The Association Between -330T/G Polymorphism of Interleukin 2 Gene and Bladder Cancer

Abstract

Bladder cancer is one of the most common cancers in the world. Studies have shown that genetic factors may play important roles in the development of this disease. Interleukin-2 (IL-2) is a cytokine involved in the regulation of proliferation and functional activities of T- and NK-cell. Recombinant IL-2 has been shown to be a promising agent for the activation of immune response against tumors. The aim of this study was to examine the effect of -330T/G polymorphism of the IL-2 gene on the development of bladder cancer in the Chinese population. IL-2 -330T/G polymorphism was detected by polymerase chain reaction-restriction fragment length polymorphism in 365 bladder cancer cases and 390 age-matched healthy controls. Data were analyzed using the Chi-square test. Results showed that individuals with TG genotype or GG genotype had significantly increased susceptibility to bladder cancer (odds ratio [OR]=1.48, 95% confidence interval [CI]: 1.08–2.02, p=0.014 and OR=2.22, 95%CI: 1.35–3.68, p=0.002). Also, the frequency of the G allele was significantly higher in bladder cancer cases compared with healthy controls (OR=1.40, 95%CI: 1.14–1.73, p=0.002). In conclusion, IL-2 -330T/G polymorphism may be involved in the etiology of bladder in Chinese population.

Introduction

B ladder cancer is the ninth most frequent cancer in the world, and it is estimated that there were 340,000 newly diagnosed bladder cancer cases and 130,000 related deaths worldwide in 2000 (Parkin, 2004). In China, bladder cancer is the eighth most common cancer, accounting for more than 20,000 deaths in 2009, and the mortality rate has steadily increased between 1991 and 2009 (Huang et al., 2011; Yee et al., 2011). The incidence and mortality rate of bladder cancer are the highest among urinary system tumors, with the majority (about 70%) of cases occurring in men (Parkin, 2004). Associated with the risk of bladder cancer are tobacco smoking, industrially related aromatic amines and amides (e.g., 4-aminobiphenyl, benzidine, and 2-naphthylamine), and some anticancer drugs, such as phosphoramide mustards (Cohen et al., 2000). Although many people are exposed to these risk factors, only a fraction of exposed individuals develop bladder cancer, suggesting that there are individual variations in susceptibility to exposure-related bladder carcinogenesis.

Interleukin 2 (IL-2) secreted by Th1 cells plays a central role in the activation of T cell-mediated immune responses, functioning as a T cell growth factor that can augment NK cell cytolytic activity and promote immunoglobulin production by B cells. Also, IL-2 contributes to the development of regulatory T cells and regulates the expansion and apoptosis among activated T cells (Lenardo, 1991; D'Souza and Lefrancois, 2003). IL-2 plays an essential role in antitumor immunity (Zhang et al., 2010). Clinical studies have shown that the IL-2 gene transfected into tumor cells can enhance both specific and nonspecific antitumor immune responses (Okamoto et al., 2003; Terao et al., 2005). Recent research has demonstrated that IL-2 might be helpful for the treatment of bladder cancer (Jarmalaite et al., 2009). The -330 T/G polymorphism lies in the promoter region of the IL-2 gene and is implicated in the susceptibility to a range of inflammation diseases and cancers, including gastric atrophy from Helicobacter pylori infection, rheumatoid arthritis, gastric cancer, and myelogenous leukemia (Amirzargar et al., 2005; Pawlik et al., 2005; Togawa et al., 2005; Shin et al., 2008; Wu et al., 2009). However, no studies to date have examined the association between this polymorphism and bladder cancer. Clarification of the relationship between IL-2 -330 polymorphism and bladder cancer may indicate a role of IL-2 function in the etiology of bladder cancer and provide clues to guide the treatment of this disease. To clarify this relationship, we have analyzed IL-2 -330 polymorphism in 365 cases of bladder cancer and 390 controls.

