Retracted: HBx Elevates Oncoprotein AEG-1 Expression to Promote Cell Migration by Downregulating miR-375 and miR-136 in Malignant Hepatocytes

Abstract

DNA and Cell Biology

officially retracts the paper entitled, “HBx Elevates Oncoprotein AEG-1 Expression to Promote Cell Migration by Downregulating miR-375 and miR-136 in Malignant Hepatocytes,” by Jing Zhao, Wenjie Wang, Yuxian Huang, Jing Wu, Mingquan Chen, Peng Cui, Wenhong Zhang, and Ying Zhang (DNA and Cell Biology; doi: 10.1089/dna.2014.2376).

After the journal has published a post-publication correction to the article,¹ additional considerations were made after revisiting the recently released guidelines by STM: Advancing Trusted Research.² These recommendations indicate that replicative experiments should not be permitted if they were not generated at the time of the original experimentation.^{3[section A2(4)]}

The Editor and Publisher of DNA and Cell Biology are committed to preserving the scientific literature and the community it serves, and abides by all standard guidelines for, and proper protocols of, scientific publishing.

References

1. [No author(s) listed]. Correction to: HBx elevates oncoprotein AEG-1 expression to promote cell migration by downregulating miR-375 and miR-136 in malignant hepatocytes by Zhao et al. Epub 2021 Sep 27. doi: 10.1089/dna.2014.2376.correx

2. Working Group on Image Alterations and Duplications. STM STEC Working Group on Image Alterations and Duplications. https://www.stm-assoc.org/standards-technology/working-group-on-image-alterations-and-duplications/ Last accessed Sept. 29, 2021.

3. STM Working Group on Image Alteration and Duplication Detection. STM Recommendations for handling image integrity issues. https://osf.io/kgyc6/ Last accessed Sept. 29, 2021.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common worldwide malignancies with high morbidity and mortality. Chronic hepatitis B virus (HBV) infection is a major risk factor (Kew, 2010). The hepatitis B viral X (HBx) protein encoded by HBV plays important roles in hepatocarcinogenesis (Zhang et al., 2006) and high HCC incidence is observed in the HBx-transgenic mice (Kim et al., 1991). HBx is a multifunctional regulator involved in modulating the expression of many viral and cellular genes, which affect cell survival, apoptosis, and intracellular signal transduction, and stimulate invasion and metastasis of HCC (Zhang et al., 2006). For instance, HBx interacted with oncoprotein AIB1 and increased the stability of AIB1. Thus, HBx cooperated with AIB1 to promote matrix metallopeptidase 9 (MMP-9) expression and enhance HCC cell invasiveness (Liu et al., 2012). HBx can also affect some microRNA (miRNA) expression. Let-7a was the first established miRNA downregulated by HBx, which led to the upregulation of STAT3 to increase cell proliferation in HBx-expressing cells (Wang et al., 2010).

Astrocyte elevated gene-1 (AEG-1), also named as metadherin (MTDH) or 3D3/LYRIC, has been regarded as an important oncogene, which is located in 8q22 and this region is amplified in breast cancer (Hu et al., 2009) and HCC (Yoo et al., 2009). AEG-1 overexpression has been observed in various cancers and is associated with poor clinical outcomes (Yoo et al., 2011). The transgenic mouse expressing AEG-1 in specific hepatocyte developed multinodular HCC with steatosis when treating with N-nitrosodiethylamine (Srivastava et al., 2012). The positive feedback loop interplay existed between AEG-1 and oncogenic Ha-ras requiring PI3K-Akt pathway, and synergistically resulted in tumor aggressiveness (Lee et al., 2006, 2008). AEG-1 was the downstream target of Ha-ras. Ha-ras could activate PI3K-Akt pathway to induce transcription factor c-MYC recruitment in E-box elements of the AEG-1 promoter region, and consequently augmented AEG-1 expression and promoted cell proliferation and invasiveness (Lee et al., 2006). Additionally, AEG-1 overexpression enabled Akt phosphorylation activation to induce cell survival under serum starvation by inhibiting apoptosis (Lee et al., 2008). Further, AEG-1 upregulation could activate NF-κB, Wnt/β-catenin, and MAPK/ERK signaling cascades, which induced many malignant phenotypes, including chemoresistance, angiogenesis, metastasis, and invasion (Yoo et al., 2011). Hence, exploring the molecular mechanisms of AEG-1 overexpression is helpful to prevent tumor development.

