IL-28B Genetic Variant Is Associated with the Risk of Schizophrenia in the Chinese Han Population

Abstract

Schizophrenia is a severe psychiatric disorder. Although its exact cause is unknown, it is widely accepted that environmental factors and genes integrate in the pathogenesis of schizophrenia. 19q13, which contains IL-28B, is a newly identified potential susceptibility locus. IL-28B is a cytokine that functionally has anti-viral activity, but, structurally, is related to the interleukin-10 family. Both virus infection and cytokine changes have been documented in schizophrenia. We selected the single-nucleotide polymorphism rs8099917, which is associated with IL-28B gene expression, to study its relationship to the susceptibility to schizophrenia. A total of 256 Chinese patients with schizophrenia and 329 healthy controls were studied. Both genotype and allele frequencies showed significant differences between patients and normal subjects (p=0.03 and p=0.04, respectively). Our study suggested that the frequency of allele T was a risk factor for the susceptibility of schizophrenia (odds ratio [OR]=1.76, 95% confidence interval [CI]=1.03–3.03). When all subjects were grouped by symptoms, both the genotype and the allele frequency were associated with patients having disorganized speech (genotype: χ ²=5.75, p=0.02; allele: χ ²=5.41, p=0.02, OR=3.67, 95% CI=1.14–11.82) and negative symptoms (genotype: χ ²=5.09, p=0.02; allele: χ ²=4.80, p=0.03, OR=1.95, 95% CI=1.06–3.56) as well as cognitive symptoms (genotype: χ ²=5.97, p=0.02; allele: χ ²=5.53, p=0.02, OR=2.04, 95% CI=1.11–3.74). The results in this study may lead to a better understanding of the etiology of schizophrenia.

Introduction

S chizophrenia is a complex mental disorder affecting 1% of the world's population (Ozbey et al., 2009). The etiology is still unknown, but genetic and environmental factors contribute to this disorder, and several hypotheses have been formulated to explain its pathogenic mechanism. Some of these theories consider an abnormal function of neurotransmitter systems; others suggest immunological alterations (Potvin et al., 2008). Moreover, a modification in brain development as a consequence of an early interaction with possible infective agents, especially viruses, contributes to the pathogenesis of schizophrenia (Fruntes and Limosin, 2008; Brown and Derkits, 2010).

Although multiple factors have been associated with an increased risk to develop schizophrenia, the basic risk profile mainly depends on causative genes, which is underpinned by heritability of schizophrenia with up to 80% in monozygotic twins (Sullivan et al., 2003). Linkage and allelic association studies are two general approaches to determine the genetic vulnerability of individuals. In linkage studies, large pedigree samples are analyzed to identify broad chromosomal regions that are likely to harbor genes that are involved in the disorder. Recently, a population-based linkage analysis of schizophrenia identified a new potential susceptibility locus on 19q13 (Francks et al., 2010).

IL-28B, a recently discovered cytokine, is functionally an interferon but structurally related to the interleukin-10 family. In other words, IL-28B displays type I interferon-like anti-viral and cytostatic activities, but it is closer to the IL-10-related cytokines in terms of gene structure, protein structure, and receptor binding (Sheppard et al., 2003; Witte et al., 2010). The IL-10 gene is located on chromosome 1(q31–q32), which is also a locus associated with genetic susceptibility to schizophrenia. The concentration of IL-10 has been reported to increase in the plasma of schizophrenic patients, consistent with the immune deregulation hypothesis of schizophrenia. Association studies focusing on IL-10 genetic polymorphisms and schizophrenia have been reported (Bocchio Chiavetto et al., 2002; Yu et al., 2004). Besides the similarity in biological background to IL-10, IL-28B has anti-viral activities relevant to the virus infection hypothesis of schizophrenia. Viral infection as an etiologic factor in schizophrenia is supported by indirect evidence including possible geographic variance in the prevalence of schizophrenia, a season-of-birth effect, and observed associations between schizophrenia and prenatal exposure to viral epidemics (Pert et al., 1988; Pearce, 2001; Fruntes and Limosin, 2008). The IL-28B gene is located in the 19q13 region, which has been shown by linkage studies to be associated with schizophrenia. Considering the gene location, protein structure, and function, we inferred that IL-28B may be a candidate gene for susceptibility to schizophrenia.

