Characterization of VNTRs Within the Entire Region of SLC6A3 and Its Association with Hypertension

Abstract

The dopamine transporter SLC6A3 (DAT1) mediates uptake of dopamine into presynaptic terminals. In addition, in previous reports, hypertensive rats were associated with DAT gene, but the genetic association with SLC6A3 and hypertension is still unknown. We examined the distribution of variable number of tandem repeats (VNTRs) and conducted polymorphic analysis of the entire region of SLC6A3. Ten VNTR regions (MS1–10) were revealed throughout the intronic and UTRs; seven VNTR regions were newly isolated and three VNTRs were previously reported. Four VNTR regions (SLC6A3-MS1, -MS4, -MS8 [rs3836790], and -MS9 [rs28363170]) showed polymorphism and these loci were found to be transmitted through meiosis following Mendelian inheritance. These VNTR polymorphisms may be useful markers for paternity mapping and DNA fingerprinting. Furthermore, we also conducted a case–control study between the controls and essential hypertensive cases. Analysis of the genotypes of SLC6A3-MS8 (rs3836790) revealed that having an 8/6-repeat allele, which was only detected in hypertensive cases, was associated with hypertension (p < 0.05). Additional significant association was identified between the short 7-repeat allele of SLC6A3-MS9 (rs28363170) and the occurrence of hypertension (odds ratio 2.02; p < 0.05). These results revealed the genetic association between SLC6A3 and hypertension, and the specific VNTR alleles of SLC6A3 may be a risk factor for hypertension.

Introduction

The solute carrier family 6 (SLC6) gene family can be classified as Na⁺-Cl⁻-coupled transporters, which include transporters of dopamine, serotonin, 5-HT, norepinephrine, glycine, and γ-aminobutyric acid (Amara and Kuhar, 1993; Hoglund et al., 2005). The SLC6 family members are also known as specific transporters for osmolyte neurotransmitters and amino acids (Carlsson, 1987; Hoglund et al., 2005; Hahn and Blakely, 2007) and are associated with a number of serious neurological and psychiatric disorders (Amara and Kuhar, 1993; Blakely et al., 1994; Hoglund et al., 2005).

The dopamine transporter SLC6A3 (DAT1) is a presynaptic plasma membrane protein and acts to take released dopamine back up into the presynaptic nerve terminals (Gainetdinov et al., 1999; Bannon, 2005). SLC6A3 has been implicated in human disorders such as Parkinson's disease, Tourette's syndrome, substance abuse, attention-deficit/hyperactivity disorder (ADHD), and life expectancy (Seeman and Niznik, 1990; Madras et al., 1998; Krause et al., 2003; Brookes et al., 2006; Tarnok et al., 2007; Safarinejad, 2011; Hadi et al., 2015).

Association of genetic variation with specific diseases serves as a useful mechanism for understanding how alteration of the gene function can be involved in a disease pathway. Genetic association with variable number of tandem repeats (VNTRs, minisatellites) of various genes was reported with human diseases, such as associations between TERT, MUC6, or HRAS1 and various cancers, and SLC6A2 or SLC6A19 and hypertension (Krontiris et al., 1993; Ono et al., 2003; Kwon et al., 2010; Yoon et al., 2010). As stated above, VNTRs are utilized as biomarkers in various fields.

A relatively strong linkage was observed between human hypertension and the 5p15 region (Rice et al., 2000; Wu et al., 2003). This region encodes the DAT1 (SLC6A3), Xtrp (SLC6A18), and B⁰AT1 (SLC6A19) genes, which are syntenic to the area of mouse chromosome 13 (Vandenbergh et al., 1992). We previously conducted a study in which we reported the distribution of VNTRs of SLC6A18 and SLC6A19 for essential hypertension (EH) susceptibility in the Korean population (Seol et al., 2008; Yoon et al., 2008).

The polymorphic 3′-UTR VNTR element of SLC6A3 (rs28363170) of about 40 bp revealed an association with ADHD, cognition, and brain function (Vandenbergh et al., 1992; Sano et al., 1993; Heinz et al., 2000; Sander et al., 2000; Li et al., 2006). An association between ADHD and VNTRs in the intron 8 region of SLC6A3 (rs3836790) was discovered in a previous study and SLC6A3 was associated with psychological disorders such as ADHD, Parkinson's disease, and schizophrenia (Seeman and Niznik, 1990; Madras et al., 1998; Krause et al., 2003; Brookes et al., 2006; Miguita et al., 2007). Interestingly, the spontaneously hypertensive rat is a well-characterized genetic model of ADHD (Howes et al., 1984; van den Buuse et al., 1986; McKeon and Hendley, 1988; Watanabe et al., 1997). It also reported that the brain dopamine system performs a direct role in adjusting blood pressure and developing hypertension (Watanabe et al., 1997).

SLC6A3 is located near the telomere at p15.3 (Vandenbergh et al., 1992) of chromosome 5, and VNTRs are predominantly located in the subtelomeric regions (Jeffreys et al., 1985). Therefore, we identified the VNTRs from the entire SLC6A3 region; 10 VNTRs were identified, 7 of which were novel regions in this study. Next, we investigated the relationship between EH and these VNTR regions. To genotype the SLC6A3 polymorphisms, 388 samples of genomic DNA obtained from the blood of normal individuals as well as from samples obtained from eight multigenerational families were analyzed. Furthermore, a case–control study was performed that compared genomic DNA from 388 controls and DNA from 201 Korean individuals with hypertension.