AEG-1 expression is regulated by many factors. AEG-1 was originally identified as the inducible gene by human immunodeficiency virus and tumor necrosis factor α in primary human fetal astrocytes (Su et al., 2002, 2003). Recently, some miRNAs were demonstrated to reduce AEG-1 expression. For instance, miR-375 could target AEG-1 to stimulate G1 arrest and apoptosis, and inhibit cell migration and invasion in head and neck cancer (Hui et al., 2011), and HCC (Fan et al., 2012); miR-136 triggered apoptosis partially by targeting AEG-1 in human glioma (Yang et al., 2012); and miR-26a was found to negatively regulate AEG-1 to enhance apoptosis in breast cancer (Zhang et al., 2011). Previous study reported that AEG-1 expression displayed increasing trend from normal liver tissue to hepatitis B and HBV-related HCC samples (Gong et al., 2012), which suggests that HBV may be involved in augmenting AEG-1 expression. Considering that HBx can increase the levels of some oncoproteins, such as AIB1 (Liu et al., 2012) and c-Myc (Kalra and Kumar, 2006), we wonder whether HBx contributes to AEG-1 upregulation and collaborates with AEG-1 to promote HCC development.

In this study, we found that HBx could elevate AEG-1 protein level without affecting its transcription, which in turn was involved in HBx-induced cell migration. The miR-375 and miR-136 downregulated by HBx accounted for HBx-mediated AEG-1 elevation and cell migration.

Materials and Methods

Cell culture

The HepG2-pcDNA3-HBx cells had stable HBx expression in human HCC cell line HepG2, and the HepG2-pcDNA3 was its vector control cells. These cells were kindly provided by Dr. Zhongtian Qi (Changhai Hospital, the Second Military Medical University of China) and were constructed as described previously (Li et al., 2009). The control HepG2-pcDNA3 and HepG2-pcDNA3-HBx stable cells were named HepG2-Ctr and HepG2-HBx in this study. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS) and 200 μg/mL G418 (Gibco) at 37°C in 5% CO₂-humidified atmosphere. Another HCC cell line SMMC-7721 was also grown in DMEM with 10% FBS at 37°C in 5% CO₂ atmosphere.

Antibodies

Specific antibodies used for western blot were as follows: anti-HBx (Santa Cruz), anti-AEG-1 (Abcam), anti-Myc and anti-β-Actin (Sigma), and anti-MMP-9 (Cell Signaling Technology).

Plamids, miRNA mimics, and siRNA oligos transfections

Transfection was conducted with Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions. Cells at 80% confluence were transfected with plasmids pCMV-Myc-HBx. When transfecting siRNA oligos and miRNA mimics (RiboBio), cell densities were about 60%. Then, 40 nM of siRNA oligos or 60 nM of miRNA mimics was, respectively, introduced into cells as indicated, and cells were harvested 48 h after transfection. The siRNA oligos sequences targeting AEG-1 were siRNA1-AEG-1: 5′ GGAGGAGGCUGGAAUGAAAdTdT 3′ and siRNA2-AEG-1: 5′ GGUCU CAGAUGAUGAUAAAdTdT 3′. The siRNA oligos sequences targeting HBx were siRNA1-HBx: 5′ CCUGGAUCGAAGAAUACAUTT 3′ and siRNA2-HBx: 5′ GGGAGGAGAUUAGGUUAAATT 3′. Negative control siRNA: 5′-AACUCCUGCCUCCUUAUGUAUUUdTdT-3′.

Western blot

Cell lysates were separated by 12% SDS-PAGE and transferred to nitrocellulose membranes (GE Healthcare). The membrane was blocked with 5% milk in TBS (20 mM Tris-HCl and 137 mM NaCl [pH 7.6]) for 1 h at room temperature, and incubated with specific primary antibodies at 4°C overnight, followed by incubation with horseradish-peroxidase-conjugated secondary antibody at room temperature for 1 h. Then, the protein bands of interest were visualized with enhanced chemiluminescence detection reagents (Santa Cruz Biotechnology).

