Integration of Shh and Wnt Signaling Pathways Regulating Hematopoiesis

Abstract

To investigate the spatial and temporal programmed expression of Shh and Wnt members during key stages of definitive hematopoiesis and the possible mechanism of Shh and Wnt signaling pathways regulating the proliferation of hematopoietic progenitor cells (HPCs). Spatial and temporal programmed gene expression of Shh and Wnt signaling during hematopoiesis corresponded with c-kit⁺lin⁻ HPCs proliferation. C-kit⁺Lin⁻ populations derived from aorta-gonad-mesonephros (AGM) of Balb/c mice at E10.5 with increased expression of Shh and Wnt3a demonstrated a greater potential for proliferation. Additionally, supplementation with soluble Shh N-terminal peptide promoted the proliferation of c-kit⁺Lin⁻ populations by activating the Wnt signaling pathway, an effect which was inhibited by blocking Shh signaling. A specific inhibitor of wnt signaling was capable of inhibiting Shh-induced proliferation in a similar manner to shh inhibitor. Our results provide valuable information on Shh and Wnt signaling involved in hematopoiesis and highlight the importance of interaction of Shh and Wnt signaling in regulating HPCs proliferation.

Introduction

Hematopoietic progenitor cells (HPCs) are the source of all blood cells in the adult body. HPCs have been investigated as promising candidates for use in therapeutic strategies, such as cancer treatment or tissue repair, but their poor expansion in vitro limits their application. An understanding of the developmental process leading to the generation and expansion of HPCs in the embryo can provide an insight into their clinical implications.

In early development of the mouse, the first adult-type hematopoietic stem cells are autonomously generated in the aorta-gonad-mesonephros (AGM) region in low numbers at E10.5–E11.5, then migrate to the fetal liver (FL) at E12–E18 (Keller et al., 1999; Ema and Nakauchi, 2000; Kumaravelu et al., 2002; Dzierzak and Speck, 2008). By the time of birth, they migrate to the bone marrow (BM) and begin to colonize this site. Throughout development of the hematopoietic system, HPCs from various regions exhibit different properties. Previous studies have reported differences between fetal and adult HPCs in phenotype, cell cycle status, and gene expression (Ivanova et al., 2002; Rollini et al., 2007). HPCs found in the FL have a greater proliferative potential than in the adult BM and undergo significant expansion in vivo (Rebel et al., 1996; Martin and Bhatia, 2005).

The spatially and temporally restricted definitive hematopoietic programs and the signaling molecules involved in hematopoietic development are of great interest. Recently, several developmentally conserved signaling pathways have emerged as important controls for hematopoiesis in humans and mice, including the Sonic hedgehog (Shh) and Wnt pathways (Duncan et al., 2005; McIntyre et al., 2013). Shh has been shown to control cellular proliferation and differentiation in a variety of tissues (Baron, 2001; Trowbridge et al., 2006). Using ptc^+/− mice, which have increased Hh activity, it was demonstrated that activation of the Hh signaling pathway induces expansion of primitive blood cells under homeostatic conditions (Wicking et al., 1999). Similar to the shh family, WNT proteins are expressed in diverse tissues and have been shown to accomplish an important regulatory function in HPCs during fetal and adult development (Reya and Clevers, 2005; Staal and Clevers, 2005; Clements et al., 2011). Wnt signaling provides proliferative signals for immature hematopoietic progenitors and regulates the differentiation of hematopoietic lineages (Reya et al., 2003; Staal and Luis, 2010). Exposure of mouse and human hematopoietic progenitors to conditioned media containing WNT proteins results in an increase in immature colony formation in vitro (Nikolova et al., 2007). Although prior studies have suggested that Shh and Wnt signaling pathways are important regulators of hematopoiesis, the mechanism by which these signals influence hematopoiesis spatially and temporally remains less clear.

The aims of this study were to address the question of whether these signals are integrated to regulate the proliferation of HPCs, and then to further investigate the mechanisms involved. Our findings should help to optimize the in vitro expansion conditions of HPC populations.

Materials and Methods

Mice

Six- to eight-week Balb/c mice were all purchased from Prophylaxis and Control Center (Hubei, China). Mice were bred according to institutional guidelines and procedures carried out in compliance with the Standards for Humane Care and Use of Laboratory Animals. The appearance of the vaginal plug was designated as day 0.5 postgestation (E0.5). Mating was used to produce embryos and pups for the isolation of the AGM region (E10.5, E11.5), FL (E12.5, E14.5, E16.5, and E18), and BM.