Materials and Methods

Database analysis and primer construction for VNTR regions of SLC6A3

All DNA sequence regions analyzed in this study were based on SLC6A3 genomic sequences (length 1–52,639 bp, Fig. 1) and assembled by NCBI (|NC_000005.9|NC_000005: 1392905-1445543 Homo sapiens chromosome 5, GRCh37.p2 primary reference assembly). VNTR regions (repeat units: 10 and 100 bp in length) were confirmed by using Tandem Repeats Finder software (Benson, 1999), and regions that scored >300 in the program algorithm were selected as VNTRs for further analysis.

FIG. 1.

Minisatellites in SLC6A3. (A) Structure of the entire genomic region of SLC6A3. It is predicted that 15 exons (black boxes) encode SLC6A3. The approximate positions of VNTRs are indicated by asterisks and numbers (SLC6A3-MS1, -MS2, -MS3, -MS4, -MS5, -MS6, -MS7, -MS8 (rs3836790), -MS9 (rs28363170), and -MS10). (B) The sequences represent 10 VNTR units. VNTRs, variable number of tandem repeats.

All primers used in this work were constructed using Primer3 software (http://frodo.wi.mit.edu/). The following primer pairs were used for amplification: MS1, F-CTGGGCCTTCGGTGAGCTTG and R-CCACTGGCCACACTGGCTGA; MS2, F-TGGGCATCCATTGTCAGTTACCA and R-TGTTCTCATGCTCAGGGCACCTC; MS3, F-TGGGTGTCACTGCGCAAGAA and R-CTGGCGAGGGCAGGAAGATG; MS4, AGTGCTGGCTGGTGCCTGTG and R-CGGAGGGCACCTTGGGTCTT; MS5, F-GGCTGGCTGGATGTATGG and R-CCATTTCTTTCCTGATTTCTCTTCA; MS6, F-CGTGGACCCACCCACCTTTC and R-GCCCTAGCGGGGTCTCCATC; MS7, F-GGGGACACACTCAGGGGGTTG and R-GGCAGCAGACGACTGGTGGAA; MS8 (rs3836790), F-GCACAAATGAGTGTTCGTGCATGT and R-CAGGCTGGTCCTGCCCTTCA; MS9 (rs28363170), F-CATTGGAGGATGGGGGTCCTG and R-AGCAAGCAGGCTCGCGGATA; and MS10, F-GTCATGGCTGTCCCCTGCAA and R-GGAGGCTGAGGCAGTTTTTCCA.

Study population

To examine the degree of VNTR polymorphism in SLC6A3, we performed a case–control study with genomic DNA obtained from unrelated 388 healthy controls and 201 EH cases. As previously described (Seol et al., 2008; Yoon et al., 2008), hypertensive patients were classified when they had a systolic blood pressure (SBP) of >140 mmHg or a diastolic blood pressure (DBP) of >90 mmHg, while the normotensive controls used in this study showed an SBP of <130 mmHg and a DBP of <85 mmHg (Seol et al., 2008; Yoon et al., 2008). The control group, with no personal history of hypertension, was recruited and completed an interview. The age and sex of the normotensive controls and hypertensive cases are shown in Table 1.

Table 1.

Age and Sex Distribution of Controls and Cases

Characteristic	Level	Normotension, n (%)	Hypertension, n (%)	χ² -value^a (p-value)
Age (years)	≤29	15 (3.87)	5 (2.49)
	30–39	16 (4.12)	7 (3.48)
	40–49	59 (15.21)	30 (14.93)
	50–59	108 (27.84)	49 (24.38)	5.8754
	60–69	137 (35.31)	68 (33.83)	p = 0.4373
	70–79	45 (11.60)	36 (17.91)
	80+	8 (2.06)	6 (2.99)
Mean age	Women	58.5 ± 12.3	61.5 ± 11.7
	Men	55.5 ± 11.8	57.3 ± 12.6
		57.0 ± 12.2	59.4 ± 12.3
Sex	Women	220 (56.70)	114 (56.72)	0
	Men	168 (43.30)	87 (43.28)	p = 1
Total samples		388	201

P-values are obtained from chi-square test, significant difference, P < 0.05.

In addition, genomic DNA samples were obtained from eight multigenerational family groups: six two-generation families and two three-generation families (Seol et al., 2008; Yoon et al., 2008). For conducting PCR experiments, we used genomic DNA isolated in a previous study (Seol et al., 2008; Yoon et al., 2008). Genomic DNA samples were previously obtained from two different hospitals in different cities (Dong-A University Hospital [#IRB-06-10-02 and IRB-07-10-7, Busan, Korea] and Chungbuk National University Hospital [#IRB-2006-1, Cheongju, Korea]).

