Evaluation of Antimetastatic Effect of lncRNA-ATB siRNA Delivered Using Ultrasound-Targeted Microbubble Destruction

Abstract

Hepatocellular carcinoma (HCC) is one of the most common human malignancies around the world. The poor prognosis and high recurrence rate of HCC are largely the result of the high frequencies of intrahepatic and extrahepatic metastases. However, the treatment of metastasis is very limited. Ultrasound-targeted microbubble destruction (UTMD) technology has been recognized as a promising technology for drug and gene delivery in vivo and in vitro. Long noncoding RNA activated by transforming growth factor-β (TGF-β; lncRNA-ATB) was recently identified, which was upregulated in HCC metastases and associated with poor prognosis of HCC patients. In this study, we used microbubbles for UTMD-mediated siRNA transfection to silence lncRNA-ATB expression. We found that UTMD-mediated siRNA transfection significantly inhibited lncRNA-ATB expression and ZEB1 and ZEB2 expression and suppressed cell migration and invasion. We also demonstrated that transfecting siRNA against lncRNA-ATB by using UTMD was more efficient than that by using lipidosome. UTMD-mediated siRNA transfection against lncRNA-ATB may be a promising therapy for HCC metastasis.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common human malignancies around the world, which causes nearly 600,000 deaths each year (Yang and Roberts, 2010; Invernizzi et al., 2016). The poor prognosis and high recurrence rate of HCC are largely the result of the high frequencies of intrahepatic and extrahepatic metastases (Obi et al., 2015; Waghray et al., 2015). Thus, additional therapies for prevention and treatment of metastasis are essential. However, the treatment of metastasis is very limited (Xiang et al., 2015). Effective targeting treatment for HCC, such as RNA interference (RNAi), remains a critical clinical challenge. RNAi is a naturally occurring process that silences gene expression in a post-transcriptional manner. It has been recognized as a potential therapeutic tool for silencing cancer-related genes (Feng et al., 2011; Gil-Ranedo et al., 2011; Li et al., 2013). However, the siRNA target treatment has several critical limitations in drug delivery. siRNAs are subject to rapid degradation, resulting in a short plasma half-life (Iversen et al., 2013). And there is a critical problem of how to deliver intact siRNA into the cytoplasm of the target cells efficiently (Racz and Hamar, 2008).

Ultrasound-targeted microbubble destruction (UTMD) technology has been recognized as a promising technology for drug and gene delivery in vivo and in vitro (Chen et al., 2013a, 2013b; Liao et al., 2014). UTMB open transient pores in cell membranes promote cell membrane permeabilization and generate microstreams that significantly increase the gene transfection efficiency (Xie et al., 2010; Suzuki et al., 2011; Chang et al., 2015). UTMD has been reported to be an efficient tool for siRNA delivery (Florinas et al., 2014; Shi et al., 2014). Therefore, UTMD delivering siRNA will be a promising therapy.

Long noncoding RNA activated by transforming growth factor-β (TGF-β; lncRNA-ATB) was recently identified, which was upregulated in HCC metastases and associated with poor prognosis of HCC patients. lncRNA-ATB upregulated ZEB1 and ZEB2 by competitively binding the miR-200 family and then induced epithelial–mesenchymal transition and invasion (Yuan et al., 2014). It provides a novel target for antimetastatic therapies. In this study, we evaluated the effect of UTMD-mediated delivery of siRNA against lncRNA-ATB (siATB) in HCC cells. Our results demonstrated that UTMD enhances the siATB silence efficiency in HCC cells and markedly suppresses HCC cell migration and invasion. To the best of our knowledge, it is the first report to use UTMD to deliver siRNA against lncRNA to HCC cells.

Materials and Methods

Cell cultures

SMMC-7721 and MHCC-97h cells were obtained from Cell Bank of Chinese Academy of Sciences cultured at 37°C in an atmosphere containing 5% CO₂ and in RPMI-1640 medium (Hyclone) supplemented with 10% fetal bovine serum.