Materials and Methods

Subjects

A total of 365 subjects newly diagnosed with bladder cancer and 390 healthy controls were consecutively recruited from General Hospital of Jinan Military Command between January 2006 and February 2011. Every subject participating in the study was genetically unrelated, of Han Chinese ethnicity, and permanently resided in Shandong province in China. All cases were urology clinic patients with histological confirmed transitional cell carcinoma. The controls were genetically unrelated cancer-free individuals living in the same residential areas and frequency-matched to the cases on age, sex, smoking status, and alcohol use. Control subjects with benign prostate hyperplasia, history of prostatitis, and any degree of hematuria were excluded. A total number of 33 cases and 69 controls were excluded from this study. Individuals that smoked once a day for over 1 year were defined as smokers. Individuals who consumed more than three alcohol drinks or three bottles of beer or 150 mL of wine per week for at least 1 year were considered drinkers. Each subject was informed about the aims and requirements of this study, and informed consent for participation was obtained in accordance with institutional guidance at General Hospital of Jinan Military Command. A structured questionnaire was filled by interviewers to collect information on demographic data and lifestyle characteristics. The research protocol was approved by the institutional review board of General Hospital of Jinan Military Command. Each participant provided 5 mL of peripheral blood.

DNA extraction and genotyping

Genomic DNA was extracted from 5 mL frozen whole blood using the DNA Extraction Kit (Fastagen, China) according to the manufacturer's protocol. The IL-2-330 T/G genotypes were determined using a polymerase chain reaction (PCR)–restriction fragment length polymorphism assay and DNA sequencing analysis. The PCR primers were designed as described previously (Matesanz et al., 2001). The PCR primers for the -330 T/G polymorphisms were 5′ ATTCACATGTTCAGTGTAGTTCT 3′ (forward) and 5′ GTGATAGCTCTAATTCATGC 3' (reverse). The PCR reactions were performed in a total volume of 25 uL containing 100 ng genomic DNA, 20 pM of each primer, 0.2 mM dNTPs, 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH₄)₂SO₄, 2 mM MgSO₄, 0.1% Triton X-100, and 1 unit of Taq polymerase (New England BioLabs). The PCR cycle conditions consisted of an initial denaturation step at 94°C for 5 min, followed by 35 cycles of 30 s at 94°C; 45 s at 61°C, 45 s at 72°C; and a final elongation at 72°C for 8 min.

The PCR products were digested for 3 h at 37°C with BfaI restriction enzyme (New England BioLabs). The digested PCR products were resolved on 8% acrylamide gels and stained with ethidium bromide for visualization under UV light. To confirm the genotyping results, 20% PCR-amplified DNA samples were examined by DNA sequencing and the results were 100% concordant.

Statistical analysis

Genotype and allele frequencies of IL-2 were compared between cases and controls using the Chi-square test and ORs and 95% CIs were calculated to assess the relative risk conferred by a particular allele and genotype. Demographic and clinical data between groups were compared by Chi-square test and Student's t-test. Statistical significance was assumed at the p<0.05 level. The SPSS statistical software package version 13.0 was used for all of the statistical analyses.

Results

Characteristics of the study population

The frequency distributions of select characteristics of the cases and controls are presented in Table 1. The bladder cancer cases and controls did not show a significant difference in the frequency distributions of age (p=0.72), sex (p=0.71), body mass index (p=0.34), occupational status (p=0.83), educational level (p=0.71), or hematological parameters. However, there were more smokers (66.0% vs. 34.0%, p<0.001) and alcohol users (61.1% vs. 38.9%, p<0.001) among the cases than among the controls. The clinicopathological characteristics of bladder cancer patients are shown in Table 1.

Table 1.