AGM-, FL-, and BM-derived HPCs isolation and culture

The AGM region (E10.5, E11.5), FL (E12.5, E14.5, E16.5, and E18), and BM (D14) were dissociated into single-cell suspensions by trypsin digestion. Cell counts and viability were estimated with trypan blue staining. Bone marrow nucleated cells (BMNCs) were incubated with a cocktail of biotinylated monoclonal antibodies against lineage markers (BD Cell Separation Magnet) for 15 min at 4°C. After depletion of lineage-positive cells, magnetic lineage-negative cells were subsequently sorted with c-kit⁺ microbeads (Miltenyi Biotec, Inc.) according to the manufacturer's protocol. Populations of c-kit⁺Lin⁻ cells were greater than 90% pure as determined by immunostaining with c-kit-FITC antibody and Lin PE-conjugated mAbs (containing anti-CD3, CD14, CD19, CD20, CD56) (BD Bioscience), and subsequent fluorescence-activated cell sorting (FACS) analysis. Freshly isolated c-kit⁺Lin⁻ HPCs were then cultured in Iscove's modified Dulbecco's medium (Hyclone) supplemented with 12.5% fetal calf serum (FCS), 10 μM β-mercaptoethanol (Sigma), 100 ng/mL stem cell factor (SCF), 100 ng/mL Flt3 ligand, 10 ng/mL interleukin-3 (IL-3) (PeproTech, Inc.) in the presence or absence of 500 ng/mL Shh-N (R&D Systems), 500 ng/mL cyclopamine (R&D Systems), or 500 ng/mL Dkk-1 (R&D Systems). Cultures were maintained at 37°C, 5% CO₂, in a humid atmosphere for 7 days. After this period, cultured floating cells were collected and used in experiments.

Flow cytometry

For FACS analysis, cells were detached with 0.05% trypsin-EDTA and washed with phosphate-buffered saline (PBS) containing 3% (v/v)FCS. Approximately 1 × 10⁵–5 × 10⁵ cells were incubated with FITC anti-mouse c-kit, anti-mouse CD34, anti-mouse Ter-119, or anti-mouse Gr-1 (all from eBioscience) for 30 min in the dark at room temperature. Cells were fixed at 4°C with 4% paraformaldehyde. Samples were analyzed using a FACSCalibur^™ (BD Biosciences) cell sorter and CellQuest^™ software (BD Biosciences).

In vitro clonal assays

Methylcellulose culture was carried out in 35-mm culture dishes (Corning, Inc.). Cells were mixed vigorously with 1 mL of complete methylcellulose medium (MethoCult M3134; StemCell Technologies) containing 30% FCS, 50 μM β-mercaptoethanol, 2 mM l-glutamine, 100 ng/mL SCF, 100 ng/mL Flt-3L, 10 ng/mL IL-3, 50 ng/mL GM-CSF (PeproTech, Inc.), and 2 U/mL erythropoietin (EPO). Dishes were incubated at 37°C in a humidified atmosphere with 5% CO₂ in air. After 7–14 days, the number of colonies, including colony-forming unit–granulocytes, macrophages (CFU-GM), burst-forming unit–erythroid (BFU-E), and multilineage colonies (CFU-Mix, colony-forming unit–granulocyte, erythrocyte, macrophage, megakaryocyte), was counted.

Analysis of gene expression

Total RNA was extracted using TRIzol^® reagent (Invitrogen). The RNA concentration within samples was determined by spectrophotometry. Synthesis of cDNA was performed by mixing 8 μL RNA, 2 μL oligodT, and 10 μL H₂O. This reaction mixture was incubated at 70°C for 5 min and then cooled in an ice bath for 30 s. The following reagents were then added: 10 μL 5× buffer, 2 μL dNTP, 1 μL RNasin, 2 μL M-MLVRT, and 15 μL H₂O; the reaction was incubated at 42°C for 1 h followed by a 5-min incubation at 95°C (all reagents were from Toyobo Co). The synthesized cDNA products were stored at 4°C. Quantitative polymerase chain reaction (PCR) was subsequently performed using SYBR Green^® Real-time PCR Master Mix (Toyobo Co) with the following cycling parameters: 95°C for 1 min, 40 cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 45 s. The PCR was performed using β-actin (Actb) as a housekeeping gene to ensure the quality and efficiency of the reaction. Each PCR was performed in triplicate, and the comparative quantification, based on the cycle threshold (Ct) of the gene of interest, normalized to Actb in each population. The relative expression level of a gene can be calculated with the following formula: Relative expression = 2^−ΔΔCt. The PCR was performed on a StepOne^™ Real-Time PCR System (Applied Biosystems). Primer sequences used in these studies are as follows:

