Polymorphism Arg72Pro of p53 Confers Susceptibility to Squamous Cell Carcinoma of Lungs in a North Indian Population

Introduction

L ung cancer is one of the commonest neoplasms all over the world with ∼1.61 million new cases worldwide in 2008, representing 12.7% of all new cancers (Ferlay et al., 2008). Lung cancer is also the most devastating cause of cancer-related deaths with more than 1.38 million deaths (18.2% of all cancer-related deaths worldwide) in 2008. The developing nations are witnessing an increasing trend in lung cancer incidence and accounts for almost 55% of the total global incidence. In India, there were 58,567 (6.2% of total cancer cases) new lung cancer cases and 52,269 (8.3% of total cancer-related deaths) deaths due to lung cancer (Ferlay et al., 2008). Although cigarette smoking has been attributed as the predominant cause, not all smokers develop lung cancer (Alberg et al., 2005). Interindividual genetic variation, due to single-nucleotide polymorphisms (SNPs), has been shown to play pivotal role for predisposition to lung cancer.

The tumor suppressor protein p53 is a transcription factor that is associated with many cellular functions, including cell cycle regulation, DNA repair, inhibition of spontaneous mutations, cellular differentiation, and apoptosis, in response to cellular stress, including DNA damage (Robles and Harris, 2001; Melino et al., 2003; Oren, 2003; Lane, 2004). p53 inactivation is a frequent and early event in lung carcinogenesis (Nigro et al., 1989; Takahashi et al., 1989; Hollstein et al., 1991; Vahakangas et al., 1992; Bennett et al., 1993), and several studies worldwide have shown association between tumor suppressor protein p53 and lung cancer. Furthermore, p53 is a major determinant of cell survival and is a safeguard against genetic instability (Robles and Harris, 2001). p53 importance as a tumor suppressor is reflected by its high rate of mutation in all human cancers, with >50% of adult human tumors bearing inactivating mutations or deletions in this gene. Consistent with its tumor suppressor functions, mutations in p53 are present in >90% of small-cell lung cancers and >50% of non-small-cell lung cancers (Nigro et al., 1989; Tammemagi et al., 1999; Vousden, 2000; Pfeifer et al., 2002; Yokota and Kohno, 2004).

Based on the role of the p53 protein in preventing tumor formation, genetic variability in the p53 gene may modulate lung cancer susceptibility. Till date, a total of 300 SNPs are documented in NCBI, among them 34 SNPs are in the coding region (www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=7157). The most commonly studied polymorphism in p53 is Arg72Pro, which affects the biological activity of p53 protein. Protein having Arginine (Arg) at codon 72 can more effectively induce p53-mediated apoptosis, partially through targeting of p53 to the mitochondria (Dumont et al., 2003; Sullivan et al., 2004). Meanwhile, the Proline (Pro) at codon 72 of p53, when compared with Arginine, more efficiently induced cell cycle arrest (Pim, 2004; Sullivan et al., 2004) and DNA repair (Siddique and Sabapahty, 2006). Many epidemiological studies examined the association of the p53 Arg72Pro polymorphism with lung cancer, with inconsistent results of association with lung cancer (Matakidou et al., 2003; Murphy, 2006; Pietsch et al., 2006). In the present study, we examined the possibility of a new polymorphism if any in exon 4 of the p53 gene and the association of the Arg72Pro polymorphism with lung cancer predisposition in the North Indian population.

Materials and Methods

Genotyping of codon 72 in the p53 gene

Genomic DNA was isolated from 200 μL peripheral blood samples using the QIAamp^® DNA Mini kit (Qiagen, Inc., Valencia, CA), as per the manufacturer protocol. Exon 4 was polymerase chain reaction (PCR)-amplified by using forward primer ATCTACAGTCCCCCTTGCCG and reverse primer TGACTTGCACGGTCAGTTGC, 5 μL of 10× Taq buffer (10 mM Tris–Cl, pH 9.0, 1.5 mM MgCl₂, 50 mM KCl, and 0.01% gelatin), 1.5 U of Taq polymerase, and 200 μmol dNTPs (all from Bangalore Genei, Bangalore, India). About ∼100 ng genomic DNA was used for each reaction. PCR products were analyzed by electrophoresis on agarose gel.

In the preliminary study, to identify new polymorphisms in exon 4 of the p53 gene, PCR-amplified exon 4 from genomic DNA of 20 each randomly selected patients and controls were sequenced by using an ABI 3100 Genetic analyzer. The cycle-sequencing reactions were performed by using a Big Dye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster city, CA), 15–20 ng amplified DNA, and 5.0 pmol of the same forward or reverse primer that was used for amplification of the exon 4. Amplicons from both strands were sequenced, and no discrepancies were observed. The obtained data were analyzed by sequencing analysis software v5.1 (ABI) and aligned by using Lasergene v5.07® software (DNA STAR, Inc., Madison, WI).