Analysis of VNTR polymorphisms of SLC6A3

Genomic DNA isolated from whole blood was added to a PCR mixture that comprised the following: 50 mM KCl, 10 mM Tris-HCl, pH 9.0, 3.0 mM MgCl₂, 0.2 mM dTTP, dCTP, dGTP, and dATP in a final volume of 40 μL. For analysis of the VNTR polymorphisms, PCR amplification was performed with the primers shown above under the following conditions: SLC6A3-MS1, -MS2, -MS3, -MS6, -MS7, -MS9 (rs28363170), and MS10, 1 cycle of 2 min of initial denaturation at 94°C, followed by 30 cycles of 45 s at 94°C, and 2 min at 68°C (1 min per kb of DNA), with a 7-min extension at 72°C; SLC6A3-MS5, 1 cycle of 2 min of initial denaturation at 94°C, followed by 30 cycles of 45 s at 94°C, 30 s at 62°C, and 1 min at 72°C, with a 7-min extension at 72°C; SLC6A3-MS4, 1 cycle of 3 min of initial denaturation at 94°C, followed by 30 cycles of 30 s at 94°C, 30 s at 68°C, and 2 min at 72°C, with a 7-min extension at 72°C; and SLC6A3-MS8 (rs3836790), 1 cycle of 2 min of initial denaturation at 94°C, followed by 30 cycles of 45 s at 94°C, and 1 min at 70°C, with a 7-min extension at 72°C. PCR was performed using a 9700 Thermal Cycler (Perkin-Elmer), with TaKaRa G-Taq polymerase (TaKaRa Co.) or GeNet Bio primer Taq polymerase (GeNet Bio Co.). VNTRs were analyzed by gel electrophoresis (1 V/cm) in 1× TAE buffer through a 1.0–2.0% agarose gel.

All PCR products in VNTR regions (Fig. 1) were purified using a Gel Extraction Kit (Qiagen) and confirmed by DNA sequencing.

Statistical analysis

The degree of polymorphism (heterozygosity) ranges from 0 to 1 and increases depending on the number of alleles. To calculate the probability of two randomly chosen alleles that are different (heterozygous) at a given locus, the formula was used as previously described (Chakravarti and Lynn, 2004).

Regression analysis was examined to decide the odds ratios (ORs) of the association between groups. ORs were estimated using the natural logarithm and its standard error. Where relevant, we used a chi-squared test with one degree of freedom to assess differences between groups. Significant differences were determined using a confidence interval (CI) of 95%. All tests were two-sided, with p < 0.05 considered statistically significant. Statistical analysis was performed using MS Excel with CHITEST and R statistical software (v2.5.2, www.r-project.org) using the chi-squared test function to calculate the chi-squared values.

Results

Polymorphic VNTR regions in SLC6A3

Sequence analysis of the entire SLC6A3 gene (from the NCBI database) revealed the identification of 10 VNTR regions. A search of the GenBank database using the BLAST program disclosed that 10 VNTR regions (MS1–10) were revealed throughout the entire SLC6A3 gene region. Seven novel VNTR regions (SLC6A3-MS2, -MS3, -MS4, -MS5, -MS6, -MS7, and -MS10) were newly isolated in this study, while three VNTR regions [MS1 (Franke et al., 2008), MS8 (rs3836790) (Guindalini et al., 2006), and MS9 (rs28363170) (Franke et al., 2008)] were previously identified. The length, location, and consensus sequences of these repeats are presented in Figure 1. We examined the frequency of heterozygosity (the degree of polymorphism) within VNTR regions by PCR amplification with human genomic DNA samples isolated from control samples (Fig. 2). Analysis of polymorphism of all VNTRs was determined with 200 controls at first, and then when a polymorphic VNTR was decided, we examined the additional samples for each locus.

FIG. 2.

Allele frequency and electrophoretic patterns of SLC6A3 VNTRs in controls. The allelic patterns of each VNTR are shown in the upper part (electrophoretic patterns) of each panel (A–J; SLC6A3-MS1–10). The allelic frequency, size of PCR products, and repeat number are indicated in the lower part of each panel. VNTRs were PCR amplified from the genomic DNA of controls using diagnostic primers (see the Materials and Methods section). Different genotypes for four polymorphic VNTRs were analyzed: 4 alleles of MS1 (A), 15 alleles of MS4 (D), 5 alleles of MS8 (rs3836790) (H), and 5 alleles of MS9 (rs28363170) (I). The other six VNTR regions (B, C, E, F, G, and J) were found to be monomorphic. Size markers are given in bp (100 bp or 1 kb size markers). h represents the heterozygosity of each VNTR in controls.

Two VNTR regions (SLC6A3-MS1 and -MS2) were detected in the intron 3 region; SLC6A3-MS1 previously identified as an intron 3 VNTR (Franke et al., 2008) contained 7 and 8 repeats, and the new SLC6A3-MS2 region exhibited a monomorphic pattern in the 201 control samples (Fig. 2B). In this study, SLC6A3-MS1 was revealed as polymorphic from the 388 control samples, ranging from 647 to 779 bp in length and containing 6, 7, and 8 repeats of the VNTR unit with heterozygosity 0.5 (Fig. 2A). As new rare alleles, a 6-repeat allele was identified in controls and an additional rare 3-repeat allele was detected in hypertensive cases (Table 2). The most common allele (8-repeat) was found at a frequency above 52.3% in controls and cases (Table 2).

Table 2.