Actb-for: AGGGAAATCGTGCGTGAC

Actb-rev: CAAGAAGGAAGGCTGGAAA

shh-for: CTCCGTGGCGGCCAAAT

shh-rev: GTCCAGGAAGGTGAGGAAGTCG

wnt3a-for: CCTCGGAGATGGTGGTAGA

wnt3a-rev: GTTAGGTTCGCAGAAGTTGG

wnt5a-for: TGCCTCGGGACTGGTTG

wnt5a-rev: CCCTTAGCGTGGATTCGTT

smo-for: GACCACTCCCATAAGGGCTA

smo-rev: GAAGAGGTTGGCCTAGTGGA

ptc1-for: TTCTGCTGCCTGTCCTCTTA

ptc1-rev: GCAAACCGGACGACACTT

fzd3-for: CAGGCACAGTAGTTCTCATCG

fzd3-rev: TGGTTCCATCCTCCTCAATAA

fzd7-for: TATCGCCTACAACCAGACCATC

fzd7-rev: GGGTGCGTACATAGAGCATAAGA

c-myc-for: CAACGTCTTGGAACGTCAGA

c-myc-rev: TCGTCTGCTTGAATGGACAG

ccnd1-for: GCCCATGACCAGTGTGACT

ccnd1-rev: TTGCCCAATGAAAGACCAAT

Immunohistochemical staining

Mouse embryos at E10.5, E11.5, E12.5, and E14.5 and bone specimens at D14 were fixed in 2% (w/v) paraformaldehyde-PBS overnight at 4°C, and then infiltrated with 30% sucrose in PBS at 4°C overnight. Frozen sections (5 μm) were fixed in acetone and stored at −80°C until required. C-kit⁺Lin⁻ HPCs were resuspended in PBS, smeared on glass slides, and air-dried. Cells were then fixed in 4% paraformaldehyde for 30 min at room temperature. For immunostaining, sections were blocked in 0.1% Triton X-100 and 10% fetal bovine serum-PBS for 1 h at room temperature. Sections were incubated with primary antibodies against SHH and WNT3A (all from Santa Cruz Biotechnology, Inc.) in a humidified chamber overnight at 4°C. Sections were washed three times and incubated with a FITC- or PE-conjugated secondary antibody for 1 h at room temperature. To visualize nuclear morphology, cells were counterstained with the fluorescent DNA-binding dye DAPI for 5 min. Samples were mounted using fluorescent mounting media and viewed with appropriate filters.

Statistical analysis

All experiments were conducted at least in triplicate. The results are presented as the mean ± standard deviation (SD). The statistical software package SPSS 13.0 was used to analyze data from various experiments. p < 0.05 was considered statistically significant.

Results

Identification of HPCs from AGM, FL, and BM

C-kit⁺Lin⁻ populations were isolated from the AGM at E10.5, FL at E14.5, and the BM at D14. The phenotypes detected by flow cytometry showed that the c-kit⁺Lin⁻ cells from different tissues highly expressed hematopoietic progenitor marker (CD34), with a very low expression level of lineage marker for granulocytes (Gr-1) and red blood cells (Ter-119) (Fig. 1A). All of the cells were able to form differentiated colonies, including CFU-GM, CFU-Mix, and BFU-E (Fig. 1B, C). E10.5 AGM-, E14.5 FL-, and D14 BM-derived c-kit⁺Lin⁻ cells demonstrated the same differentiation potential and shared common hematopoietic progenitor molecules, therefore c-kit⁺Lin⁻ cells from AGM, FL, and BM represent a population of HPCs.

FIG. 1.