Distribution of Selected Demographic Variables and Risk Factors Among the Cancer Cases and Healthy Controls

Characteristic	Cancer patients (n=365)	Controls (n=390)	p-value
Age (years)	61.8±10.9	60.5±11.3	0.72
Sex no. (%)			0.71
Male	287 (78.6)	311 (79.7)
Female	78 (21.4)	79 (20.3)
BMI (kg/m²)	23.5±9.1	22.9±10.5	0.34
Occupational status no. (%)			0.83
Employed	56 (15.3)	62 (15.9)
Unemployed/Retired	309 (84.7)	328 (84.1)
Educational level			0.71
Secondary school	358 (98.1)	381 (97.7)
Post secondary school	7 (1.9)	9 (2.3)
Hematological parameter Mean±SD
Hemoglobin (mg/dL)	13.5±0.41	13.5±0.37	0.81
White blood cells (10³)	6.22±2.11	6.31±1.99	0.58
Red blood cells (10⁹)	7.85±0.58	7.79±0.63	0.77
Platelets (10³)	855±102	849±111	0.63
Smoking status			<0.001
No	124 (34.0)	228 (58.5)
Yes	241 (66.0)	162 (41.5)
Drinking status			<0.001
No	142 (38.9)	229 (58.7)
Yes	223 (61.1)	161 (41.3)
Primary tumor stage
Superficial tumor (pTa-pT1)	215 (58.9)
Invasive tumor (pT2-pT4)	150 (41.1)
Histopathological grade
G1	54 (14.8)
G2	200 (54.8)
G3	111 (30.4)
Tumor number
Single	236 (64.7)
Multiple	129 (35.3)
Tumor size (cm)
<1	118 (32.3)
1–3	108 (29.6)
>3	139 (38.1)

Genotype distributions of IL-2 -330 polymorphism among the cases and controls

The genotype and allele frequencies of the IL-2 -330 polymorphism in bladder cancer cases and healthy controls are summarized in Table 2. The genotype distributions of the IL-2 -330 polymorphisms among the controls were in agreement with the Hardy–Weinberg equilibrium. The TT, TG, and GG genotype frequencies were 29.9%, 56.2%, and 13.9% among the cases and 40.3%, 51.3%, and 8.4% among the controls. Frequencies of the IL-2 -330 TG and GG genotypes were significantly higher in patients than in controls (OR=1.48, 95%CI: 1.08–2.02, p=0.014 and OR=2.22, 95%CI: 1.35–3.68, p=0.002). Also, the IL-2 -330 G allele carrier frequency showed significantly increased prevalence in patients than in controls (OR=1.40, 95%CI: 1.14–1.73, p=0.002). These data suggest that the IL-2 -330 TG genotype, GG genotype, and G allele were associated with an increased susceptibility to bladder cancer in Chinese population.

Table 2.

Genotype and Allele Frequencies of the IL-2-330 G/T Polymorphism Among the Cases and Controls and the Association with Risk of Bladder Cancer

Variables	Cases (n=365) (%)	Controls (n=390) (%)	OR (95%CI)	p-Value
Genotype
TT	109 (29.9)	157 (40.3)	Referent
TG	205 (56.2)	200 (51.3)	1.48 (1.08–2.02)	0.014^a
GG	51 (13.9)	33 (8.4)	2.22 (1.35–3.68)	0.002^a
Allele
T	423 (57.9)	514 (65.9)	Referent
G	307 (42.1)	266 (34.1)	1.40 (1.14–1.73)	0.002^a

p<0.05.

OR, odds ratio; CI, confidence interval.

Stratification analysis between IL-2 -330 polymorphism and bladder cancer risk

We further evaluated the association between IL-2 -330T/G polymorphism and clinical-pathological factors in the 365 bladder cancer patients. The stratification analysis, including age, gender, primary tumor stage, tumor number, tumor size, drinking status, and smoking status are shown (Table 3). None of the data reached significant difference (p=0.862 for age, p=0.769 for gender, p=0.178 for tumor stage, p=0.814 for tumor number, p=0.092 for tumor size, p=0.245 for drinking status, and p=0.223 for smoking status respectively), indicating that the IL-2 polymorphism may not be associated with these clinical-pathological factors.

Table 3.

