese and Nigerian are significantly different from those in the current study; for +781C/T polymorphism, there are significantly higher detection rate of the C allele and a lower detection rate of the T allele in Japanese (76.1% for C and 23.9% for T) and Nigerian (93.3% for C and 6.7% for T) compared with our data (64.7% for C and 35.3% for T).

Table 6.

Haplotype Distribution in the Patients with Hepatocellular Carcinoma and Controls

Haplotypes	Healthy controls (2n=300) (%)	HCC (2n=300) (%)	χ²	p	OR	95% CI
A²⁵¹C⁷⁸¹	44.04 (14.7)	39.76 (13.3)	0.171	0.679098	0.890	0.511–1.549
A²⁵¹T⁷⁸¹	90.17 (30.1)	88.15 (29.4)	0.031	0.860765	0.963	0.632–1.468
T²⁵¹C⁷⁸¹	150.17 (50.1)	153.46 (51.2)	0.054	0.815939	1.047	0.712–1.539
T²⁵¹T⁷⁸¹	15.62 (5.2)	18.63 (6.2)	0.210	0.646862	1.215	0.527–2.801

Discussion

The gene encoding IL-8 located on chromosome 4q12-21 is 5.2-kb long and a common polymorphism in the −251 position (251A/T) of the promoter region has been associated with the gene's transcriptional activity. The 251A allele in a homozygous state influences the transcriptional control of IL-8 expression (Hull et al., 2000). The polymorphism of this site has been well studied and potentially increases susceptibility for certain tumors. Wei et al. (2007) have reported that the −251 AA and AT genotypes were associated with a significantly increased risk of nasopharyngeal carcinoma (OR=1.820, 95% CI 1.120–2.959 and OR=1.590, 95% CI 1.104–2.290, respectively). Lee et al. (2005) had reported that the IL-8-251 T allele is significantly associated with increased risk of gastric carcinoma, particularly the diffuse type (OR=2.52, 95% CI 1.16–5.49) and mixed type (OR=2.22, 95% CI 1.12–4.40) in Chinese population. Taguchi et al. (2005) showed that the IL-8-251 T>A polymorphism is associated with higher expression of IL-8 protein, more severe neutrophil infiltration, and increased risk of atrophic gastritis (OR=2.35, 95% CI 1.12–4.94) and gastric cancer (OR=2.22, 95% CI 1.08–4.56). The polymorphism in position 781 of the IL-8 gene (781C/T) has been associated with altered transcription levels of IL-8. Puthothu et al. (2006) reported that IL-8 polymorphism 781C/T is associated with the increased risk for asthma (p=0.011); at the same time, it is also associated with the increased risk for asthmatic population with the respiratory syncytial virus (p=0.034). In addition, the IL 8 781 T allele may also associated with increased risk of developing wet age-related macular degeneration (OR=2.16, 95% CI, 1.58–2.94) (Tsai et al., 2008). The data mentioned previously clearly indicated that IL-8 polymorphism was associated with the inflammatory status as well as the risk of carcinoma.

This is the first study assessing the impact of −251A/T and 781C/T polymorphisms of the IL-8 gene on patient susceptibility to HBV-related liver diseases. We found that there were significant differences in the genotype and allele frequencies of IL-8 gene −251A/T polymorphism between the LC patients and healthy controls; patients with AA genotype had a reduction of the risk (OR=0.14) when compared with TT genotype. The subjects with the A allele appeared to have lower susceptibility to LC than those with the T allele (OR=0.48). However, the +781C/T polymorphism of IL-8 was not found relevant to the liver diseases. In the HapMap Project, there were other epidemiological studies in diverse ethnic populations that found inconsistent results with us; in the −251A/T site, the frequencies of the A alleles among the healthy controls were 0.447, and these were similar to those frequencies observed in healthy HCB (Han Chinese in Beijing) and CEU (Utah residents with northern and western European ancestry; 0.3389 and 0.400, respectively), but the frequencies were lower than those of Yoruba in Ibadan (YRI), and higher than Japanese in Tokyo (JPT; 0.271). The frequencies of the 781 C alleles among the healthy controls were 0.647; these were similar to those frequencies observed in healthy HCB and CEU (0.633 and 0.608, respectively), but the frequencies were significantly different than those of JPT and YRI.