Identification of hematopoietic progenitor cells (HPCs) from aorta-gonad-mesonephros (AGM), fetal liver (FL), and bone marrow (BM). (A) The phenotypes (CD34, Ter-119, Gr-1) were detected by flow cytometry. Positive gate setting was based on isotype control. (B) The number of colonies, including colony-forming unit–granulocytes, macrophages (CFU-GM), burst-forming unit–erythroid (BFU-E), and multilineage colonies (CFU-Mix, colony-forming unit–granulocyte, erythrocyte, macrophage, megakaryocyte), was counted. Each experiment was repeated four times. Data are expressed as mean ± standard deviation (SD). (C) Colonies of CFU-GM, CFU-Mix, and BFU-E. Representative for four independent experiments.

Spatial and temporal gene expression of Shh and Wnt pathway members during hematopoietic development

The temporal and spatial gene expression of shh pathway members (shh, patched, smo) and wnt pathway members (wnt3a, Fzd3, Fzd7) in HPCs was analyzed by quantitative PCR throughout hematopoietic development at the main sites of hematopoiesis: the AGM region, FL, and BM. Figure 2A shows a very high expression of all the shh and wnt pathway members in HPCs from the AGM (E10.5) of the mouse embryo corresponding to the first phase of definitive hematopoiesis. This would suggest that both Shh and Wnt signaling was involved in early hematopoietic regulation. Analysis of the FL-derived HPCs at E11.5, E12.5, E14.5, E16.5, and E18 showed a second wave of shh, smo, and wnt3a upregulation at E14.5, with a rapid decrease in expression levels over subsequent days until E18. Compared with BM, the expressions of ptc1, fzd 3, and fzd7 at E10.5–12.5 were much higher (p < 0.05) suggesting that shh and wnt pathways may play an important role in establishing definitive hematopoietic development and contribute to the initial phases of FL hematopoiesis. By immunostaining, we demonstrated that all the c-kit⁺lin⁻ HPCs from E10.5 AGM and E14.5 FL expressed both Shh and Wnt3a. Compared to AGM- and FL-derived c-kit⁺lin⁻ HPCs, c-kit⁺lin⁻ HPCs from BM expressed a lower level of Shh and Wnt3a protein (Fig. 2B).

FIG. 2.

The expressions of Shh and Wnt pathway members were assessed by quantitative polymerase chain reaction (PCR). (A) shh, wnt3a, smo, ptc1, fzd3, and fzd7 mRNA expression was assessed in AGM- (E10.5, E11.5), FL- (E11.5, E12.5, E14.5, E16.5, E18), and BM-derived c-kit⁺Lin⁻ populations by quantitative PCR. Each experiment was repeated at least three times. Expression in BM-derived c-kit⁺Lin⁻ populations was set to 1. (B) Coexpression of Shh and Wnt3a in AGM-, FL-, and BM-derived c-kit⁺Lin⁻ HPCs was analyzed by immunostaining. SHH staining is red, WNT3A staining is green, and DAPI staining is blue. Populations of c-kit⁺Lin⁻ cells were greater than 90% pure as determined by fluorescence-activated cell sorting (FACS). Each experiment was repeated at least three times. Scale bar: 100 μm. *Significance was determined using one-way analysis of variance with Dunnett's posttest (p < 0.05).

Different proliferation ability of HPCs from AGM, FL, and BM

E10.5 AGM-, (E11.5, E12.5, E14.5) FL-, and D14 BM-derived HPCs were isolated and cultured in vitro. After 7 days of culture, numerous cells floating above the stromal layer were generated and collected for cell counting. As shown in Figure 3, AGM-derived c-kit⁺Lin⁻ HPCs produced the highest number of c-kit⁺Lin⁻ cells, while BM-derived c-kit⁺Lin⁻ HPCs produced the lowest number of c-kit⁺Lin⁻ cells (less than 10-fold increase). During E11.5–E14.5, the proliferation potential of HPCs derived from the FL significantly increased.

FIG. 3.

Expansion of c-kit⁺Lin⁻ HPCs derived from AGM, FL, and BM. C-kit⁺Lin⁻ HPCs were isolated from AGM at E10.5, FL at E11.5, E12.5, E14.5, and BM at D14. After 7 days of culture, floating c-kit⁺Lin⁻ hematopoietic cells were counted by FACS. Results are shown as the fold increase in c-kit⁺Lin⁻ cells present compared to the initial number of c-kit⁺Lin⁻ cells seeded for culture. Data are expressed as mean ± SD. Each experiment was repeated four times. *Significance was determined using one-way analysis of variance with Dunnett's posttest (p < 0.05).