RNA extraction and qRT-PCR analysis

Total RNA, including miRNA, was extracted and purified with miRNeasy mini kit (Qiagen). The RNA concentration was measured by O.D. 260/280 nm absorbance with NanoDrop spectrophotometer (Thermo). Then, 500 ng of RNA was reverse-transcribed to cDNA with ReverTra Ace kit (Toyobo), and an aliquot of 500 ng RNA was converted to cDNA for miRNA analysis using the miScript RT kit (Qiagen) following the manufacturer's protocols. qRT-PCR for AEG-1 gene level was performed with standard SYBR-Green PCR kit protocol (Takara) and normalized by the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). miRNA expression detection by qRT-PCR used the miScript SYBR Green PCR kit (Qiagen), the universal reverse primer was provided by manufacturer, and the forward primer was specific to the mature miRNA listed in the Sanger miRBase. The miRNA expression was normalized with U6 small RNA as internal control. All reactions were conducted in triplicate. Specific qRT-PCR primers were as follows:

AEG-1-forward: 5′ TGGGCGGACTGTTGAAGTGGC 3′, AEG-1-reverse: 5′ CCCAGGCTCCTTCATCAACTTCCT 3′; MMP-9-forward: 5′ TTGACAGCGACAAGAAGTGG 3′, MMP-9-reverse: 5′ GCCATTCACGTCGTCCTTAT 3′; and GAPDH-forward: 5′ AGGGCTGCTTTTAACTCTGGT 3′, GAPDH reverse: 5′CCCCACTTGATTTTGGAGGGA 3′.

Cell migration assay

The migration assay was performed by using Transwell insert chambers (8-μm pore size; Corning). About 2×10⁵ cells were seeded into the upper chamber in serum-free medium in triplicate. The lower chamber was filled with 600 μL DMEM containing 10% FBS as chemoattractant. After incubation for 24 h, nonmigrating cells in upper chambers were removed by cotton swab, and cells migrating to the lower surface of membrane were fixed using methanol and stained with 0.1% crystal violet. The migrating cells were counted at least six visual fields per membrane under the light microscope.

Statistical analysis

Results were shown as mean and standard deviation (SD) from at least three independent experiments. Student's t-test was used and difference was considered significant when p-value was <0.05.

Results

HBx elevates AEG-1 expression without altering AEG-1 mRNA level

Previous studies found that AEG-1 expression levels increased from normal liver tissue to hepatitis B and HBV-related HCC samples (Gong et al., 2012), which implicated that HBV may be involved in controlling AEG-1 expression. Given HBx encoded by HBV is critical for HCC progression and HBx can enhance the levels of some oncoproteins (Kalra and Kumar, 2006; Liu et al., 2012). We wondered whether HBx could regulate AEG-1. To test this, increasing amounts of pCMV-HBx plasmids were transfected into HCC cell line SMMC-7721, and western blots were performed to detect AEG-1 protein level. As shown in Figure 1A, the level of AEG-1 protein was elevated with HBx expression in a dose-dependent manner. To address whether AEG-1 protein upregulation reflected changes in its mRNA level, we performed qRT-PCR analysis and found that the relative mRNA level of AEG-1 was not affected by HBx (Fig. 1B). To further confirm the effect of HBx on AEG-1 expression, AEG-1 protein levels and relative mRNA changes were also detected in HepG2 cells with stable HBx expression. The results indicated that AEG-1 protein level was significantly higher in HepG2-HBx than in HepG2-Ctr cells (Fig. 1C), but again the AEG-1 mRNA level had no obvious change (Fig. 1D). Then, two siRNA oligos were employed to deplete HBx and western blot indicated that AEG-1 protein level reduced with HBx knockdown (Fig. 1E). Next, we determined whether HBx-induced AEG-1 elevation was achieved by increasing AEG-1 protein stability. Cells were treated with cycloheximide (CHX) to block de novo protein synthesis, and AEG-1 protein level was examined at the indicated interval. As shown in Figure 1F, HBx expression had no significant effect on AEG-1 protein turnover. These findings suggest that HBx can upregulate AEG-1 expression via the post-transcriptional regulation.

FIG. 1.