Frequency of SLC6A3 VNTR Alleles Between Controls and Cases

		Normotension		Hypertension
MS	Size (bp)	n = 776	Frequency	n = 402	Frequency	p-Value
MS1-repeat
8	779	406	0.5232	210	0.5224	0.9790
7	713	369	0.4755	191	0.4751	0.9898
6	647	1	0.0013	0	0.0000	0.4715
3	449	0	0.0000	1	0.0025	0.1645
MS4-repeat
32	2548	1	0.0013	0	0.0000	0.4715
31	2473	10	0.0133	5	0.0125	0.9481
30	2398	166	0.2213	95	0.2375	0.3801
29	2323	131	0.1747	73	0.1825	0.5827
28	2248	12	0.0160	12	0.0300	0.0975
27	2173	1	0.0013	0	0.0000	0.4715
25	2023	1	0.0013	0	0.0000	0.4715
24	1948	2	0.0027	0	0.0000	0.3083
20	1648	6	0.0080	3	0.0075	0.9599
19	1573	0	0.0000	1	0.0025	0.1645
17	1423	2	0.0027	1	0.0025	0.9769
16	1348	89	0.1187	42	0.1050	0.5971
15	1273	7	0.0093	5	0.0125	0.5827
14	1198	320	0.4267	160	0.4000	0.6343
13	1123	1	0.0013	2	0.0050	0.2339
11	973	1	0.0013	1	0.0025	0.6356
MS8 (rs3836790)-repeat
10	395	1	0.0013	0	0.0000	0.4715
9	365	2	0.0026	0	0.0000	0.3083
8	335	3	0.0039	2	0.0050	0.7813
7	305	616	0.7938	313	0.7786	0.5444
6	275	154	0.1985	87	0.2164	0.4686
MS9 (rs28363170)-repeat
11	786	21	0.0271	7	0.0174	0.3026
10	746	710	0.9149	368	0.9154	0.9779
9	706	26	0.0335	9	0.0224	0.2867
7	626	17	0.0219	17	0.0423	0.0476 ^a
6	586	2	0.0026	1	0.0025	0.9769

Bold line denotes the statistically significant value.

Statistically significant (p < 0.05).

In intron 4, two novel VNTRs were identified (Fig. 2C, D), monomorphic SLC6A3-MS3 and polymorphic SLC6A3-MS4 (Fig. 2C, D). The SLC6A3-MS4 locus was the most polymorphic with 0.724 heterozygosity; 15 different alleles in the range 11–32 repeats were detected in controls (Fig. 2D). Three novel VNTRs (SLC6A3-MS5, SLC6A3-MS6, and SLC6A3-MS7) in intron 6 were found to have a monomorphic haplotype, analyzed in 200 control individuals (Fig. 2E–G).

SLC6A3-MS8 (rs3836790) in intron 8 was previously reported (Franke et al., 2008) and was shown to have a polymorphic pattern comprising two alleles in the control group. In this study, we found that SLC6A3-MS8 (rs3836790) is a polymorphic VNTR with five alleles comprising 6–10 repeats of a 30 bp repeat unit in 388 control individuals. The most common 7-repeat allele composed ∼79% and the 6-repeat allele ∼20%, while three rare 8-, 9-, and 10-repeat alleles composed less than 1% (Table 2).

In the 3′-UTR, two VNTRs were detected in this study, SLC6A3-MS9 (rs28363170) and SLC6A3-MS10 (Figs. 1 and 2I, J). SLC6A3-MS9 (rs28363170) was reported as a 3′-UTR VNTR with two different alleles with 9 and 10 repeats (Franke et al., 2008). In this study, five different alleles varied from 6 to 11 repeats, with 10 repeats being present in the most common allele (91.5% frequency) (Fig. 2I). An additional 3′-UTR VNTR, SLC6A3-MS10, was found to be monomorphic in 200 individuals.

Mendelian inheritance of polymorphic VNTRs of SLC6A3

An inheritance analysis of polymorphic VNTRs in SLC6A3 (SLC6A3-MS1, -MS4, -MS8 [rs3836790], and -MS9 [rs28363170]) during meiotic segregation was conducted using family groups of two and three generations (six and two families, respectively) (Fig. 3). Blood samples were obtained from parents and child of each family in a previous study (Seol et al., 2008; Yoon et al., 2008). Each polymorphic VNTR was confirmed in all eight families. Meiotic transfer for four polymorphic VNTRs could be traced from parents to child; there was hereditary segregation of each three-generation family (Fig. 3A) or two generations of a family (Fig. 3B). Their segregation within a family indicated that these VNTRs were transmitted through meiosis following Mendelian inheritance (i.e., each child received one VNTR allele from each parent; Fig. 3). Additional new VNTR alleles were not discovered during this analysis.

FIG. 3.

Meiotic inheritance of SLC6A3 VNTRs in a three-generation family (A) and a two-generation family (B). PCR amplification was performed with the genomic DNA obtained from family members. The pedigree demonstrates the relationship between family groups used in this study. (A) First generation (lanes 1 and 2; grandfather and grandmother, respectively); second generation (lanes 3 and 4; fathers and mothers); and third generation (lanes 5 and 6; children from parents 3 and 4). (B) First generation (lanes 1 and 2; father and mother, respectively); and second generation (lanes 3 and 4; children from parents 3 and 4). M corresponds to the size marker.

Genetic association between the allelic variation of SLC6A3 VNTRs and hypertension

In this study, we investigated the allelic variation of these polymorphic VNTRs to determine whether they have a role in the genetic association with hypertension. To conduct this possibility, we compared the distribution and frequency of the polymorphic SLC6A3 VNTR alleles (SLC6A3-MS1, -MS4, -MS8 [rs3836790], and -MS9 [rs28363170]) of patients with hypertension and age- and sex-matched controls (Table 1).

We performed a case–control study to compare between the 388 people in the control group and 201 in the hypertensive patient group. The frequency of VNTR alleles for SLC6A3-MS1, -MS4, -MS8 (rs3836790), and -MS9 (rs28363170) between controls and hypertension cases is represented in Table 2.