Role of Shh and Wnt signaling pathways in the proliferation of HPCs

We demonstrated above that Shh and Wnt have similar expression patterns during hematopoietic development, indicating that there might be some interaction between the Shh and Wnt signaling pathways. To identify the relationship between Shh and Wnt pathways in the proliferation of primitive hematopoietic cells, we compared the effects of adding inhibitors of each signaling—cyclopamine and Dkk-1, respectively, to treated cultures. Shh was found to double the number of c-kit⁺Lin⁻ cells, but this effect was neutralized by cyclopamine, a Shh pathway inhibitor (Fig. 4A). Wnt inhibitor Dkk-1 could also block the effect caused by Shh treatment (Fig. 4A).

FIG. 4.

Shh activates Wnt pathway in c-kit⁺Lin⁻ HPCs derived from BM at D14. (A) Shh and Wnt pathways regulate the proliferation of c-kit⁺Lin⁻ HPCs. Results are shown as a fold increase in c-kit⁺Lin⁻ cells present compared to the initial number of c-kit⁺Lin⁻ cells seeded for culture. (B) Shh and Wnt pathways regulate the clonogenic progenitor capacity of c-kit⁺Lin⁻ populations. Results are shown as the total number of colonies. (C–F) Quantitative PCR analysis of Wnt3a, Wnt5a, c-Myc, and Ccnd1 mRNA levels after shh and/or cyclopamine and/or DKK-1 treatment. Expression in the untreated group was set to 1. Each experiment was repeated five times. *Significance was determined using one-way analysis of variance with Dunnett's posttest (p < 0.05).

Next, to determine the functional effects of Shh on progenitors, production of multilineage hematopoietic progenitor capacity from cultured c-kit⁺Lin⁻ cells was assessed using colony-forming unit (CFU) assays after 7 days of treatment. Exogenous Shh led to an increase in the number of CFU-GM, CFU-Mix, and BFU-E, an effect which was inhibited by cyclopamine (Fig. 4B). Cyclopamine treatment alone inhibited the proliferation of c-kit⁺Lin⁻ cells, but surprisingly, enhanced the total number of CFUs, including CFU-GM, CFU-Mix, and BFU-E, derived from c-kit⁺Lin⁻ HPCs (Fig. 4B). Furthermore, Dkk-1 treatment alone had similar effects with cyclopamine in inhibiting the proliferation of HPCs and retaining CFU capacity (Fig. 4B). Cultures treated with cyclopamine+Dkk-1 did not show an additive or synergistic effect in growth inhibition (Fig. 4B). Based on these results, we suggest that Shh functions upstream of Wnt signaling to regulate progenitor expansion.

Furthermore, we demonstrated that exogenous soluble Shh at a concentration of 500 ng/mL significantly increased the gene expression of Wnt3a and Wnt5a, as well as direct Wnt target genes, such as c-Myc and Ccnd1. Additionally, the induction of Wnt signaling by Shh was inhibited using cyclopamine at a concentration of 500 ng/mL (Fig. 4C–F). Dkk-1 treatment alone had similar effects with cyclopamine in inhibiting wnt target gene expression, such as c-Myc and Ccnd1, but had no effects in wnt3a and wnt5a expression (Fig. 4C–F). All these results suggest that Shh contributes to the different expression of known Wnt targets in modulating hematopoietic progenitor proliferation and differentiation.

Discussion

Hematopoietic development is established early in the mouse embryo and progresses through a well-characterized succession of intraembryonic regions and organs. C-kit⁺Lin⁻ cells derived from E10.5 AGM, E14.5 FL, and D14 BM demonstrated the same differentiation potential and shared common hematopoietic progenitor molecules (CD34^high Ter-119^low/− Gr-1^low/−), also suggesting c-kit⁺Lin⁻ as a pivotal molecule for HPCs. We found that mouse c-kit⁺Lin⁻ HPCs exhibited a biphasic expression pattern with Shh and Wnt3a upregulation occurring at key points that corresponded to distinct periods in development when early definitive hematopoiesis is established and expanding. The first wave of high Shh and Wnt3a expression occurred at the early stages of hematopoietic development, E10.5, in the AGM of the mouse embryo. This was followed by a second wave of Shh and Wnt3a being upregulated in the FL at E14.5. Next, we discovered that the proliferation potential of c-kit⁺Lin⁻ HPCs from various hematopoietic compartments is inherently different. The E10.5 AGM-derived c-kit⁺Lin⁻ HPCs exhibited the highest proliferation potential and BM-derived c-kit⁺Lin⁻ HPCs the lowest. It seems that the spatial and temporal expression patterns of Shh and Wnt signaling coincide with the proliferation potential of hematopoietic progenitors during development, suggesting that both Shh and Wnt signaling are involved in regulation of hematopoiesis.