rs8099917 is a promoter single-nucleotide polymorphism (SNP) of IL-28B. It is reported that this gene variant affects IL-28B expression and was associated with the effectiveness of anti-viral treatment of hepatitis C patients (Tanaka et al., 2009; Honda et al., 2010). Thus, in the current study, we chose rs8099917 to evaluate the potential role of genetic variants in IL-28B for susceptibility to schizophrenia in the Han Chinese population. Further, since genes may affect the psychopathological traits (Risch, 1990), we analyzed whether the SNP was associated with certain clinical symptoms in a subset of patients with schizophrenia.

Materials and Methods

Study population

A total of 256 unrelated individuals with schizophrenia (average age 28.44±12.51 years; 117 males and 139 females) were recruited from the inpatient unit of the Mental Health Center of West China Hospital, Sichuan University. These patients were diagnosed between October 2009 and June 2010, strictly according to the Chinese Classification of Mental Disorders, 3rd version, and the International Classification of Diseases, 10th version. Basic clinical characteristics of the 256 Chinese patients with schizophrenia were shown in Table 1. The control samples (n=329, 161 males and 168 females; average age 26.31±4.67 years) were sex- and age-matched healthy people selected from those coming to our hospital for regular health examinations. The inclusion criteria were people with normal physical examination results. The exclusion criteria were those with psychotic symptoms, substance abuse, a history of organic brain diseases, and a family history of mental illness. Signed informed consents were obtained from all the subjects, and the study was approved by the ethics committee of West China Hospital, Sichuan University. All subjects were Han Chinese in origin.

Table 1.

Clinical Data of Patients

Variables	Subgroups	Male, n (%)	Female, n (%)	χ²	P
N		117	139
Onset age (years)	–	22.36±8.49	24.28±10.48	NA	0.11
	10–20	62 (54.05)	65 (44.55)	2.34	0.32
	21–35	45 (35.14)	54 (42.73)	–	–
	36–61	10 (10.81)	20 (12.73)	–	–
Years of education	<6	16 (13.68)	22 (15.83)	1.07	0.78
	6–9	23 (19.66)	29 (20.86)	–	–
	10–12	45 (38.46)	45 (32.37)	–	–
	>12	33 (28.21)	43 (30.94)	–	–
Marriage	–	33 (28.21)	44 (31.66)	0.36	0.55
Family history	–	25 (21.37)	27 (19.42)	0.15	0.70

NA, not applicable.

SNP genotyping

Genomic DNA was extracted using a QIAamp® DNA Blood mini kit (Qiagen) and diluted to 10 ng/μL with the AE buffer provided by the manufacturer. Primers were designed to specifically amplify a fragment spanning the reference allele, avoiding the known polymorphisms. The forward primer sequence 5′ TTGTTTTCCTTTCTGTGAGCAA 3′ and the reverse primer sequence 5′ TGTGGGAGAATGCAAATGAG 3′ were recruited. Polymorphisms of the SNP were detected using the high-resolution melting (HRM) method. This method includes two steps, polymerase chain reaction (PCR) and HRM analysis. rs8099917 G/T variants were amplified in a 96-well plate in the LightCycler^® 480 Real-Time PCR System (Roche Diagnostics). The genotype was defined according to controls, which were run in every experiment. The controls were confirmed by sequencing after the first spot differentiation. A volume of 20 μL PCR reaction mixture contained 10 ng gnomic DNA, 5 pmol of forward and reverse primers, 5 mM of dNTP (Promega), 30 mM MgCl₂ (ChaoShi), 2X buffer (ChaoShi), 1X evagreen dye (Biotium), and 1 U of Hoststar Taq and DNA polymerase (ChaoShi). The thermal cycling profile was initial denaturizing at 95°C for 10 s, annealing at 60°C for 15 s, and extension at 72°C for 25 s. After amplification, PCR products were denatured at 95°C for 1 min and cooled to 40°C for 1 min to form double-strand DNA. HRM analysis was then performed by gradually increasing the temperature from 65°C to 95°C at a rate of 0.01°C /s. HRM analysis was performed by LightCycler^® 480 Gene Scanning software v1.2 (Roche Diagnostics) (Zhou et al., 2010).