IL-8 is a multifunctional CXC chemokine that is produced after stimulation with numerous exogenous and endogenous agents. Evidence was provided that IL-8 as an angiogenesis-regulating molecule has some potential functions in different cancer types, including a role in angiogenesis, tumor growth, and metastasis (Koch et al., 1992; Desbaillets et al., 1997; Mizukami et al., 2005). Recent studies have demonstrated that IL-8 regulates tumor cell growth and metastasis in ovarian cancer (Uslu et al., 2005), squamous cell cancer of the head and neck (Gokhale et al., 2005), and stomach (Kitadai et al., 1998). SNPs are the most common form of human genetic variation; a number of studies on the IL-8 genotypes and different cancer types' susceptibility have been reported. The authors reported that the IL-8 polymorphisms increase the risk of atrophic gastritis (Taguchi et al., 2005), gastric cancer and gastric ulcer (Ohyauchi et al., 2005), and breast carcinoma (Snoussi et al., 2006). On the contrary, Landi et al. (2003) had shown that the IL-8-251A allele was associated with decreased risk of colorectal cancer. The result is similar to our finding that −251A allele is associated with decreased risk of LC. (Michaud et al., 2006) reported that IL-8 did not seem to play a role in the risk of prostate cancer. Our data also showed that IL-8 polymorphisms were not associated with risk of HCC.

However, the reason for these discrepancies should be considered. First, population in some studies was hospital based, and healthy subjects were not evaluated as a control group. Furthermore, it is well-known that the etiology of cancer is the interplay between both genetic factors and environmental exposure, such as infection with HBV or HCV, excessive alcohol intake in HCC, and different risk factors attribute for the development of HCC. At last, the inadequate study design should also be considered, as the limited sample size prevents our analysis to reach significant p-values. For the −251A/T site, AA genotype with a p-value (p=0.086 in Table 3 or p=0.075 in Table 5) indicating a nonsignificant trend toward a protective effect.

In conclusion, our findings suggest that IL-8 gene −251 AA genotype is a protect factor for LC. The difference between our results and others highlights the possibility that IL-8 may operate via unique mechanisms. Further validated larger studies should be done in the future.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Desbaillets

, Diserens

A.C.

, Tribolet

, Hamou

M.F.

, Van Meir

E.G.

1997. Upregulation of interleukin 8 by oxygen-deprived cells in glioblastoma suggests a role in leukocyte activation, chemotaxis, and angiogenesis. J Exp Med, 186:1201–1212.

Gokhale

A.S.

, Haddad

R.I.

, Cavacini

L.A.

, Wirth

, Weeks

, Hallar

, Faucher

, Posner

M.R.

2005. Serum concentrations of interleukin-8, vascular endothelial growth factor, and epidermal growth factor receptor in patients with squamous cell cancer of the head and neck. Oral Oncol, 41:70–76.

Hull

, Thomson

, Kwiatkowski

2000. Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax, 55:1023–1027.

Kim

Y.S.

, Cheong

J.Y.

, Cho

S.W.

, Lee

K.M.

, Hwang

J.C.

, Oh

, Kimm

, Lee

J.A.

, Park

B.L.

, Cheong

H.S.

, Shin

H.D.

, Kim

J.H.

2009. A functional SNP of the Interleukin-18 gene is associated with the presence of hepatocellular carcinoma in hepatitis B virus-infected patients. Dig Dis Sci, 54:2722–2728.

Kitadai

, Haruma

, Sumii

, Yamamoto

, Ue

, Yokozaki

, Yasui

, Ohmoto

, Kajiyama

, Fidler

I.J.

, Tahara

1998. Expression of interleukin-8 correlates with vascularity in human gastric carcinomas. Am J Pathol, 152:93–100.

Koch

A.E.

, Polverini

P.J.

, Kunkel

S.L.

, Harlow

L.A.

, DiPietro

L.A.

, Elner

V.M.

, Elner

S.G.

, Strieter

R.M.

1992. Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science, 258:1798–1801.

Kubo

, Ueno

, Hiwatashi

, Sakoda

, Kawaida

, Nuruki

, Aikou

2005. Interleukin 8 in human hepatocellular carcinoma correlates with cancer cell invasion of vessels but not with tumor angiogenesis. Ann Surg Oncol, 12:800–807.

Landi

, Moreno

, Gioia-Patricola

, Guino

, Navarro

, de Oca

, Capella

, Canzian

2003. Association of common polymorphisms in inflammatory genes interleukin (IL)6, IL8, tumor necrosis factor alpha, NFKB1, and peroxisome proliferator-activated receptor gamma with colorectal cancer. Cancer Res, 63:3560–3566.

Lee

W.P.

, Tai

D.I.

, Lan

K.H.

, Li

A.F.

, Hsu

H.C.

, Lin

E.J.

, Lin

Y.P.

, Sheu

M.L.

, Li

C.P.

, Chang

F.Y.

, Chao

, Yen

S.H.

, Lee

S.D.

2005. The −251T allele of the interleukin-8 promoter is associated with increased risk of gastric carcinoma featuring diffuse-type histopathology in Chinese population. Clin Cancer Res, 11:6431–6441.

10.

Llovet

J.M.

, Burroughs

, Bruix

2003. Hepatocellular carcinoma. Lancet, 362:1907–1917.

11.

Michaud

D.S.

, Daugherty

S.E.

, Berndt

S.I.

, Platz

E.A.

, Yeager

, Crawford

E.D.