Shh is capable of acting on primitive blood cells to induce expansion of both progenitors and in vivo repopulating stem cells (Trowbridge et al., 2006). Supplementation with exogenous Shh in vitro significantly induced the proliferation of c-kit⁺Lin⁻ HPCs. Cyclopamine is a potent inhibitor of the Shh pathway. Cyclopamine treatment alone inhibited the proliferation of c-kit⁺Lin⁻ cells, but, surprisingly, enhanced the total number of CFUs, including CFU-GM, CFU-Mix, and BFU-E derived from c-kit⁺Lin⁻ HPCs. Thus, neutralization of Shh inhibits cell proliferation while maintaining progenitors in an undifferentiated state, thereby retaining CFU capacity. The effect of cyclopamine also suggests that hematopoietic progenitors may normally produce endogenous Hh proteins through autocrine or paracrine release. It also suggests that Shh signaling is critical to the proliferative regulation of HPCs.

Considering that Shh and Wnt pathways are very important signalings in regulating the proliferation of stem cells, we speculated that there might be some interactions between them during hematopoiesis. We demonstrated that Wnt antagonist Dkk-1 could block the effect caused by Shh treatment and inhibited the proliferation of HPCs. Cultures treated with cyclopamine+Dkk-1 did not show an additive or synergistic effect in growth inhibition. Stimulation with Shh upregulated the expression of Wnt3a, Wnt5a, as well as c-Myc and Ccnd1 transcripts. This effect was Shh specific and could be blocked by Shh antagonists. C-Myc and Ccnd1 are both described as Wnt target genes and their expression favors cell proliferation. C-Myc activity controls crucial aspects of hematopoietic stem and progenitor functions, including proliferation, differentiation, and survival (He et al., 1998; Murphy et al., 2005). Shh-dependent upregulation of Ccnd1 leads to proliferation of target cells through cell cycle progression (Shtutman et al., 1999; Tetsu and McCormick, 1999). These data suggest that Shh functions upstream of Wnt signaling and contributes to the different expression of known Wnt targets in modulating hematopoietic progenitor proliferation and differentiation.

Overall, this study provides a comprehensive analysis of spatial and temporal programmed expression of Shh and Wnt signaling during definitive hematopoiesis. The expression of Shh and Wnt corresponded with the proliferative activity of the hematopoietic progenitors. Shh contributes to hematopoietic progenitors, proliferation, and differentiation through induction of an autocrine Wnt signaling loop. Future studies will be needed to delineate the more detailed mechanism of cross-talk between the Shh and Wnt pathways, aiding the expansion of HPC populations in vitro.

Footnotes

Acknowledgment

This work was supported by the National Natural Science Foundation (No. 81200347).

Disclosure Statement

No competing financial interests exist.

References

Baron

(2001). Induction of embryonic hematopoietic and endothelial stem/progenitor cells by hedgehog-mediated signals. Differentiation, 35, 175–185.

Clements

W.K.

, Kim

A.D.

, Ong

K.G.

, Moore

J.C.

, Lawson

N.D.

, and Traver

(2011). A somitic Wnt16/Notch pathway specifies haematopoietic stem cells. Nature, 474, 220–224.

Duncan

A.W.

, Rattis

F.M.

, DiMascio

L.N.

, Congdon

K.L.

, Pazianos

, Zhao

, Yoon

, Cook

J.M.

, Willert

, Gaiano

, and Reya

(2005). Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol, 6, 314–322.

Dzierzak

, and Speck

N.A.

(2008). Of lineage and legacy: the development of mammalian hematopoietic stem cells. Nat Immunol, 9, 129–136.