Statistical analysis

Hardy–Weinberg equilibrium was assessed for each group. The frequencies of genotype and allele were compared among patients and controls using Pearson Chi-Square analysis, and Fisher's exact test was substituted when sample sizes were smaller than expected (<5 subjects). The calculations of odds ratio (OR) and 95% confidence interval (95% CI) was conducted with the Risk option of Crosstabs by SPSS 17.0. In addition, the demographical parameters were analyzed using the t-test and one-way analysis of variance test. p<0.05 was considered to be statistically significant.

Results

Spot the genotypes

Software-based genotype assignments were obtained in all the samples. In our study we had only two genotypes, the heterozygous TG and homozygous TT. The normalized melting curves and difference plots were well distinguished among the genotype melting profiles.

Gene polymorphisms in patients and normal controls

The genotype distributions and allele frequencies of the SNP are summarized in Table 2. Genotype frequencies of the polymorphisms in both the patient and control groups were in accordance with the Hardy–Weinberg equilibrium (patients and controls, χ ²=0.39 and χ ²=1.69; p>0.05).

Table 2.

Comparisons of IL-28B Gene Polymorphisms (rs8099917) Among Patients With and Without Family History Against Control Groups

		Genotype, n (%)				Allele, n (%)
	N	TT	GT	χ²	P	T	G	χ²	P	OR	95%CI
Controls	329	285 (86.63)	44 (13.37)	–	–	614 (93.31)	44 (6.69)	–	–	–	–
Patients	256	236 (92.19)	20 (7.81)	4.57	0.03	492 (96.09)	20 (3.91)	4.31	0.04	1.76	1.03–3.03
With family history	52	50 (96.15)	2 (3.85)	0.82	0.37	102	2	0.79	0.38	2.35	0.54–10.31
No family history	204	186 (91.18)	18 (8.82)	–	–	390	18	–	–	–	–

OR, odds ratio; CI, confidence interval.

The frequencies of genotype TT and TG in patients were 92.19% and 7.81%, respectively, and in controls were 86.63% and 13.37%, respectively. There were significant differences in genotypes between patients and controls (χ ²=4.57, p=0.03). The frequency of allele T was also significantly different between patients and controls (χ ²=4.31, p=0.04, OR=1.76, 95% CI=1.03–3.03). However, no significant differences of the genotypes or the alleles were found among patients with family history and without family history of mental illness (χ ²=0.82, p=0.37; χ ²=0.79, p=0.38).

Gene polymorphisms in patients with various typical symptoms

Because different genes may confer further risks for specific symptoms, we determined the relationship between the SNP locus and the presence of some important psychiatric symptoms of schizophrenia.

All the subjects were divided into different symptom subgroups. In each subgroup we compared IL-28B gene polymorphism (rs8099917) between subjects with and without the clinical features. As shown in Table 3, both genotype and allele frequencies were associated with patients having disorganized speech (genotype: χ ²=5.75, p=0.02; allele: χ ²=5.41, p=0.02, OR=3.67, 95% CI=1.14–11.82), negative symptoms (genotype: χ ²=5.09, p=0.02; allele: χ ²=4.80, p=0.03, OR=1.95, 95%CI=1.06–3.56), as well as cognitive symptoms (genotype: χ ²=5.97, p=0.02; allele: χ ²=5.53, p=0.02, OR=2.04, 95% CI=1.11–3.74). No significant difference was detected in either the genotype or allele frequencies in other subgroups.

Table 3.