Stratification Analysis Between the IL-2-330 T/G Polymorphism and Bladder Cancer Risk

Variables	T allele n (%)	G allele n (%)	OR (95% CI)	p-value
Age	Referent		0.97 (0.68–1.38)	0.862
≤55	96 (58.5)	68 (41.5)
>55	327 (57.8)	239 (42.2)
Sex	Referent		1.06 (0.74–1.51)	0.769
Male	331 (57.7)	243 (42.3)
Female	92 (59.0)	64 (41.0)
Tumor stage	Referent		0.81 (0.60–1.10)	0.178
Superficial (pTa-pT1).	258 (60.0)	172 (40.0)
Invasive (pT2-pT4)	165 (55.0)	135 (45.0)
Tumor number	Referent		0.96 (0.71–1.31)	0.814
Single	275 (58.3)	197 (41.7)
Multiple	148 (57.4)	110 (42.6)
Tumor size	Referent		1.30 (0.96–1.76)	0.092
≤3 cm	251 (55.5)	201 (44.5)
>3 cm	172 (61.9)	106 (38.1)
Drinking status	Referent		1.20 (0.88–1.62)	0.245
No	157 (55.3)	127 (44.7)
Yes	266 (59.6)	180 (40.4)
Smoking status	Referent		0.83 (0.61–1.12)	0.223
No	136 (54.8)	112 (45.2)
Yes	287 (59.5)	195 (40.5)

Discussion

In this case-control study in Chinese population, we examined the association of the IL-2 -330 T/G polymorphism with susceptibility to bladder cancer. Human IL-2 is a glycoprotein secreted by activated T lymphocytes and natural killer cells (Bubeník, 2004; GaVen and Liu, 2004). This cytokine has a broad effect on the human immune system. After binding with its specific receptors, IL-2 enhances proliferation, cytotoxic activity, and cytokine secretion of antigen-stimulated T cells and NK cells. Early on, it was shown that peritumoral injection of rat lymphoid IL-2 induces marked inhibition of induced sarcomas in mice (Bubeník et al., 1983). The tumor inhibitory effects of local IL-2 administration were repeated and confirmed in various experimental models (Bubeník, 2004; GaVen and Liu, 2004). In the United States and in many other countries, IL-2 is approved for treatment of advanced renal cell carcinoma and melanoma. Although the objective response rate to IL-2 therapy in renal cell carcinoma and melanoma is rather low, ranging from 15% to 20%, the response may last for more than 10 years in some patients (Pyrhönen, 2004). Several publications suggest that instillations of IL-2 into the urinary bladder may be effective in treating superficial bladder carcinoma (Den Otter et al., 1998; Grasso et al., 2001). A recent pilot study shows favorable effects of IL-2 therapy observed in 43% of patients with multifocal superficial bladder cancer (Jarmalaite et al., 2010). These results indicate that changes in serum IL-2 level may affect the development of bladder cancer.

Human genetic polymorphisms could play critical roles in various diseases (Liu et al., 2011; Ma et al., 2011; Wang et al., 2011). Due to the importance of IL-2, polymorphisms in this gene have been extensively researched and two polymorphisms have been identified: one located in the promoter region at nucleotide -330 (John et al., 1998), and another in the first exon at position +114 (Matesanz et al., 2000). According to the HapMap Project and Environmental Genome Project, the synonymous substitution at +114, is not observed in Chinese population, while the frequency of the IL-2 -330 G allele is about 0.34 in Asian populations. Also, the -330T/G polymorphism has shown to alter IL-2 level and to be associated with diseases and cancers, including gastric atrophy from Helicobacter pylori infection, rheumatoid arthritis, gastric cancer, and myelogenous leukemia (Amirzargar et al., 2005; Pawlik et al., 2005; Togawa et al., 2005; Shin et al., 2008; Wu et al., 2009). Due to these data, we focused our research on the relation of -330 polymorphism with bladder cancer and found that the TG genotype, GG genotype, and G allele were associated with higher risk of bladder cancer. The mechanism is not clear yet. Since it was reported that the G allele is correlated with reduced IL-2 production in vivo (Hoffmann et al., 2001; Matesanz et al., 2004), it is possible that the decreased IL-2 level can also downregulate the antitumor response in bladder cancer patients and therefore increase the susceptibility to this disease. It would be important to conduct further studies to clarify the mechanisms.