RNA extraction and real-time PCR

Total RNA was isolated using Trizol reagent (Invitrogen) according to its manual. First-strand cDNA was generated by using the One-Step Easy Reverse Transcriptase (Takara). Real-time PCR was performed in the Step-One Plus Real-Time PCR System (Applied Biosystems) using SYBR Green (Thermo). The gene-specific primers were shown as follows: LncRNA-ATB-F: TCTGGCTGAGGCTGGTTGAC, LncRNA-ATB-R: ATCTCTGGGTGCTGGTGAAGG; ZEB1-F: CCCAGGACAGCACAGTAAAT, ZEB1-R: GATGGTGTACTACTTCTGGAACC; ZEB2-F: CGCCACGAGAAGAATGAAGA, ZEB2-R: GATTACCTGCTCCTTGGGTTAG; GAPDH-F: GGTGTGAACCATGAGAAGTATGA, GPDH-R: GAGTCCTTCCACGATACCAAAG. GAPDH was employed as an endogenous control. The relative expression of RNA was calculated using the comparative Ct method.

UTMD exposure

A therapeutic ultrasound machine (PHYSIOSON Basic) was used to generate ultrasound at the frequency of 1 MHz. The microbubbles were added to the adherent cell culture and incubated up-side-down. The ultrasound transducer was placed at the bottom of dishes with coupling medium on the surface of the transducer. Microbubbles (SonoVue) were lipid-shelled ultrasound contrast agents containing sulfur hexafluoride gas (diameter 3–6.0 μm) and used at a concentration of 1 × 10⁸ bubbles/mL. UTMD parameters were as follows: ultrasound intensity, 0.8 W/cm²; exposure time, 70 s; pulse frequency, 100 Hz; duty cycle, 20%; volumetric ratio of microbubbles:medium, 1:6.

siRNA transfection

siRNA against lncRNA-ATB (siATB) was purchased from Riborio Company. Target sequence for lncRNA-ATB is as follows: TCCCTGACTCCTCTATGGCAT. A total of 100 nM siRNAs were transfected to cells by using Hiperfect (Qiagen). The siRNAs were added to the adherent cell culture and incubated up-side-down. All experiments were performed 48 h after transfection.

Transwell assay

The transwell assays (Corning) were performed as previously described (Tong et al., 2012). In brief, 1 × 10⁵ cells were seeded in the upper chamber of transwell and incubated for 24 h. The cells migrating to the lower chamber were stained.

Statistical analysis

All statistical analyses were performed using the SPSS 19.0 software. All data were represented as mean ± standard deviation and analyzed by Student's t-test (two-tailed). p Value less than 0.05 was considered significant.

Results

Decrease of lncRNA-ATB expression by UTMD-mediated siATB transfection

UTMD-mediated lncRNA-ATB knockdown was tested by real-time PCR in SMMC-7721 and MHCC-97h cells. As shown in Figure 1, the expression of lncRNA-ATB was decreased by using siRNA against lncRNA-ATB, and siATB+UTMD group showed more effective knockdown than siATB group. The results indicated that UTMD-mediated delivery of siATB significantly inhibited the expression of lncRNA-ATB in HCC cells and was more effective than using siATB alone.

FIG. 1.

Decrease of lncRNA-ATB expression by UTMD-mediated siATB transfection. Relative expression of lncRNA-ATB was detected by qRT-PCR in SMMC-7721 and MHCC-97h cell treated with siRNA against lncRNA-ATB (siATB) or UTMD-mediated siRNA against lncRNA-ATB (siATB+UTMD) transfection. Data are shown as mean ± SD. *p < 0.05. qRT-PCR, quantified real-time PCR; SD, standard deviation; UTMD, ultrasound-targeted microbubble destruction.