Hepatitis B viral X (HBx) elevates astrocyte elevated gene-1 (AEG-1) expression without altering AEG-1 mRNA level. (A) SMMC-7721 cells were transfected with 0, 200, and 400 ng pCMV-Myc-HBx plasmids for 48 h. Western blots were employed to detect AEG-1 and HBx protein levels with indicated antibodies. Actin was the loading control. The quantification of AEG-1 normalized to Actin by calculating the immunoblot density with software Quantity One (version 4.4.1). (B) The relative AEG-1 mRNA levels were detected by qRT-PCR in SMMC-7721 cells with above transfected conditions. (C) In HepG2-Ctr and HepG2-HBx cells with stable HBx expression, AEG-1 and HBx protein levels were determined by western blot. (D) The relative AEG-1 mRNA levels were examined by qRT-PCR in HepG2-Ctr and HepG2-HBx cells. The data were shown as the mean±SD (n=3). (E) pCMV-Myc-HBx and 40 nM HBx siRNA oligos were cotransfected into SMMC-7721 cells as indicated. Forty-eight hours after transfection, western blot examined the AEG-1 and HBx protein level. (F) pCMV-Myc empty vector and pCMV-Myc-HBx were transfected into SMMC-7721 cells, respectively. Twenty-four hours after transfection, cells were treated with 50 μg/mL CHX for indicated interval, followed by western blot. Actin was the loading control.

HBx-induced AEG-1 elevation is involved in HBx-mediated cell migration

The two siRNA oligos targeting AEG-1 were introduced into SMMC-7721 cells; qRT-PCR and western blot showed that they could markedly decrease AEG-1 mRNA level to about 70% and reduce AEG-1 protein expression to nearly 50% (Fig. 2A). However, the siRNAs were not successfully introduced into HepG2 cells because of the poor transfection efficiency. In addition, when SMMC-7721 cells were cotransfected with pCMV-HBx plasmid and AEG-1 siRNAs, the HBx-induced AEG-1 protein elevation was attenuated effectively (Fig. 2B). Since both HBx and AEG-1 were reported to enhance cell migration via upregulating MMP-9 (Chung et al., 2004; Liu et al., 2010, 2012; Sun et al., 2012), we detected the changes of MMP-9. Our result indicated that both MMP-9 mRNA and protein levels were increased with HBx expression. However, when pCMV-HBx plasmids were cotransfected with AEG-1 siRNAs, the HBx-mediated MMP-9 mRNA and protein elevation was blocked (Fig. 2C, D). Then, we detected whether AEG-1 participated in HBx-mediated cell motility with transwell assay. As shown in Figure 2E and F, there were more migrated cells in SMMC-7721 cells with HBx expression than in controls. In contrast, when decreasing AEG-1 expression with siRNA in the HBx-transfected cells, the HBx-mediated cell migrations were significantly reduced. These results implicate that the HBx-induced AEG-1 elevation is involved in HBx-mediated MMP-9 elevation and cell migration.

FIG. 2.

HBx-induced AEG-1 elevation is involved in HBx-mediated cell migration. (A) SMMC-7721 cells were transfected with 40 nM negative control siRNA (NC), si-1, or si-2 targeting AEG-1 for 48 h; relative AEG-1 mRNA levels were assayed with qRT-PCR (top panel); and AEG-1 protein levels were detected by western blot (bottom panel). (B) SMMC-7721 cells were cotransfected with pCMV-Myc-HBx plasmids and siRNA-AEG-1 as shown in the figures. Western blot examined the AEG-1 and HBx protein levels. Actin was the loading control. (C) In the transfected condition of (B), the relative MMP-9 mRNA level was determined by qRT-PCR. (D) MMP-9 protein level was detected by western blot. (E) Transwell assay in the transfected condition of (B); histograms showed the average number of migrated cells in per visual field from three independent experiments. Panel (F) represents results of cell migration across the membrane. The data were indicated as the mean±SD (n=3), and *p<0.05.

*Correction added on September 27, 2021 after first online publication ahead of print on July 2, 2014 and in DNA and Cell Biology Volume 33, Issue 10, September 29, 2014: In figure 2, the image HBx+si-1 in panel F was a duplicate of the image “Ctr” also in panel F. Figure 2 panel F has been corrected with the correct image for HBx+si-1. Additionally, the graph in panel E has been corrected to show the calculated migratory cell numbers.