Ema

, and Nakauchi

(2000). Expansion of hematopoietic stem cells in the developing liver of a mouse embryo. Blood, 95, 2284–2288.

T.C.

, Sparks

A.B.

, Rago

, Hermeking

, Zawel

, da Costa

L.T.

, Morin

P.J.

, Vogelstein

, and Kinzler

K.W.

(1998). Identification of c-MYC as a target of the APC pathway. Science, 281, 1509–1512.

Ivanova

N.B.

, Dimos

J.T.

, Schaniel

, Hackney

J.A.

, Moore

K.A.

, and Lemischka

I.R.

(2002). A stem cell molecular signature. Science, 298, 601–604.

Keller

, Lacaud

, and Robertson

(1999). Development of the hematopoietic system in the mouse. Exp Hematol, 27, 777–787.

Kumaravelu

, Hook

, Morrison

A.M.

, Ure

, Zhao

, Zuyev

, Ansell

, and Medvinsky

(2002). Quantitative developmental anatomy of definitive haematopoietic stem cells/long-term repopulating units (HSC/RUs): role of the aorta-gonad-mesonephros (AGM) region and the yolk sac in colonisation of the mouse embryonic liver. Development, 129, 4891–4899.

10.

Martin

M.A.

, and Bhatia

(2005). Analysis of the human fetal liver hematopoietic microenvironment. Stem Cells Dev, 14, 493–504.

11.

McIntyre

B.A.

, Ramos-Mejia

, Rampalli

, Mechael

, Lee

J.H.

, Alev

, Sheng

, and Bhatia

(2013). Gli3-mediated hedgehog inhibition in human pluripotent stem cells initiates and augments developmental programming of adult hematopoiesis. Blood, 121, 1543–1552.

12.

Murphy

M.J.

, Wilson

, and Trumpp

(2005). More than just proliferation: Myc function in stem cells. Trends Cell Biol, 15, 128–137.

13.

Nikolova

, Wu

, Brumbarov

, Alt

, Opitz

, Boheler

K.R.

, Cross

, and Wobus

A.M.

(2007). Wnt-conditioned media differentially affect the proliferation and differentiation of cord-blood-derived CD133 ⁺ cells in vitro. Differentiation, 75, 100–111.

14.

Rebel

V.I.

, Miller

C.L.

, Eaves

C.J.

, and Lansdorp

P.M.

(1996). The repopulation potential of fetal liver hematopoietic stem cells in mice exceeds that of their adult bone marrow counterparts. Blood, 87, 3500–3507.

15.

Reya

, and Clevers

(2005). Wnt signalling in stem cells and cancer. Nature, 434, 843–850.

16.

Reya

, Duncan

A.W.

, Ailles

, Domen

, Scherer

D.C.

, Willert

, Hintz

, Nusse

, and Weissman

I.L.

(2003). A role for Wnt signalling in the self-renewal of haematopoietic stem cells. Nature, 423, 409–414.

17.

Rollini

, Faes-Van't Hull

, Kaiser

, Kapp

, and Leyvraz

(2007). Phenotypic and functional analysis of human fetal liver hematopoietic stem cells in culture. Stem Cells Dev, 16, 281–296.

18.

Shtutman

, Zhurinsky

, Simcha

, Albanese

, D'Amico

, Pestell

, and Ben-Ze'ev

(1999). The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway. Proc Natl Acad Sci U S A, 96, 5522–5527.

19.

Staal

F.J.

, and Clevers

H.C.

(2005). WNT signalling and haematopoiesis: a WNT-WNT situation. Nat Rev Immunol, 5, 21–30.

20.

Staal

F.J.

, and Luis

T.C.

(2010). Wnt signaling in hematopoiesis: crucial factors for self-renewal, proliferation, and cell fate decisions. J Cell Biochem, 109, 844–849.

21.

Tetsu

, and McCormick

(1999). Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature, 398, 422–426.

22.

Trowbridge

J.J.

, Scott

M.P.

, and Bhatia

(2006). Hedgehog modulates cell cycle regulators in stem cells to control hematopoietic regeneration. Proc Natl Acad Sci U S A, 103, 14134–14139.

23.

Wicking

, Smyth

, and Bale

(1999). The hedgehog signalling pathway in tumorigenesis and development. Oncogene, 18, 7844–7851.