There are some limitations to this study. Our patient sample size was small, and additional studies are needed. Since our study focused on the Chinese population it would be important to conduct a similar study in other ethnic populations. In addition, the current research studied a single polymorphism. It would be interesting to identify more polymorphisms in IL-2 gene and study their correlations with bladder cancer.

In conclusion, this case-control study demonstrates that the IL-2 gene -330 TG, GG genotypes, and G allele are associated with elevated susceptibility to bladder cancer in the Chinese population. Our results provide insights for understanding the etiology of bladder cancer.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Amirzargar

A.A.

, Bagheri

, Ghavamzadeh

, Alimoghadam

, Khosravi

, Rezaei

, Moheydin

, Ansaripour

, Moradi

, Nikbin

2005. Cytokine gene polymorphism in Iranian patients with chronic myelogenous leukaemia. Int J Immunogenet, 32:167–171.

Bubeník

2004. Interleukin-2 therapy of cancer. Folia Biol, 50:120–130.

Bubeník

, Perlmann

, Indrova

, Simova

, Jandlova

, Neuwirt

1983. Growth inhibition of an MC-induced mouse sarcoma by TCGF (IL 2)-containing preparations. Cancer Immunol Immunother, 14:205–206.

Cohen

S.M.

, Shirai

, Steineck

2000. Epidemiology and etiology of premalignant and malignant urothelial changes. Scand J Urol Nephrol Suppl, 34:105–115.

Den Otter

, Dobrowolski

, Bugajski

1998. Intravesical interleukin-2 in T1 papillary bladder carcinoma: regression of marker lesion in 8 of 10 patients. J Urol, 159:1183–1186.

D'Souza

W.N.

, Lefrancois

2003. IL-2 is not required for the initiation of CD8 T cell cycling but sustains expansion. J Immunol, 171:5727–5735.

GaVen

S.L.

, Liu

K.D.

2004. Overview of interleukin-2 function, production and clinical applications. Cytokine, 28:109–123.

Grasso

, Torelli

, Scannapieco

, Franzoso

, Lania

2001. Neoadjuvant treatment with intravesical interleukin-2 for recurrent superWcial transitional bladder carcinoma Ta-T1/G1–2. J Immunother, 24:184–187.

Hoffmann

S.C.

, Stanley

E.M.

, Darrin Cox

, Craighead

, DiMercurio

B.S.

, Koziol

D.E.

, Harlan

D.M.

, Kirk

A.D.

, Blair

P.J.

2001. Association of cytokine polymorphic inheritance and in vitro cytokine production in anti-CD3/CD28-stimulated peripheral blood lymphocytes. Transplantation, 72:1444–1450.

10.

Huang

J.L.

, Qiu

, Ma

L.L.

, Huang

, Hou

X.F.

, Tian

X.J.

2011. Analysis of perioperative complications of laparoscopic radical cystectomy for bladder cancer. Beijing Da Xue Xue Bao, 43:544–547.

11.

Jarmalaite

, Andrekute

, Scesnaite

, Suziedelis

, Husgafvel-Pursiainen

, Jankevicius

2010. Promoter hypermethylation in tumour suppressor genes and response to interleukin-2 treatment In bladder cancer: a pilot study. J Cancer Res Clin Oncol, 136:847–854.

12.

John

, Turner

, Donn

, Sinnott

, Worthington

, Ollier

W.E.

, Hutchinson

I.V.

, Hajeer

A.H.

1998. Two novel biallelic polymorphisms in the IL-2 gene. Eur J Immunogenet, 25:419–420.

13.

Lenardo

M.J.

1991. Interleukin-2 programs mouse alpha beta T lymphocytes for apoptosis. Nature, 353:858–861.

14.