HBx increases AEG-1 expression by downregulating miR-375 and miR-136

Recent studies have manifested that miR-375 (Fan et al., 2012), miR-136 (Yang et al., 2012), and miR-26a (Zhang et al., 2011) could bind directly to the 3′-untranslated region of AEG-1 and suppressed cell growth, migration, or apoptosis via decreasing AEG-1 expression. In addition, HBx has been found to regulate miRNA expression in previous studies (Qiu et al., 2013). To further explore the underlying mechanism of HBx-mediated AEG-1 elevation, we first assessed whether HBx has any influence on the expression of miR-375, miR-136, and miR-26a by qRT-PCR. The results showed that miR-375 and miR-136 expression was significantly downregulated in SMMC-7721 cells that expressed HBx (Fig. 3A) and in HepG2-HBx cells (Fig. 3B), but miR-26a level did not change in SMMC-7721 and HepG2 cells expressing HBx (Fig. 3A, B). We also confirmed that miR-136 and miR-375 mimic introduction could reduce AEG-1 protein levels in SMMC-7721 cells (Fig. 3C). When the miR-136 and miR-375 mimics were cotransfected with pCMV-HBx into SMMC-7721 cells, we found that HBx-mediated AEG-1 protein upregulation was abrogated (Fig. 3D). Meanwhile, AEG-1 mRNA levels were not changed significantly with the high-dosed miR-136 and miR-375 mimic introduction (Fig. 3E), which was consistent with the result that HBx had no effect on AEG-1 transcription as shown in Figure 1B and D. These results indicate that HBx may increase AEG-1 protein level by downregulating miR-375 and miR-136 expression.

FIG. 3.

HBx increases AEG-1 expression by downregulating miR-375 and miR-136. (A) miR-375, miR-136, and miR-26a expression levels were assessed by qRT-PCR in SMMC-7721 cells with transfecting 0 ng or 400 ng pCMV-Myc-HBx plasmids, respectively. (B) The qRT-PCR results of miR-375, miR-136, and miR-26a in HepG2-Ctr and HepG2-HBx cells. (C) About 60 nM of miRNA negative control, miR-136, and miR-375 mimics was transfected into SMMC-7721 cells, respectively. Western blot was used to examine AEG-1 protein level. (D) Western blot detected AEG-1 expression in SMMC-7721 cells cotransfecting pCMV-Myc-HBx plasmids and 60 nM miRNA mimics as indicated. (E) The qRT-PCR results of relative AEG-1 mRNA levels in the transfected condition of (D). The data were shown as the mean±SD (n=3), and *p<0.05.

The introduction of miR-375 and miR-136 mimics attenuates HBx-mediated MMP-9 elevation and cell migration

To determine whether the restoration of miR-375 and miR-136 had any effect on HBx-induced cell migration, miR-375 and miR-136 mimics were re-expressed when SMMC-7721 cells were transfected with pCMV-HBx. The qRT-PCR results indicated that the HBx-induced MMP-9 mRNA level elevation was attenuated upon introducing miR-375 and miR-136 mimics (Fig. 4A). Cell migration assay was performed by transwell detection. The results showed that miR-375 and miR-136 restoration could partially suppress HBx-induced migration compared with control (Fig. 4B, C). These findings suggest that HBx upregulates AEG-1 protein level to promote cell migration by decreasing miR-375 and miR-136 expression.

FIG. 4.

miR-375 and miR-136 mimics attenuate HBx-mediated MMP-9 elevation and cell migration. (A) The relative MMP-9 mRNA level was validated by qRT-PCR in the transfected condition of Figure 3D. (B) Histograms showed the average number of migrated cells in per visual field from three independent experiments. Panel (C) represents results of cell migration across the membrane. The data were expressed as the mean±SD (n=3), and *p<0.05.

Discussion

In this study, we found that HBx overexpression could elevate AEG-1 protein level without affecting AEG-1 mRNA transcription. Similar results were also observed in the regulation of HBx on AIB1 (Liu et al., 2012). Further study revealed that HBx could interact with AIB1 protein and protected AIB1 from ubiquitin-proteasomal degradation. However, we found that HBx had no obvious effect on AEG-1 stability. When treated with CHX to block novel protein synthesis, HBx expression did not prolong AEG-1 half-life (Fig. 1F). Previous studies might provide some clues to this result. AEG-1 was not subjected to degradation through polyubiquitin-proteasome pathway (Thirkettle et al., 2009) and it was the longevous protein with half-life about 20 h (Lee et al., 2006). Therefore, it implies that except for inhibiting oncoproteins from polyubiquitinated degradation, there exists a novel mechanism for HBx to upregulate AEG-1 protein level.