There was no significant difference in the frequency of SLC6A3-MS1 alleles between controls and cases. Because SLC6A3-MS4 represented the highest heterozygosity rate shown among controls and cases, we focused on the association between the rare variants and hypertension for further analysis. Then, VNTR alleles were divided into two groups (common and rare alleles; rare alleles were considered to be ≤1%) according to their frequency in controls. In comparison between controls and cases, there was an approximately threefold increase in the OR of hypertension for the frequency of short rare alleles (11- and 13-repeat) of SLC6A3-MS4 (Table 2). This result was not statistically significant, however, due to the low number of patients evaluated in this study. An additional rare 19-repeat allele was detected among hypertensive cases. Sixteen different alleles of SLC6A3-MS4 were detected in this study.

In the analysis of genotypes for each VNTR region, there were no significant differences between controls and hypertension cases for SLC6A3-MS1 and SLC6A3-MS4 (Table 3). Hence, the analysis of genotypes of SLC6A3-MS8 (rs3836790) found in controls and cases revealed that having an 8/6-repeat allele was associated with hypertension (p < 0.05) (Table 4). This genotype of two alleles (8/6-repeat) was only detected in two patients with hypertension (Table 4).

Table 3.

Analysis of SLC6A3-MS1 and MS4 Genotypes and Risk of Hypertension

	Normotension		Hypertension
MS1 genotype	n = 388	Frequency	n = 201	Frequency	OR (95% CI)	p-Value
MS1-genotype
8/8	103	0.2655	57	0.2836	1.10 (0.75–1.60)	0.639
8/7	200	0.5155	96	0.4776	0.86 (0.61–1.21)	0.384
7/7	84	0.2165	47	0.2338	1.11 (0.74–1.66)	0.632
6/7	1	0.0026	0	0.0000	ND	0.471
3/7	0	0.0000	1	0.0050	ND	0.164
MS4-genotype
32/14	1	0.0027	0	0.0000	ND	0.465
31/30	4	0.0107	4	0.0200	1.89 (0.47–7.65)	0.363
31/29	3	0.0080	1	0.0050	0.62 (0.06–6.03)	0.680
31/16	1	0.0027	0	0.0000	ND	0.465
31/14	2	0.0053	0	0.0000	ND	0.301
30/30	25	0.0667	16	0.0800	1.22 (0.63–2.34)	0.554
30/29	32	0.0853	18	0.0900	1.06 (0.58–1.94)	0.850
30/28	3	0.0080	4	0.0200	2.53 (0.56–11.42)	0.211
30/27	1	0.0027	0	0.0000	ND	0.465
30/24	2	0.0053	0	0.0000	ND	0.301
30/20	0	0.0000	2	0.0100	ND	0.052
30/16	16	0.0427	4	0.0200	0.46 (0.15–1.39)	0.158
30/14	58	0.1547	30	0.1500	0.97 (0.60–1.56)	0.882
30/13	0	0.0000	1	0.0050	ND	0.171
29/29	16	0.0427	8	0.0400	0.94 (0.39–2.22)	0.879
29/28	4	0.0107	1	0.0050	0.47 (0.05–4.20)	0.486
29/20	3	0.0080	0	0.0000	ND	0.205
29/16	18	0.0480	10	0.0500	1.04 (0.47–2.31)	0.916
29/15	2	0.0053	0	0.0000	ND	0.301
29/14	36	0.0960	25	0.1250	1.35 (0.78–2.31)	0.252
29/13	0	0.0000	1	0.0050	ND	0.171
29/11	1	0.0027	1	0.0050	1.88 (0.12–30.21)	0.651
28/28	0	0.0000	2	0.0100	ND	0.052
28/20	0	0.0000	1	0.0050	ND	0.171
28/16	1	0.0027	0	0.0000	ND	0.465
28/14	4	0.0107	2	0.0100	0.94 (0.17–5.16)	0.940
25/14	1	0.0027	0	0.0000	ND	0.465
20/14	3	0.0080	0	0.0000	ND	0.205
19/14	0	0.0000	1	0.0050	ND	0.171
17/14	2	0.0053	1	0.0050	0.94 (0.08–10.40)	0.958
16/16	6	0.0160	5	0.0250	1.58 (0.48–5.23)	0.453
16/15	1	0.0027	3	0.0150	3.78 (0.34–41.92)	0.245
16/14	37	0.0987	15	0.0750	0.74 (0.40–1.39)	0.346
16/13	1	0.0027	0	0.0000	ND	0.465
15/15	2	0.0053	0	0.0000	ND	0.301
15/14	2	0.0053	2	0.0100	1.88 (0.26–13.48)	0.521
14/14	87	0.2320	42	0.2100	0.88 (0.58–1.33)	0.547

CI, confidence interval; ND, not determined; OR, odds ratio.

Table 4.

Analysis of SLC6A3-MS8 (rs3836790) Genotypes and Risk of Hypertension

	Normotension		Hypertension
MS8 (rs3836790) genotype	n = 388	Frequency	n = 201	Frequency	OR (95% CI)	p-Value
10/6	1	0.0026	0	0	ND	0.471
9/7	2	0.0052	0	0	ND	0.308
8/7	3	0.0077	0	0	ND	0.211
7/7	244	0.6289	121	0.6020	0.893 (0.63–1.27)	0.5241
8/6	0	0	2	0.0100	ND	0.049^a
7/6	123	0.3170	71	0.3532	1.177 (0.82–1.69)	0.3751
6/6	15	0.0387	7	0.0348	0.897 (0.36–2.24)	0.8160

Statistically significant (p < 0.05).