Liu

, He

, Feng

, Shi

, Gao

, Wu

, Song

, Yuan

2011. Cytotoxic T-lymphocyte Antigen-4 Polymorphisms and Susceptibility to Osteosarcoma. DNA Cell Biol, 30:1051–1055.

15.

, Song

, Zhang

2011. Lysyl Oxidase G473A Polymorphism Is Associated with Increased Risk of Coronary Artery Diseases. DNA Cell Biol, 30:1033–1037.

16.

Matesanz

, Delgado

, Fresno

, Alcina

2000. Allelic selection of human IL-2 gene. Eur J Immunol, 30:3516–3521.

17.

Matesanz

, Fedetz

, Collado-Romero

, Fernandez

, Guerrero

, Delgado

, Alcina

2001. Allelic expression and interleukin-2 polymorphisms in multiple sclerosis. J Neuroimmunol, 119:101–105.

18.

Matesanz

, Fedetz

, Leyva

, Delgado

, Fernandez

, Alcina

2004. Effects of the multiple sclerosis associated −330 promoter polymorphism in IL2 allelic expression. J Neuroimmunol, 148:212–217.

19.

Okamoto

, Tsuburaya

, Yanoma

, Yoshikawa

, Cho

, Takanashi

, Noguchi

2003. Inhibition of peritoneal metastasis in an animal gastric cancer model by interferongamma and interleukin-2. Anticancer Res, 23:149–153.

20.

Parkin

D.M.

2004. International variation. Oncogene, 23:6329–6340.

21.

Pawlik

, Kurzawski

, Florczak

, Gawronska Szklarz

, Herczynska

2005. IL1beta?3953 exon 5 and IL-2–330 promoter polymorphisms in patients with rheumatoid arthritis. Clin Exp Rheumatol, 23:159–164.

22.

Pyrhönen

S.O.

2004. Systemic therapy in metastatic renal cell carcinoma. Scand J Surg, 93:156–161.

23.

Shin

W.G.

, Jang

J.S.

, Kim

H.S.

, Kim

S.J.

, Kim

K.H.

, Jang

M.K.

, Lee

J.H.

, Kim

H.J.

, Kim

H.Y.

2008. Polymorphisms of interleukin-1 and interleukin-2 genes in patients with gastric cancer in Korea. J Gastroenterol Hepatol, 23:1567–1573.

24.

Terao

, Shirakawa

, Goda

, Kamidono

, Fujisawa

, Gotoh

2005. Recombinant interleukin-2 enhanced the antitumor effect of ADV=RSV-HSV-tk=ACV therapy in a murine bladder cancer model. Anticancer Res, 25:2757–2760.

25.

Togawa

, Joh

, Itoh

, Katsuda

, Ito

, Matsuo

, Tajima

, Hamajima

2005. Interleukin-2 gene polymorphisms associated with increased risk of gastric atrophy from Helicobacter pylori infection. Helicobacter, 10:172–178.

26.

Wang

, Song

, Liu

, Song

, Cao

2011. CD86+ 1057G/A Polymorphism and Susceptibility to Osteosarcoma. DNA Cell Biol, 30:925–929.

27.

, Lu

, Ding

Y.B.

, Ke

, Hu

Z.B.

, Yan

Z.G.

, Xue

, Zhou

, Hua

Z.L.

, Shu

Y.Q.

, Liu

, Shen

, Xu

Y.C.

, Shen

H.B.

2009. Promoter polymorphisms of IL2, IL4, and risk of gastric cancer in a high-risk Chinese population. Mol Carcinog, 48:626–632.

28.

Yee

D.S.

, Ishill

N.M.

, Lowrance

W.T.

, Herr

H.W.

, Elkin

E.B.

2011. Ethnic differences in bladder cancer survival. Urology, 78:544–549.

29.

Zhang

, Luo

C.L.

, He

B.C.

, Zhang

J.M.

, Cheng

, Wu

X.H.

2010. Exosomes derived from IL-12-anchored renal cancer cells increase induction of specific antitumor response in vitro: a novel vaccine for renal cell carcinoma. Int J Oncol, 36:133–140.