Recently, miRNAs have been extensively investigated, which function to repress gene expression by base-pair complementation with the 3′-untranslated region (3′-UTR) of target mRNAs (Bartel, 2004). When the association between the miRNA and target mRNA is complete, the mRNA would be cleaved and direct degradation. Since most complementary pairs are imperfect, miRNA-mediated silence is frequently accomplished by translational suppression (Bartel, 2009). Aberrant miRNA expression has been implicated in numerous cancers, including HCC (Murakami et al., 2006). Many studies have evaluated the potential effects of HBx on miRNA dysregulations (Wang et al., 2010; Wei et al., 2013). HBx could decrease miR-101; consequently, the miR-101-target DNA methyltransferase 3A (DNMT3A) was upregulated, which induced aberrant DNA methylation and expression inhibition of some tumor suppressors, including GSTP1, CDKN2A, and APC (Wei et al., 2013). Currently, some microRNAs have been identified to target AEG-1 and block its oncogenic roles, such as miR-375 (Fan et al., 2012; Yang et al., 2012), miR-136 (Yang et al., 2012), and miR-26a (Zhang et al., 2011). Our results found that HBx could inhibit miR-375 and miR-136 expression to elevate AEG-1 protein level (Fig. 3). The restoration of miR-375 and miR-136 mimics not only attenuated HBx-induced AEG-1 elevation (Fig. 3D) but also repressed HBx-mediated cell migration (Fig. 4). MiR-375 has potential tumor-suppressive function, and miR-375 downregulation is established in HCC (Furuta et al., 2010; Fan et al., 2012) and the head and neck squamous cell carcinoma (HNSCC) (Hui et al., 2011). The hypermethylation within the promoter or coding regions of miR-375 may account for its suppression (Furuta et al., 2010; Hui et al., 2011). Then, whether the miR-101 downregulated by HBx is involved in HBx-mediated miR-375 or miR-136 reduction through DNMT3A pathway needs further investigation.

MMP-9 can facilitate the degradation of environmental barriers, such as extracellular matrix and basement membranes, which has important roles in the migration and invasion of tumors (Woessner, 1991). Our findings indicated that both MMP-9 mRNA and protein levels, and cell migration were increased with HBx overexpression. In contrast, when AEG-1 was knocked down by siRNAs, or miR-375 and miR-136 mimics were introduced in HBx-expressing HCC cells, both the HBx-induced MMP-9 upregulation and cell migratory were repressed significantly (Figs. 2 and 4). MMP-9 promoter region has the AP-1 and NF-κB binding sites (Sato and Seiki, 1993). HBx was reported to stimulate MMP-9 expression mainly through activating ERK and PI3K-Akt/PKB signaling cascades to promote AP-1 and NF-κB transcriptional activity (Chung et al., 2004). Moreover, AEG-1 overexpression was also found to positively correlate with MMP-9 elevation in gliomas and in nonsmall cell lung cancer with aggressive clinicopathologic outcomes (Liu et al., 2010; Sun et al., 2012). The interaction between AEG-1 and p50/p65 complex of NF-κB could stimulate the nuclear translocation of NF-κB to enhance MMP-9 expression (Sarkar et al., 2008). Study in gliomas also illustrated that AEG-1 was able to physically bind MMP-9 promoter region (from −690 nt to −483 nt, from −164 nt to −3 nt) cooperating with NF-κB p65 and/or AP-1 (Liu et al., 2010). In addition, there are many crosstalk and overlaps in regulating some oncogenic signaling networks between HBx and AEG-1, and the precise mechanisms by which HBx and AEG-1 control MMP-9 expression and cell migration remain to be determined.