After the preliminary study, the polymorphism Arg72Pro was analyzed by the PCR–restriction fragment length polymorphism (RFLP) method (Ara et al., 1990) in 175 cases and 202 controls. The PCR product of exon 4 was restriction digested with Bsh1236I restriction enzyme (Fermentas Life Sciences, USA) at 37°C overnight and resolved on 2% Nuseive^® agarose gel. Mutation at codon 72 abolished the restriction site of Bsh1236I and remains undigested 296-bp fragment, while the wild type gave two fragments of the size 169 and 127 bp (Fig. 1).

OPEN IN VIEWER

FIG. 1.

Polymerase chain reaction–restriction fragment length polymorphism analysis of Pro72Arg in exon 4 after digestion with restriction enzymes Bsh1236I and resolved on 2% Nuseive^® agarose gel. Mutation at codon 72 abolished the restriction site of Bsh1236I and remained as undigested 296-bp fragment while wild type gave two fragments of the size 169 and 127 bp. Lane M, 100 base-pair DNA size ladder; lanes, 1, 2, 7, 9, and 10 are heterozygous; lanes 3 and 4 depict wild type; and lanes 5, 6, and 8 represent homozygous mutant.

Results

Discussion

There is an expanding body of literature suggesting that host factors, including genetic polymorphisms, may explain some of the individual differences in cancer occurrence (Kawajiri et al., 1993a; Gonzalez, 1995). We have shown that the genetic polymorphism exon 4 Arg72Pro in the tumor suppressor p53 gene contributes to predisposition of younger subjects for the lung cancer in the North Indian population. The genotype Pro72Pro occurred more frequently as well as significantly associated with SCC in the North Indian population. The population of cases and controls was composed mainly of men (Table 1), and therefore the results derived from this study can be considered restricted to the male population. We could not compare the risk in association with gender due to a small number of female patients with lung cancer (3.4%; Table 1).

p53 is a well-studied tumor suppressor gene that plays a central role in cell-cycle control, DNA repair, and apoptosis in response to DNA damage (Shen et al., 2002). Mutation of p53 is considered an important genetic event in the development of lung cancer (Chiba et al., 1990). The first polymorphism detected in the p53 gene was Arg72Pro, and it was suggested that the two alleles Arg/Pro of codon 72 might have different oncogenic properties (Matlashewski et al., 1987). Although the relationship between the polymorphism Arg72Pro and lung cancer has been studied, the results have been inconsistent with its association with lung cancer, possibly due to differences in ethnicity and in background risk due to smoking (Weston et al., 1992; Jin et al., 1995; Murata et al., 1996; Wang et al., 1999; Fan et al., 2000; Wu et al., 2002; Sobti et al., 2009; Chua et al., 2010). A possible involvement of ethnicity in altering the p53 functionality, with respect to the SNP and mutational status, is evident from the findings of two studies that showed significantly higher or a lower prevalence of the p53 gene mutations in lung cancers among carriers of the Pro allele in the Polish (Szymanowska et al., 2006) or a Norwegian population (Lind et al., 2007), respectively.

Many previous studies found no association between the codon 72 of p53 SNPs and the risk of developing lung cancer (Pierce et al., 2000; Biros et al., 2001; Papadakis et al., 2002; Giuliani et al., 2007). Recently, a pooled analysis of 32 case–control studies involving 19,255 subjects was conducted to explore the real association between the p53 codon-72 polymorphism and lung cancer risk (Dai et al., 2009). Pooled analysis results showed that significantly elevated lung cancer risks were associated with variant genotypes in all genetic models (OR=1.21 for Pro/Arg vs. Arg/Arg and OR=1.20 for Pro/Pro vs. Arg/Arg). This study concluded that Pro at codon 72 is emerging as a low-penetrance susceptibility allele for lung cancer development. These findings were also supported by another recently published meta-analysis of 23 studies involving 15,857 subjects (Li et al., 2009). Another meta-analysis of 13 epidemiologic studies observed that the OR of lung cancer associated with the Pro/Pro genotype was 1.18, and was 1.02 for Pro-carriers (Matakidou et al., 2003). In one of the studies, the association between the p53 codon-72 polymorphism and elevated lung cancer risk was observed only with Caucasians, but not with the African-American and Mexican-American population (Wu et al., 2002). In the present report, we observed a significant association of the genotype Pro72Pro with 2.78-fold increased risk for lung cancer susceptibility. It has been reported that the genotype Pro72Pro was less efficient in suppressing cell transformation and slower in inducing apoptosis than was the p53 wild-type (Arg72Arg) protein (Thomas et al., 1999). Likewise, another study demonstrated that the p53 wild-type (Arg72Arg) protein was more efficient than the p53-mutant protein (Pro72Pro) at binding and inactivating p73, a tumor suppressor protein responsible for apoptosis (Marin et al., 2000). Our study is supported by previous studies from India (Sreeja et al., 2008) and Chile (Irarrazabal et al., 2003), which also reported a dominant presentation of the Pro/Pro homozygotes in a lung carcinoma population than in the control population (OR=2.1 and 3.88, respectively). In contrast to these reports, a study from India reported the presence of a significantly increased frequency of the Arg/Arg homozygotes in patients with advanced lung cancer than controls (OR=5.13) (Jain et al., 2005). Studies from Greece, Iran, and Turkey also suggested that the p53 Arg/Arg genotype represents a potential risk factor for the development of lung cancer (Papadakis et al., 2002; Nadji et al., 2007; Buyru et al., 2008). These differences in lung cancer risk conferred by the p53 codon-72 polymorphism again supports the theory of involvement of ethnicity, smoking, and other factors in modifying cancer risk and susceptibility.