For SLC6A3-MS9 (rs28363170), five VNTR alleles ranging from 6 to 11 repeats were detected among controls and cases (Table 2). Interestingly, the presence of a 7-repeat allele was associated with a relative OR of 2.0 (95% CI 1.0–3.9; p < 0.05) for hypertension (Table 2). Furthermore, analysis of genotypes of the 7-repeat allele found in cases and controls revealed that having one 7-repeat allele in SLC6A3-MS9 (rs28363170) (controls : cases = 4.4% : 8.5%) was associated with a relative hypertension OR of 2.03 (95% CI 1.01–4.06; p = 0.043; Table 5).

Table 5.

Analysis of SLC6A3-MS9 (rs28363170) Genotypes and Risk of Hypertension

	Normotension		Hypertension
MS9 (rs28363170)genotype	n = 388	Frequency	n = 201	Frequency	OR (95% CI)	p-Value
11/10	21	0.0514	6	0.0299	0.538 (0.21–1.35)	0.1817
11/7	0	0	1	0.005	ND	ND
10/10	325	0.8376	168	0.8358	0.987 (0.62–1.56)	0.9551
10/9	22	0.0567	9	0.0448	0.780 (0.35–1.73)	0.5398
10/7	16	0.0412	16	0.0796	2.011 (0.98–4.11)	0.0515
10/6	1	0.0026	1	0.005	1.935 (0.12–31.10)	0.6353
9/9	2	0.0052	0	0	ND	ND
7/6	1	0.0026	0	0	ND	ND
7/N^*	17	0.0438	17	0.0846	2.027 (1.01–4.06)	0.043^a

Statistically significant (p < 0.05).

N^*, any other alleles except 7-repeat allele.

In an attempt to determine if allelic variants in SLC6A3 VNTRs were associated with disease, we analyzed the genetic association with hypertension because SLC6A3 is located in 5p15, a region in which there is a relatively strong linkage expected with hypertension. A case–control study was performed to score SLC6A3 VNTR alleles in DNA from controls and cases. There was no difference in the frequencies of alleles from the SLC6A3-MS1 and -MS4 loci observed between controls and cases (Table 2). The genotype having an 8/6-repeat allele in SLC6A3-MS8 (rs3836790) was associated with hypertension (p < 0.05) and the 7-repeat allele of SLC6A3-MS9 (rs28363170) was associated with a relative OR of 2.03 (95% CI 1.01–4.06; p < 0.05) for hypertension (Tables 2 –5).

Discussion

Overall, in this study, 7 of the 10 VNTRs in SLC6A3 evaluated were novel VNTR loci that were first analyzed in this study. SLC6A3 has four polymorphic VNTRs (SLC6A3-MS1, -MS4, -MS8 [rs3836790], and -MS9 [rs28363170]) and six monomorphic minisatellites (SLC6A3-MS2, -MS3, -MS5, -MS6, -MS7, and MS10). A search of the GenBank database using the BLASTN program revealed that there was no significant similarity between these VNTRs and other previously identified repeated regions. Therefore, all of the VNTRs examined in this study are unique to SLC6A3 and the properties they confer may be directly related to SLC6A3 function.

An inheritance analysis of polymorphic VNTRs in SLC6A3 (SLC6A3-MS1, -MS4, -MS8 [rs3836790], and -MS9 [rs28363170]) during meiotic segregation was conducted using family groups. Meiotic transfer for four polymorphic VNTRs could be traced from parents to child. Their segregation within a family indicated that these VNTRs were transmitted through meiosis following Mendelian inheritance. These observations suggest that these polymorphic VNTRs could also be useful markers for paternity mapping and DNA fingerprinting. Furthermore, these polymorphisms could be useful as markers for meiotic segregation of SLC6A3 VNTRs in studies evaluating SLC6A3-related inheritable diseases.

In previous studies reported by Rice et al. (2000) and Wu et al. (2003), there was relatively strong linkage between human hypertension and 5p15. SLC6A3, which is located in this region, is well known to be associated with psychological disorders such as Parkinson's disease, ADHD, and schizophrenia (Seeman and Niznik, 1990; Madras et al., 1998; Krause et al., 2003), while it was also reported that the brain dopamine system performed a significant role in the development of hypertension (Watanabe et al., 1997).

To investigate the genetic association between the allelic variation of these polymorphic VNTRs and hypertension, we performed a case–control study to compare between the control group and hypertensive patient group. For SLC6A3-MS9 (rs28363170), the presence of a 7-repeat allele was associated with a relative OR of 2.0 (95% CI 1.0–3.9; p < 0.05) for hypertension. Furthermore, analysis of genotypes of the 7-repeat allele found in cases and controls revealed that having one 7-repeat allele in SLC6A3-MS9 (rs28363170) (controls : cases = 4.4% : 8.5%) was associated with a relative hypertension OR of 2.03 (p = 0.043).

Coincidently, in previous studies, the expression level of the 7-repeat allele of SLC6A3-MS9 (rs28363170) was detected as lower than that of the 10-repeat allele through the luciferase assay (Fuke et al., 2001; Miguita et al., 2007). Moreover, it was reported for interaction between the miRNA (miR-137 and miR-491) and different lengths of repeats of 3′-UTR VNTR region of DAT1 gene (Jia et al., 2016). Authors reported that miR-491 binds to 3′-UTR VNTR region and it affected the expression level in luciferase assay. The functional role played by these SLC6A3 VNTRs is still not clear; however, they may play a role in regulation of the expression of SLC6A3. Taken together, these results suggested that the genetic association between the SLC6A3 VNTRs and the occurrence hypertension and the specific VNTR alleles of SLC6A3 may be a risk factor for hypertension. This study should provide a helpful reference for understanding the function and complex genomic properties of the SLC6 family.