Conclusions

In summary, our results demonstrated that HBx could elevate AEG-1 protein level by inhibiting miR-375 and miR-136 expression, and the HBx-induced AEG-1 upregulation enhanced HBx-mediated cell migration. These findings provide a novel mechanism for AEG-1 upregulation in HCC and shed new light on HBx promoting HCC development and progression. Additionally, our results also implicate the therapeutic potential of miR-375 and miR-136 in HBV-infected HCC.

Footnotes

Acknowledgments

The present study was supported by the Natural Science Foundation of China (81201521, 81373064, and 30972635), China Postdoctoral Science Foundation Funded Project (2013 M541467), the Natural Science Foundation of Shanghai Municipal Science and Technology Commission (12ZR1441500 and 12ZR1404300), and the Key Technologies Research and Development Program for Infectious Diseases of China (2013ZX10003001-002).

Disclosure Statement

No competing financial interests exist.

References

Bartel

D.P.

(2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 116, 281–297.

Bartel

D.P.

(2009). MicroRNAs: target recognition and regulatory functions. Cell, 136, 215–233.

Chung

T.W.

, Lee

Y.C.

, and Kim

C.H.

(2004). Hepatitis B viral HBx induces matrix metalloproteinase-9 gene expression through activation of ERK and PI-3K/AKT pathways: involvement of invasive potential. FASEB J, 18, 1123–1125.

Fan

, Dachrut

, Coral

, Yuen

S.T.

, et al. (2012). Integration of DNA copy number alterations and transcriptional expression analysis in human gastric cancer. PLoS One 7, e29824.

Furuta

, Kozaki

K.I.

, Tanaka

, Arii

, et al. (2010). miR-124 and miR-203 are epigenetically silenced tumor-suppressive microRNAs in hepatocellular carcinoma. Carcinogenesis, 31, 766–776.

Gong

, Liu

, You

, Wang

, et al. (2012). Prognostic significance of metadherin overexpression in hepatitis B virus-related hepatocellular carcinoma. Oncol Rep, 27, 2073–2079.

, Chong

R.A.

, Yang

, Wei

, et al. (2009). MTDH activation by 8q22 genomic gain promotes chemoresistance and metastasis of poor-prognosis breast cancer. Cancer Cell, 15, 9–20.

Hui

A.B.

, Bruce

J.P.

, Alajez

N.M.

, Shi

, et al. (2011). Significance of dysregulated metadherin and microRNA-375 in head and neck cancer. Clin Cancer Res, 17, 7539–7550.

Kalra

, and Kumar

(2006). The X protein of hepatitis B virus binds to the F box protein Skp2 and inhibits the ubiquitination and proteasomal degradation of c-Myc. FEBS Lett, 580, 431–436.

10.

Kew

M.C.

(2010). Epidemiology of chronic hepatitis B virus infection, hepatocellular carcinoma, and hepatitis B virus-induced hepatocellular carcinoma. Pathol Biol (Paris), 58, 273–277.

11.

Kim

C.M.

, Koike

, Saito

, Miyamura

, et al. (1991). HBx gene of hepatitis B virus induces liver cancer in transgenic mice. Nature, 351, 317–320.

12.

Lee

S.G.

, Su

Z.Z.

, Emdad

, Sarkar

, et al. (2006). Astrocyte elevated gene-1 (AEG-1) is a target gene of oncogenic Ha-ras requiring phosphatidylinositol 3-kinase and c-Myc. Proc Natl Acad Sci U S A, 103, 17390–17395.

13.

Lee

S.G.

, Su

Z.Z.

, Emdad

, Sarkar

, et al. (2008). Astrocyte elevated gene-1 activates cell survival pathways through PI3K-Akt signaling. Oncogene, 27, 1114–1121.

14.

W.H.

, Miao

X.H.

, Qi

Z.T.

, Ni

, et al. (2009). Proteomic analysis of differently expressed proteins in human hepatocellular carcinoma cell lines HepG2 with transfecting hepatitis B virus X gene. Chin Med J (Engl), 122, 15–23.

15.

Liu

, Wu

, Ying

, Chen

, et al. (2010). Astrocyte elevated gene-1 upregulates matrix metalloproteinase-9 and induces human glioma invasion. Cancer Res, 70, 3750–3759.

16.

Liu

, Tong

, Li

, Chen

, et al. (2012). Hepatitis B virus X protein stabilizes amplified in breast cancer 1 protein and cooperates with it to promote human hepatocellular carcinoma cell invasiveness. Hepatology, 56, 1015–1024.