Comparisons of IL-28B Gene Polymorphisms (rs8099917) Between Subjects with Different Typical Clinical Features in Each Subgroup

	Genotypes, n				Alleles, n
Clinical features	TT (N=521)	TG (N=64)	χ²	P	T (N=1106)	G (N=64)	χ²	P	OR	95%CI
Delusion	162	13	3.16	0.08	337	13	2.98	0.08	1.72	0.92–3.20
Hallucination	122	10	1.98	0.16	852	54	1.87	0.17	1.61	0.81–3.21
Disorganized speech	83	3	5.75	0.02	937	61	5.41	0.02	3.67	1.14–11.82
Emotional disturbance	73	6	1.05	0.31	954	58	0.99	0.32	1.54	0.65–3.63
Behavior disorder	102	10	0.58	0.45	892	54	0.54	0.46	1.30	0.65–2.59
Negative symptoms	188	14	5.09	0.02	716	50	4.80	0.03	1.95	1.06–3.56
Cognitive symptoms	194	14	5.97	0.02	402	14	5.53	0.02	2.04	1.11–3.74

Discussion

Here we report that both the genotype and the allele frequencies of rs8099917 in IL-28B were associated with schizophrenia in the Han Chinese population (genotype: χ ²=4.57, p=0.03; allele: χ ²=4.31, p=0.04,). Our study had a 93% and a 91% power to detect the effect in genotype and allele frequency, respectively. Frequency of allele T is a risk factor for susceptibility to schizophrenia (OR=1.76, 95% CI=1.03–3.03). However, there was no difference between patients with family history and without a family history. This may be due to the small number of subjects with family history.

rs8099917 is a common genetic variant of the IL-28B locus. So far it is the only one that has been largely reported to influence IL-28B expression as well as spontaneous virus clearance and therapy response. Expression of IL-28B and several interferon stimulated genes (ISG) were both significantly lower in TT genotype compared to those with TG or GG genotypes in hepatic cells, whereas in peripheral blood mononuclear cells ISG expression levels did not differ significantly (Abe et al., 2011). Although most of studies were carried out in cohorts with hepatitis C virus (HCV) infection (Tanaka et al., 2009; Rauch et al., 2010; Urban et al., 2010), they showed that rs8099917 plays a potential role in determine IL-28B expression and function during virus infection. However, unlike in HCV infection cohorts, in our study frequency of allele T was a risk factor for schizophrenia. The exact cause of rs8099917 affecting IL-28B expression and function as well as the outcome of virus infection is still unclear. Future functional studies of the expression and cytokine production among the different allele carriers under virus exposure could help address the finding of this causal allele of IL-28B to schizophrenia.

The IL-28B gene is located on the chromosomal region mapped to 19q13 encoding three cytokines, IL-29, IL-28A, and IL-28B. These three cytokines are functionally similar to interferon; therefore, they are also known as IFN-λ1, IFN-λ2, and IFN-λ3. IFN-λs proteins have antiviral activity against a number of different viruses (Kotenko et al., 2003; Ank et al., 2006). The viral infection hypothesis, which is viral disruption of normal neurodevelopment, viral-induced autoimmunity, and retroviral integration, has been under serious consideration for decades (Tyrrell et al., 1979; O'Reilly, 1994; Terayama et al., 2003; Fruntes and Limosin, 2008). To date, attempts have failed to identify a specific virus that contributes to the etiology of the disorder, while epidemiologic aspects and indirect studies suggest viral exposure as risk factors (Fruntes and Limosin, 2008). It is probably unreasonable to view schizophrenia as having a single cause. It is much more likely to be a heterogeneous disorder resulting from interactions between multiple factors, including the person's genetics and various environmental influences (Pert et al., 1988; Brown, 2011). Virus infections may well be among environmental variables, and the IL-28B gene may determine idiosyncratic differences in immune responsiveness to common viral pathogens.