Suppression of ZEB1 and ZEB2 expression induced by UTMD-mediated siATB transfection

We next detected the ZEB1 and ZEB2 expression, which is regulated by lncRNA-ATB (Yuan et al., 2014). Both mRNA and protein levels of ZEB1 and ZEB2 were suppressed by siATB in both SMMC-7721 and MHCC-97h (Fig. 2A–C). Compared with siATB group, siATB+UTMD group has lower levels of ZEB1 and ZEB2. The results indicated that UTMD-mediated delivery of siATB significantly inhibited the expression of ZEB1 and ZEB2, which were the main target genes of lncRNA-ATB in HCC cells.

FIG. 2.

Suppression of ZEB1 and ZEB2 expression induced by UTMD-mediated siATB transfection. (A, B) The relative mRNA expression of ZEB1 (A) and ZEB2 (B) in SMMC-7721 and MHCC-97h cells transfected with siATB or siATB+UTMD. (C) The protein level of ZEB1 and ZEB2 in SMMC-7721 and MHCC-97h cells transfected with siATB or siATB+UTMD. Data are shown as mean ± SD. *p < 0.05.

UTMD-mediated siATB transfection inhibits cell migration and invasion

Finally, we performed transwell assays to assess the cell migration and invasion change induced by siATB alone or UTMD-mediated delivery of the siATB. We found that the cell migration and invasion were significantly reduced after siATB transfection in SMMC-7721 and MHCC-97h cells (Fig. 3A, B). In comparison with siATB group, siATB+UTMD group results in marked suppression of migration and invasion. Those results indicated that UTMD-mediated delivery of siATB significantly inhibited the migration and invasion of HCC cells and had better suppressive effect than using siATB.

FIG. 3.

UTMD-mediated siATB transfection inhibits cell migration and invasion. (A) The number of migrated and invaded SMMC-7721 cells transfected with siATB or siATB+UTMD. (B) The number of migrated and invaded MHCC-97h cells transfected with siATB or siATB+UTMD. Data are shown as mean ± SD. *p < 0.05.

Discussion

RNAi technique is a promising approach for cancer therapy because of its low off-target effect (Wang et al., 2014). To generate therapeutic effects by siRNA, siRNA needs to be delivered through the cell membrane, leading to knockdown of specific gene and protein expression. Clinical applications of siRNA largely depend on delivery technology. However, efficient delivery of siRNA into tumor cells remains a critical obstacle. Even though the viral vectors have high gene silence efficiency through integrating to genome, potential risk interference response is the major problem (Schambach et al., 2013). Nonviral delivery systems suffer from low silence efficiency (Jafari et al., 2012). Therefore, a targeted and high-efficiency siRNA delivery system is helpful for development of cancer therapy.

UTMD has recently been used for siRNA or shRNA delivery both in vitro and in vivo (Wang et al., 2014; Park et al., 2015; Zhang et al., 2015). UTMD is able to stimulate sonoporation and change in the permeability of the cell membrane, which makes the delivery of siRNA or DNA into cells more efficient (Yin et al., 2013). In contrast, combination of UTMD with siRNA leads to enriching in the tumor sites and avoids its distribution to irrelevant normal tissues, which likely reduces the dose required for antitumor activity. In this study, we used microbubbles for UTMD-mediated lncRNA-ATB silence to suppress HCC cells migration and invasion. UTMD promotes the efficient delivery of siRNA. We demonstrated that transfecting siRNA against lncRNA-ATB by using UTMD was significantly more efficient than by using Hyperfect transfection reagent, which is a kind of lipidosome. lncRNA-ATB acts as a key regulator of TGF-β signaling pathways. As direct targets of lncRNA-ATB, miR-200-ZEB and IL-11 mediated the role of lncRNA-ATB in local invasion and distant colonization (Yuan et al., 2014), suggesting that lncRNA-ATB could be a promising target for antimetastasis therapies. For this reason, we chose lncRNA-ATB as the target of UTMD-mediated oncogene silence. To the best of our knowledge, to date, it is the first report that targeting lncRNA mediated by UTMD significantly suppresses HCC cell migration and invasion. It is possible that the combination of UTMD with siRNA targeting other key HCC-related lncRNA may be developed as a potential therapeutic approach.