17.

Murakami

, Yasuda

, Saigo

, Urashima

, et al. (2006). Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene, 25, 2537–2545.

18.

Qiu

, Dong

, Qiao

, Lu

, et al. (2013). HBx-mediated miR-21 upregulation represses tumor-suppressor function of PDCD4 in hepatocellular carcinoma. Oncogene, 32, 3296–3305.

19.

Sarkar

, Park

E.S.

, Emdad

, Lee

S.G.

, et al. (2008). Molecular basis of nuclear factor-kappaB activation by astrocyte elevated gene-1. Cancer Res, 68, 1478–1484.

20.

Sato

, and Seiki

(1993). Regulatory mechanism of 92 kDa type IV collagenase gene expression which is associated with invasiveness of tumor cells. Oncogene, 8, 395–405.

21.

Srivastava

, Siddiq

, Emdad

, Santhekadur

P.K.

, et al. (2012). Astrocyte elevated gene-1 promotes hepatocarcinogenesis: Novel insights from a mouse model. Hepatology, 56, 1782–1791.

22.

Z.Z.

, Chen

, Kang

D.C.

, Chao

, et al. (2003). Customized rapid subtraction hybridization (RaSH) gene microarrays identify overlapping expression changes in human fetal astrocytes resulting from human immunodeficiency virus-1 infection or tumor necrosis factor-alpha treatment. Gene, 306, 67–78.

23.

Z.Z.

, Kang

D.C.

, Chen

, Pekarskaya

, et al. (2002). Identification and cloning of human astrocyte genes displaying elevated expression after infection with HIV-1 or exposure to HIV-1 envelope glycoprotein by rapid subtraction hybridization, RaSH. Oncogene, 21, 3592–3602.

24.

Sun

, Ke

, Wang

, Li

, et al. (2012). Overexpression of astrocyte-elevated gene-1 is closely correlated with poor prognosis in human non-small cell lung cancer and mediates its metastasis through up-regulation of matrix metalloproteinase-9 expression. Hum Pathol, 43, 1051–1060.

25.

Thirkettle

H.J.

, Girling

, Warren

A.Y.

, Mills

I.G.

, et al. (2009). LYRIC/AEG-1 is targeted to different subcellular compartments by ubiquitinylation and intrinsic nuclear localization signals. Clin Cancer Res, 15, 3003–3013.

26.

Wang

, Lu

, Toh

S.T.

, Sung

W.K.

, et al. (2010). Lethal-7 is down-regulated by the hepatitis B virus x protein and targets signal transducer and activator of transcription 3. J Hepatol, 53, 57–66.

27.

Wei

, Xiang

, Ren

, Tan

, et al. (2013). miR-101 is down-regulated by the hepatitis B virus x protein and induces aberrant DNA methylation by targeting DNA methyltransferase 3A. Cell Signal, 25, 439–446.

28.

Woessner

J.F.

Jr. (1991). Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J, 5, 2145–2154.

29.

Yang

, Wu

, Guan

, Cai

, et al. (2012). MiR-136 promotes apoptosis of glioma cells by targeting AEG-1 and Bcl-2. FEBS Lett, 586, 3608–3612.

30.

Yoo

B.K.

, Emdad

, Lee

S.-G.

, Su

.-z., et al. (2011). Astrocyte elevated gene-1 (AEG-1): A multifunctional regulator of normal and abnormal physiology. Pharmacol Ther, 130, 1–8.

31.

Yoo

B.K.

, Emdad

, Su

Z.Z.

, Villanueva

, et al. (2009). Astrocyte elevated gene-1 regulates hepatocellular carcinoma development and progression. J Clin Invest, 119, 465–477.

32.

Zhang

, Liu

X.X.

, He

J.R.

, Zhou

C.X.

, et al. (2011). Pathologically decreased miR-26a antagonizes apoptosis and facilitates carcinogenesis by targeting MTDH and EZH2 in breast cancer. Carcinogenesis, 32, 2–9.

33.

Zhang

, Zhang

, and Ye

(2006). Effects of hepatitis B virus X protein on the development of liver cancer. J Lab Clin Med, 147, 58–66.