, Hsing

, Huang

W.Y.

, Hayes

R.B.

2006. Genetic polymorphisms of interleukin-1B (IL-1B), IL-6, IL-8, and IL-10 and risk of prostate cancer. Cancer Res, 66:4525–4530.

12.

Mizukami

, Jo

W.S.

, Duerr

E.M.

, Gala

, Li

, Zhang

, Zimmer

M.A.

, Iliopoulos

, Zukerberg

L.R.

, Kohgo

, Lynch

M.P.

, Rueda

B.R.

, Chung

D.C.

2005. Induction of interleukin-8 preserves the angiogenic response in HIF-1alpha-deficient colon cancer cells. Nat Med, 11:992–997.

13.

Ohyauchi

, Imatani

, Yonechi

, Asano

, Miura

, Iijima

, Koike

, Sekine

, Ohara

, Shimosegawa

2005. The polymorphism interleukin 8-251 A/T influences the susceptibility of Helicobacter pylori related gastric diseases in the Japanese population. Gut, 54:330–335.

14.

Okamoto

, Ishida

, Ikebuchi

, Mandai

, Mimura

, Murawaki

, Yuasa

2010. The genotypes of IL-1 beta and MMP-3 are associated with the prognosis of HCV-related hepatocellular carcinoma. Intern Med, 49:887–895.

15.

Park

E.J.

, Lee

J.H.

, Yu

G.Y.

, He

, Ali

S.R.

, Holzer

R.G.

, Osterreicher

C.H.

, Takahashi

, Karin

2010. Dietary and genetic obesity promote liver inflammation and tumorigenesis by enhancing IL-6 and TNF expression. Cell, 140:197–208.

16.

Poon

R.T.

, Fan

S.T.

, Lo

C.M.

, Liu

C.L.

, Wong

1999. Intrahepatic recurrence after curative resection of hepatocellular carcinoma: long-term results of treatment and prognostic factors. Ann Surg, 229:216–222.

17.

Puthothu

, Krueger

, Heinze

, Forster

, Heinzmann

2006. Impact of IL8 and IL8-receptor alpha polymorphisms on the genetics of bronchial asthma and severe RSV infections. Clin Mol Allergy, 4:2.

18.

Shih

W.L.

, Yu

M.W.

, Chen

P.J.

, Wu

T.W.

, Lin

C.L.

, Liu

C.J.

, Lin

S.M.

, Tai

D.I.

, Lee

S.D.

, Liaw

Y.F.

2009. Evidence for association with hepatocellular carcinoma at the PAPSS1 locus on chromosome 4q25 in a family-based study. Eur J Hum Genet, 17:1250–1259.

19.

Shin

H.D.

, Park

B.L.

, Kim

L.H.

, Jung

J.H.

, Kim

J.Y.

, Yoon

J.H.

, Kim

Y.J.

, Lee

H.S.

2003. Interleukin 10 haplotype associated with increased risk of hepatocellular carcinoma. Hum Mol Genet, 12:901–906.

20.

Snoussi

, Mahfoudh

, Bouaouina

, Ahmed

S.B.

, Helal

A.N.

, Chouchane

2006. Genetic variation in IL-8 associated with increased risk and poor prognosis of breast carcinoma. Hum Immunol, 67:13–21.

21.

Taguchi

, Ohmiya

, Shirai

, Mabuchi

, Itoh

, Hirooka

, Niwa

, Goto

2005. Interleukin-8 promoter polymorphism increases the risk of atrophic gastritis and gastric cancer in Japan. Cancer Epidemiol Biomarkers Prev, 14,11 Pt 1:2487–2493.

22.

Tsai

Y.Y.

, Lin

J.M.

, Wan

, Lin

H.J.

, Tsai

, Lee

C.C.

, Tsai

C.H.

, Tsai

F.J.

, Tseng

S.H.

2008. Interleukin gene polymorphisms in age-related macular degeneration. Invest Ophthalmol Vis Sci, 49:693–698.

23.

Uslu

, Sanli

U.A.

, Dikmen

, Karabulut

, Ozsaran

, Sezgin

, Muezzinoglu

G.G.

, Omay

S.B.

, Goker

2005. Predictive value of serum interleukin-8 levels in ovarian cancer patients treated with paclitaxel-containing regimens. Int J Gynecol Cancer, 15:240–245.

24.

Wei

Y.S.

, Lan

, Tang

R.G.

, Xu

Q.Q.

, Huang

, Nong

H.B.

, Huang

W.T.

2007. Single nucleotide polymorphism and haplotype association of the interleukin-8 gene with nasopharyngeal carcinoma. Clin Immunol, 125:309–317.

25.

, Lin

J.S.

2007. DNA methyltransferase 3B promoter polymorphism and its susceptibility to primary hepatocellular carcinoma in the Chinese Han nationality population: a case-control study. World J Gastroenterol, 13:6082–6086.