In conclusion, our study showed the efficacy and therapeutic potential of combination of UTMD with lncRNA-ATB siRNA for the suppression of HCC migration and invasion in vitro. Our work supports the potential role for lncRNA-ATB as a biomarker for inhibiting metastasis in HCC. Further in vivo studies will be performed to elucidate the outcome of the UTMD-mediated lncRNA-ATB silence.

Footnotes

Acknowledgment

This study was supported by the grant of Science and Technology Agency of Liaoning Province (No. 2014022013).

Disclosure Statement

No competing financial interests exist.

References

Chang

, Liu

, Liao

, and Liu

(2015). Ultrasound-mediated microbubble destruction enhances the therapeutic effect of intracoronary transplantation of bone marrow stem cells on myocardial infarction. Int J Clin Exp Pathol, 8, 2221–2234.

Chen

Z.Y.

, Lin

, Yang

, Jiang

, and Ge

(2013a). Gene therapy for cardiovascular disease mediated by ultrasound and microbubbles. Cardiovasc Ultrasound, 11, 11.

Chen

Z.Y.

, Yang

, Lin

, Zhang

J.S.

, Qiu

R.X.

, Jiang

, et al. (2013b). New development and application of ultrasound targeted microbubble destruction in gene therapy and drug delivery. Curr Gene Ther, 13, 250–274.

Feng

, Hu

, Ma

, Feng

, Zhang

, Yang

, et al. (2011). RNAi-mediated silencing of VEGF-C inhibits non-small cell lung cancer progression by simultaneously down-regulating the CXCR4, CCR7, VEGFR-2 and VEGFR-3-dependent axes-induced ERK, p38 and AKT signalling pathways. Eur J Cancer, 47, 2353–2363.

Florinas

, Kim

, Nam

, Janat-Amsbury

M.M.

, and Kim

S.W.

(2014). Ultrasound-assisted siRNA delivery via arginine-grafted bioreducible polymer and microbubbles targeting VEGF for ovarian cancer treatment. J Control Release, 183, 1–8.

Gil-Ranedo

, Mendiburu-Elicabe

, Garcia-Villanueva

, Medina

, del Alamo

, and Izquierdo

(2011). An off-target nucleostemin RNAi inhibits growth in human glioblastoma-derived cancer stem cells. PLoS One, 6, e28753.

Invernizzi

, Vigano

, Grossi

, and Lampertico

(2016). The prognosis and management of inactive HBV carriers. Liver Int, 36 Suppl 1, 100–104.

Iversen

, Yang

, Dagnaes-Hansen

, Schaffert

D.H.

, Kjems

, and Gao

(2013). Optimized siRNA-PEG conjugates for extended blood circulation and reduced urine excretion in mice. Theranostics, 3, 201–209.

Jafari

, Soltani

, Naahidi

, Karunaratne

D.N.

, and Chen

(2012). Nonviral approach for targeted nucleic acid delivery. Curr Med Chem, 19, 197–208.

10.

, Chang

, Zhai

Y.P.

, and Xu

(2013). Targeted silencing of inhibitors of apoptosis proteins with siRNAs: a potential anti-cancer strategy for hepatocellular carcinoma. Asian Pac J Cancer Prev, 14, 4943–4952.

11.

Liao

Y.Y.

, Chen

Z.Y.

, Wang

Y.X.

, Lin

, Yang

, and Zhou

Q.L.

(2014). New progress in angiogenesis therapy of cardiovascular disease by ultrasound targeted microbubble destruction. Biomed Res Int, 2014, 872984.

12.