Conclusion

This is the first study to characterize 10 VNTRs of the entire region of the SLC6A3 gene in detail. Ten VNTR regions (MS1–10) were revealed throughout the intronic and UTRs; four VNTR regions showed polymorphism and these loci were found to be transmitted through meiosis following Mendelian inheritance, which may be useful markers for paternity mapping and DNA fingerprinting. In a case–control study between the controls and essential hypertensive cases, the genotypes of SLC6A3-MS8 (rs3836790) revealed that having an 8/6-repeat allele was associated with hypertension (p < 0.05). Additional significant association was identified between the short 7-repeat allele of SLC6A3-MS9 (rs28363170) and the occurrence of hypertension. These results revealed the genetic association between the specific SLC6A3 VNTR alleles and hypertension, and the specific VNTR alleles of SLC6A3 may be a risk factor for hypertension.

Footnotes

Acknowledgment

This work was supported by the Dong-A University research fund.

Disclosure Statement

No competing financial interests exist.

References

Amara

S.G.

, and Kuhar

M.J.

(1993). Neurotransmitter transporters: recent progress. Annu Rev Neurosci, 16, 73–93.

Bannon

M.J.

(2005). The dopamine transporter: role in neurotoxicity and human disease. Toxicol Appl Pharmacol, 204, 355–360.

Benson

(1999). Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res, 27, 573–580.

Blakely

R.D.

, De Felice

L.J.

, and Hartzell

H.C.

(1994). Molecular physiology of norepinephrine and serotonin transporters. J Exp Biol, 196, 263–281.

Brookes

K.J.

, Mill

, Guindalini

, Curran

, Xu

, Knight

, et al. (2006). A common haplotype of the dopamine transporter gene associated with attention-deficit/hyperactivity disorder and interacting with maternal use of alcohol during pregnancy. Arch Gen Psychiatry, 63, 74–81.

Carlsson

(1987). Perspectives on the discovery of central monoaminergic neurotransmission. Annu Rev Neurosci, 10, 19–40.

Chakravarti

, and Lynn

(2004). Meiotic mapping in human. In Genome Analysis: A Laboratory Manual. Vol. 4. Birren

, Green

E.D.

, Klapholz

, Myers

R.M.

, and Roskams , eds. (Cold Spring Harbor Laboratory, NY), pp. 33–40.

Franke

, Hoogman

, Arias Vasquez

, Heister

J.G.

, Savelkoul

P.J.

, Naber

, et al. (2008). Association of the dopamine transporter (SLC6A3/DAT1) gene 9-6 haplotype with adult ADHD. Am J Med Genet B Neuropsychiatr Genet, 147B, 1576–1579.

Fuke

, Suo

, Takahashi

, Koike

, Sasagawa

, and Ishiura

(2001). The VNTR polymorphism of the human dopamine transporter (DAT1) gene affects gene expression. Pharmacogenomics J, 1, 152–156.

10.

Gainetdinov

R.R.

, Jones

S.R.

, and Caron

M.G.

(1999). Functional hyperdopaminergia in dopamine transporter knock-out mice. Biol Psychiatry, 46, 303–311.

11.

Guindalini

, Howard

, Haddley

, Laranjeira

, Collier

, Ammar

, et al. (2006). A dopamine transporter gene functional variant associated with cocaine abuse in a Brazilian sample. Proc Natl Acad Sci U S A, 103, 4552–4557.

12.

Hadi

, Dato

, Carpi

F.M.

, Prontera

, Crucianelli

, Renda

, et al. (2015). A genetic-demographic approach reveals a gender-specific association of SLC6A3/DAT1 40 bp-VNTR with life-expectancy. Biogerontology, 16, 365–373.

13.

Hahn

M.K.

, and Blakely

R.D.

(2007). The functional impact of SLC6 transporter genetic variation. Annu Rev Pharmacol Toxicol, 47, 401–441.

14.

Heinz

, Goldman

, Jones

D.W.

, Palmour

, Hommer

, Gorey

J.G.

, et al. (2000). Genotype influences in vivo dopamine transporter availability in human striatum. Neuropsychopharmacology, 22, 133–139.

15.

Hoglund

P.J.

, Adzic

, Scicluna

S.J.

, Lindblom

, and Fredriksson

(2005). The repertoire of solute carriers of family 6: identification of new human and rodent genes. Biochem Biophy Res Commun, 336, 175–189.

16.

Howes

L.G.

, Rowe

P.R.

, Summers

R.J.

, and Louis

W.J.

(1984). Age related changes of catecholamines and their metabolites in central nervous system regions of spontaneously hypertensive (SHR) and normotensive Wistar-Kyoto (WKY) rats. Clin Exp Hypertens A, 6, 2263–2277.

17.

Jeffreys

A.J.

, Wilson

, and Thein

S.L.

(1985). Hypervariable ‘minisatellite’ regions in human DNA. Nature, 314, 67–73.

18.

Jia

, Wang

, Han

, Geng

, Li

, Shi

, et al. (2016). miR-137 and miR-491 negatively regulate dopamine transporter expression and function in neural cells. Neurosci Bull, 32, 512–522.

19.

Krause

K.H.

, Dresel

S.H.

, Krause

, la Fougere

, and Ackenheil

(2003). The dopamine transporter and neuroimaging in attention deficit hyperactivity disorder. Neurosci Biobehav Rev, 27, 605–613.