In current study, the genotype Pro72Pro was also analyzed for its association with a different clinical phenotype, that is, histology of lung cancer. Analysis revealed that the genotype Pro72Pro significantly associated with the elevated risk for SCC, but this association was different from the previous studies from the other ethnic groups. An increased risk of developing lung cancer was posed by the p53 Pro allele (versus Arg/Arg) in AC compared with controls (OR=1.36), but not in SCC (OR=1.04) (Liu et al., 2001). Another study also found that the genotypes Pro72Pro and Arg72Pro were associated with an increased risk of lung AC in Caucasians (Fan et al., 2000). A study from Japan also reported the higher prevalence of the Pro72Pro variant in AC cases, but their distribution was not statistically different (Kawajiri et al., 1993b). Two recently published meta-analyses also showed the association of the Pro allele with the risk of developing AC of the lung (Dai et al., 2009; Li et al., 2009). However, another study did not observe association of the polymorphism Arg72Pro with any lung cancer histology in a Caucasian and an African-American population (Weston et al., 1994). The reason for the observed tissue-specific difference in the risk conferred by the polymorphism Arg72Pro of the p53 gene is unknown. A hypothesis suggested that different carcinogenic processes are involved in the genesis of various tumor types because of the presence of a functionally different p53 allele (Pro or Arg) (Kawajiri et al., 1993b). The functional difference of the p53 polymorphism at codon 72 has reported that the genotype Arg72Arg of the p53 gene induces apoptosis with faster kinetics and suppresses transformation more efficiently than the genotype Pro72Pro (Thomas et al., 1999).

In the present study, SCC was the most common form of lung cancer (58.3%) and was followed by AC (19.4%). This observation is consistent with the result of a review on lung cancer published by (Behera and Balamugesh, 2004) in India. However, this distribution of lung cancer histology is different from the Western population where the AC is the predominant type of lung cancer (Alberg et al., 2005; Subramanian and Govindan, 2007). This contrast in the prevalence of histopathology of lung cancer in the Western population might be due to changes in the characteristics of cigarettes and consequent changes in the inhaled doses of carcinogens (Wynder and Muscat, 1995; Hoffmann and Hoffmann, 1997). Nitrate levels in tobacco smoke have also increased due to changed composition of cigarettes in the Western countries, which enhances the combustion of tobacco smoke. More complete combustion decreases the concentrations of polycyclic aromatic hydrocarbons, but the increased production of nitrogen oxides contributes to increased formation of tobacco-specific nitrosamines. An increase in the dose of the potent tobacco-specific nitrosamine, NNK (Nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone), has been postulated as one factor leading to the increase in AC in the Western population (Hoffmann and Hoffmann, 1997; Hecht, 1999).

For the analysis of environmental interaction with the genotype Pro72Pro of the p53 gene and risk of lung cancer, we used the case-only approach rather than a case–control study. One of the major requirements of a case–control study is the strict selection of matching controls in the population, which is difficult to follow. In a case–control design, misclassification can lead to false interactions (Greenland, 1980). There are some recent case-only reports (Hunter et al., 1997; Deng et al., 2004; Jain et al., 2006; Tilak et al., 2011) on gene–environment interaction to determine the etiology of disease. Therefore, a case-only approach has been considered a relatively efficient and valid approach to screen gene–environment interaction under the assumption of the independence between exposure and genotype in a population. In our study, we did not observe the significant interaction of the genotypes Pro72Pro or Arg72Pro with smoking for higher risk of lung cancer. This analysis included all smokers with respect to their smoking level, because sufficient smoking information was not available for further stratification of the smoking in to the pack years. Previous studies have looked at the association of the p53 codon-72 gene polymorphism and smoking-related lung cancer risk. In contrast to ours, previous study has shown a significant and positive association between the Pro allele carriers and smoking habits in both case–control and case-only designs (Cáceres et al., 2009). Recently performed meta-analysis also showed that the Pro allele confers a risk of developing smoking-related lung cancer (Dai et al., 2009; Li et al., 2009). Some studies have showed that genetic differences in risk may be smaller at high loads of carcinogen exposure when environmental influences may overcome the association with a genetic predisposition (Khoury et al., 1988; Amos et al., 1992), but a study showed a little difference between the susceptible genotypes and pack years at higher doses of smoking (Fan et al., 2000).

Conclusion

Our study showed that genotype Pro72Pro of the p53 gene contributes to the susceptibility for lung cancer, and this risk is more pronounced to SCC of the lung in the North Indian population.