Indeed, a decreased production of interferon-alpha and -gamma by leukocytes from patients with schizophrenia during stimulation with virus, despite disease duration and treatment, is shown in multiple studies (Inglot et al., 1994; Hornberg et al., 1995; Arolt et al., 2000). Interestingly, abnormalities in serum or plasma or cerebral fluid concentrations of interferon-alpha and -gamma in schizophrenia are mostly undetected (Preble and Torrey, 1985; Becker et al., 1990; Gattaz et al., 1992; Potvin et al., 2008). These lines of evidence suggest that it might be during virus infection rather than immune modification that interferon play its potential role in susceptibility to schizophrenia. Endogenous IL-28B is not expressed by human neuronal cells, but the expression is significantly induced through an infection imitating (poly I: C) stimulation (Zhou et al., 2009). This research may further support our hypothesis that it is during virus infection that IL-28B gene variants might determine its potential role in susceptibility to schizophrenia. In other words, the genetic predisposition of IL-28B to schizophrenia may comprise an abnormal reaction to virus infection. However, whether this abnormal reaction disrupted neurodevelopment or induced autoimmunity leading to schizophrenia needs to be further confirmed.

In our study, both the genotype and allele frequencies were associated with patients having disorganized speech and negative symptoms, as well as cognitive symptom. Previous data from 151 pairs of monozygotic twins with schizophrenia indicated a greater genetic component in negative symptoms than in positives (DeRosse et al., 2006). Cognitive symptoms sometimes are classified as part of the negative symptoms, so the finding in our study partially strengthens this genetic association. Although our study suggested that IL-28B genetic polymorphisms were associated with subgroups of clinical symptoms, the mechanism is far from understood.

In summary, our study suggests that IL-28B gene variants predispose susceptibility to schizophrenia. Furthermore, this study gives evidence to the possible involvement of the viral infection in the pathogenesis of schizophrenia. However, schizophrenia is a complex disorder and its pathobiological cascade is not fully clarified. Further studies considering virus exposure epidemiologic aspects and exploring the association between the genotype and the cerebrospinal fluid level of IL-28B during virus infection may provide a useful basis for approaching the genetic heterogeneity of this disease.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Abe

, Hayes

C.N.

et al. 2011. IL28 variation affects expression of interferon stimulated gene and peg-interferon and ribavirin therapy. J Hepatol, 54:1094–1101.

Ank

, West

et al. 2006. Lambda interferon (IFN-lambda), a type III IFN, is induced by viruses and IFNs and displays potent antiviral activity against select virus infections in vivo. J Virol, 80:4501–4509.

Arolt

, Rothermundt

et al. 2000. Decreased in vitro production of interferon-gamma and interleukin-2 in whole blood of patients with schizophrenia during treatment. Mol Psychiatry, 5:150–158.

Becker

, Kritschmann

et al. 1990. Serum interferon in first psychotic attack. Br J Psychiatry, 157:136–138.

Bocchio Chiavetto

, Boin

et al. 2002. Association between promoter polymorphic haplotypes of interleukin-10 gene and schizophrenia. Biol Psychiatry, 51:480–484.

Brown

A.S.

2011. The environment and susceptibility to schizophrenia. Prog Neurobiol, 93:23–58.

Brown

A.S.

, Derkits

E.J.

2010. Prenatal infection and schizophrenia: a review of epidemiologic and translational studies. Am J Psychiatry, 167:261–280.

DeRosse

, Funke

et al. 2006. Dysbindin genotype and negative symptoms in schizophrenia. Am J Psychiatry, 163:532–534.

Francks

, Tozzi

et al. 2010. Population-based linkage analysis of schizophrenia and bipolar case-control cohorts identifies a potential susceptibility locus on 19q13. Mol Psychiatry, 15:319–325.

10.

Fruntes

, Limosin

2008. Schizophrenia and viral infection during neurodevelopment: a pathogenesis model? Med Sci Monit, 14:RA71–RA77.

11.

Gattaz

W.F.

, Dalgalarrondo

et al. 1992. Abnormalities in serum concentrations of interleukin-2, interferon-alpha and interferon-gamma in schizophrenia not detected. Schizophr Res, 6:237–241.

12.