20.

Krontiris

T.G.

, Devlin

, Karp

D.D.

, Robert

N.J.

, and Risch

(1993). An association between the risk of cancer and mutations in the HRAS1 minisatellite locus. N Engl J Med, 329, 517–523.

21.

Kwon

J.A.

, Lee

S.Y.

, Ahn

E.K.

, Seol

S.Y.

, Kim

M.C.

, Kim

S.J.

, et al. (2010). Short rare MUC6 minisatellites-5 alleles influence susceptibility to gastric carcinoma by regulating gene. Hum Mutat, 31, 942–949.

22.

, Sham

P.C.

, Owen

M.J.

, and He

(2006). Meta-analysis shows significant association between dopamine system genes and attention deficit hyperactivity disorder (ADHD). Hum Mol Genet, 15, 2276–2284.

23.

Madras

B.K.

, Gracz

L.M.

, Fahey

M.A.

, Elmaleh

, Meltzer

P.C.

, Liang

A.Y.

, et al. (1998). Altropane, a SPECT or PET imaging probe for dopamine neurons: III. Human dopamine transporter in postmortem normal and Parkinson's diseased brain. Synapse, 29, 116–127.

24.

McKeon

T.W.

, and Hendley

E.D.

(1988). Brain monoamines and metabolites in hypertensive and hyperactive rat strains. Clin Exp Hypertens A, 10, 971–994.

25.

Miguita

, Cordeiro

, Siqueira-Roberto

, Shavitt

R.G.

, Ramos Castillo

J.C.

, Castillo

A.R.

, et al. (2007). Association analysis between a VNTR intron 8 polymorphism of the dopamine transporter gene (SLC6A3) and obsessive-compulsive disorder in a Brazilian sample. Arq Neuro Psiquiat, 65, 936–941.

26.

Ono

, Iwanaga

, Mannami

, Kokubo

, Tomoike

, Komamura

, et al. (2003). Epidemiological evidence of an association between SLC6A2 gene polymorphism and hypertension. Hypertens Res, 26, 685–689.

27.

Rice

, Rankinen

, Province

M.A.

, Chagnon

Y.C.

, Perusse

, Borecki

I.B.

, et al. (2000). Genome-wide linkage analysis of systolic and diastolic blood pressure: the Quebec Family Study. Circulation, 102, 1956–1963.

28.

Safarinejad

M.R.

(2011). Relationship between premature ejaculation and genetic polymorphisms of the dopamine transporter gene (SLC6A3). BJU Int, 108, 292–296.

29.

Sander

, Berlin

, Ostapowicz

, Samochowiec

, Gscheidel

, and Hoehe

M.R.

(2000). Variation of the genes encoding the human glutamate EAAT2, serotonin and dopamine transporters and susceptibility to idiopathic generalized epilepsy. Epilepsy Res, 41, 75–81.

30.

Sano

, Kondoh

, Kakimoto

, and Kondo

(1993). A 40-nucleotide repeat polymorphism in the human dopamine transporter gene. Hum Genet, 91, 405–406.

31.

Seeman

, and Niznik

H.B.

(1990). Dopamine receptors and transporters in Parkinson's disease and schizophrenia. FASEB J, 4, 2737–2744.

32.

Seol

S.Y.

, Lee

S.Y.

, Kim

Y.D.

, Do

E.J.

, Kwon

J.A.

, Kim

S.I.

, et al. (2008). Minisatellite polymorphisms of the SLC6A19: susceptibility in hypertension. Biochem Biophys Res Commun, 374, 714–719.

33.

Tarnok

, Ronai

, Gervai

, Kereszturi

, Gadoros

, Sasvari-Szekely

, et al. (2007). Dopaminergic candidate genes in Tourette syndrome: association between tic severity and 3′ UTR polymorphism of the dopamine transporter gene. Am J Med Genet B, 144B, 900–905.

34.

van den Buuse

, Versteeg

D.H.

, and de Jong

(1986). Brain dopamine depletion by lesions in the substantia nigra attenuates the development of hypertension in the spontaneously hypertensive rat. Brain Res, 368, 69–78.

35.

Vandenbergh

D.J.

, Persico

A.M.

, Hawkins

A.L.

, Griffin

C.A.

, Li

, Jabs

E.W.

, et al. (1992). Human dopamine transporter gene (DAT1) maps to chromosome 5p15.3 and displays a VNTR. Genomics, 14, 1104–1106.

36.

Watanabe

, Fujita

, Ito

, Okada

, Kusuoka

, and Nishimura

(1997). Brain dopamine transporter in spontaneously hypertensive rats. J Nucl Med, 38, 470–474.

37.

, Nakura

, Abe

, Jin

J.J.

, Yamamoto

, Chen

, et al. (2003). Genome-wide linkage disequilibrium mapping of hypertension in Japan. Hypertens Res, 26, 533–540.

38.

Yoon

S.L.

, Jung

S.I.

, Do

E.J.

, Lee

S.R.

, Lee

S.Y.

, Chu

I.S.

, et al. (2010). Short rare hTERT-VNTR2-2nd alleles are associated with prostate cancer susceptibility and influence gene expression. BMC Cancer, 10, 393.

39.

Yoon

Y.H.

, Seol

S.Y.

, Heo

, Chung

C.N.

, Park

I.H.

, and Leem

S.H.

(2008). Analysis of VNTRs in the solute carrier family 6, member 18 (SLC6A18) and lack of association with hypertension. DNA Cell Biol, 27, 559–567.