Obi

, Sato

, and Kawai

(2015). Current status of hepatic arterial infusion chemotherapy. Liver Cancer, 4, 188–199.

13.

Park

D.H.

, Jung

B.K.

, Lee

Y.S.

, Jang

J.Y.

, Kim

M.K.

, Lee

J.K.

, et al. (2015). Evaluation of in vivo antitumor effects of ANT2 shRNA delivered using PEI and ultrasound with microbubbles. Gene Ther, 22, 325–332.

14.

Racz

, and Hamar

(2008). [SiRNA technology, the gene therapy of the future?]. Orvosi Hetilap, 149, 153–159.

15.

Schambach

, Zychlinski

, Ehrnstroem

, and Baum

(2013). Biosafety features of lentiviral vectors. Hum Gene Ther, 24, 132–142.

16.

Shi

, Liu

, Sun

, Zhang

, Du

, Li

, et al. (2014). siRNA delivery mediated by copolymer nanoparticles, phospholipid stabilized sulphur hexafluoride microbubbles and ultrasound. J Biomed Nanotechnol, 10, 436–444.

17.

Suzuki

, Oda

, Utoguchi

, and Maruyama

(2011). Progress in the development of ultrasound-mediated gene delivery systems utilizing nano- and microbubbles. J Control Release, 149, 36–41.

18.

Tong

Z.T.

, Cai

M.Y.

, Wang

X.G.

, Kong

L.L.

, Mai

S.J.

, Liu

Y.H.

, et al. (2012). EZH2 supports nasopharyngeal carcinoma cell aggressiveness by forming a co-repressor complex with HDAC1/HDAC2 and Snail to inhibit E-cadherin. Oncogene, 31, 583–594.

19.

Waghray

, Murali

A.R.

, and Menon

K.N.

(2015). Hepatocellular carcinoma: from diagnosis to treatment. World J Hepatol, 7, 1020–1029.

20.

Wang

H.H.

, Song

Y.X.

, Bai

, Jin

L.F.

, Gu

J.Y.

, Su

Y.J.

, et al. (2014). Ultrasound targeted microbubble destruction for novel dual targeting of HSP72 and HSC70 in prostate cancer. Asian Pac J Cancer Prev, 15, 1285–1290.

21.

Xiang

Z.W.

, Sun

, Li

G.H.

, Maharjan

, Huang

J.H.

, and Li

C.X.

(2015). Progress in the treatment of pulmonary metastases after liver transplantation for hepatocellular carcinoma. World J Hepatol, 7, 2309–2314.

22.

Xie

, Liu

, Su

, Wang

, Zheng

, and Fu

(2010). Ultrasound microbubbles enhance recombinant adeno-associated virus vector delivery to retinal ganglion cells in vivo. Acad Radiol, 17, 1242–1248.

23.

Yang

J.D.

, and Roberts

L.R.

(2010). Hepatocellular carcinoma: a global view. Nat Rev Gastroenterol Hepatol, 7, 448–458.

24.

Yin

, Wang

, Li

, Zheng

, Cheng

, et al. (2013). Ultrasound-sensitive siRNA-loaded nanobubbles formed by hetero-assembly of polymeric micelles and liposomes and their therapeutic effect in gliomas. Biomaterials, 34, 4532–4543.

25.

Yuan

J.H.

, Yang

, Wang

, Ma

J.Z.

, Guo

Y.J.

, Tao

Q.F.

, et al. (2014). A long noncoding RNA activated by TGF-beta promotes the invasion-metastasis cascade in hepatocellular carcinoma. Cancer Cell, 25, 666–681.

26.

Zhang

, Chang

, Sun

, Zhu

, Pu

, Li

, et al. (2015). Targeted microbubbles for ultrasound mediated short hairpin RNA plasmid transfection to inhibit survivin gene expression and induce apoptosis of ovarian cancer A2780/DDP cells. Mol Pharm, 12, 3137–3145.