Honda

, Sakai

et al. 2010. Hepatic ISG expression is associated with genetic variation in interleukin 28B and the outcome of IFN therapy for chronic hepatitis C. Gastroenterology, 139:499–509.

13.

Hornberg

, Arolt

et al. 1995. Production of interferons and lymphokines in leukocyte cultures of patients with schizophrenia. Schizophr Res, 15:237–242.

14.

Inglot

A.D.

, Leszek

et al. 1994. responses in schizophrenia and major depressive disorders. Biol Psychiatry, 35:464–473.

15.

Kotenko

S.V.

, Gallagher

et al. 2003. IFN-lambdas mediate antiviral protection through a distinct class II cytokine receptor complex. Nature Immunol, 4:69–77.

16.

O'Reilly

R.L.

1994. Viruses and schizophrenia. Aust N Z J Psychiatry, 28:222–228.

17.

Ozbey

, Tug

et al. 2009. Interleukin-10 gene promoter polymorphism in patients with schizophrenia in a region of East Turkey. World J Biol Psychiatry, 10:461–468.

18.

Pearce

B.D.

2001. Schizophrenia and viral infection during neurodevelopment: a focus on mechanisms. Mol Psychiatry, 6:634–646.

19.

Pert

C.B.

, Knight

J.G.

et al. 1988. Scenarios for a viral etiology of schizophrenia. Schizophr Bull, 14:243–247.

20.

Potvin

, Stip

et al. 2008. Inflammatory cytokine alterations in schizophrenia: a systematic quantitative review. Biol Psychiatry, 63:801–808.

21.

Preble

O.T.

, Torrey

E.F.

1985. Serum interferon in patients with psychosis. Am J Psychiatry, 142:1184–1186.

22.

Rauch

, Rohrbach

et al. 2010. The recent breakthroughs in the understanding of host genomics in hepatitis C. Eur J Clin Investig, 40:950–959.

23.

Risch

1990. Linkage strategies for genetically complex traits. I. Multilocus models. Am J Hum Genet, 46:222–228.

24.

Sheppard

, Kindsvogel

et al. 2003. IL-28, IL-29 and their class II cytokine receptor IL-28R. Nature Immunol, 4:63–68.

25.

Sullivan

P.F.

, Kendler

K.S.

et al. 2003. Schizophrenia as a complex trait: evidence from a meta-analysis of twin studies. Arch Gen Psychiatry, 60:1187–1192.

26.

Tanaka

, Nishida

et al. 2009. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nature Genetics, 41:1105–1109.

27.

Terayama

, Nishino

et al. 2003. Detection of anti-Borna Disease Virus (BDV) antibodies from patients with schizophrenia and mood disorders in Japan. Psychiatry Res, 120:201–206.

28.

Tyrrell

D.A.

, Parry

R.P.

et al. 1979. Possible virus in schizophrenia and some neurological disorders. Lancet, 1:839–841.

29.

Urban

T.J.

, Thompson

A.J.

et al. 2010. IL28B genotype is associated with differential expression of intrahepatic interferon-stimulated genes in patients with chronic hepatitis C. Hepatology, 52:1888–1896.

30.

Witte

, Witte

et al. 2010. IL-28A, IL-28B, and IL-29: promising cytokines with type I interferon-like properties. Cytokine Growth Factor Rev, 21:237–251.

31.

, Yang

M.-S.

et al. 2004. An association between polymorphisms of the interleukin-10 gene promoter and schizophrenia in the Chinese population. Schizophr Res, 71:179–183.

32.

Zhou

, Wang

et al. 2009. Activation of toll-like receptor-3 induces interferon-lambda expression in human neuronal cells. Neuroscience, 159:629–637.

33.

Zhou

, Wang

et al. 2010. Association analysis between the rs11136000 single nucleotide polymorphism in clusterin gene, rs3851179 single nucleotide polymorphism in clathrin assembly lymphoid myeloid protein gene and the patients with schizophrenia in the Chinese population. DNA Cell Biol, 29:745–751.