DNA Methylation of the PDGFD Gene Promoter Increases the Risk for Intracranial Aneurysms and Brain Arteriovenous Malformations

Abstract

The aim of this study was to determine the role of DNA methylation of the platelet-derived growth factor-D (PDGFD) gene promoter in the development of intracranial aneurysms (IAs) and brain arteriovenous malformations (BAVMs). A total of 70 patients with IAs or BAVMs and 26 control individuals were enrolled for this study. The PDGFD level in the plasma was determined using enzyme-linked immunosorbent assay. DNA methylation levels of seven cytosine-phosphate-guanine (CpG) dinucleotides present in the PDGFD gene promoter were measured using bisulfite pyrosequencing technology. The plasma PDGFD levels in IA and BAVM were significantly lower than those in the control group (p = 0.0008 and 0.002, respectively). CpG1 methylation levels of the PDGFD gene promoter were significantly higher in IA patients (4.63 ± 0.35, p = 0.017) than in the control group (3.36 ± 0.35). CpG1 methylation of the PDGFD gene promoter in BAVM patients (6.00 ± 0.86, p = 0.003) was also significantly higher than that in the control group, although these differences were seen in both male and female patients (p = 2.81E-04 and p = 0.017, respectively). In addition, CpG1 methylation of the PDGFD promoter was associated with apolipoprotein E (APOE) levels in IA patients (p = 0.013). In conclusion, our study has demonstrated significant correlations between DNA methylation of the PDGFD gene promoter and the risk of developing either IA or BAVM. Furthermore, PDGFD gene promoter CpG1 methylation shows a significant correlation with APOE in IAs. Further functional studies on these relationships and correlations are warranted.

Introduction

Cerebrovascular disorders such as intracranial aneurysms (IAs) and brain arteriovenous malformations (BAVMs) are common disorders that frequently lead to fatal vascular ruptures and progress to subarachnoid hemorrhages (Yan et al., 2015). The overall morbidity of an IA is estimated at 2–5% in the general population (Alg et al., 2013). Although BAVMs are congenital vascular lesions, IAs can be caused by either congenital or acquired factors. BAVM symptoms usually develop in children and young adults (Bendjilali et al., 2014), and hemorrhages, headaches, seizures, and neurological deficits are common clinical manifestations (Braksick and Fugate, 2015). Rupture of an IA can put the patient at high risk for severe neurological impairment and death (Yasuno et al., 2010). Smoking, hypertension, and alcohol consumption are also known risk factors for the formation and rupture of IAs (Yan et al., 2015) and BAVMs (Ecker, 2016). Genome-wide correlation studies of single nucleotide polymorphisms have been performed worldwide for IAs (Foroud et al., 2012) and sporadic BAVMs (Kremer et al., 2015; Mouchtouris et al., 2015); however, the role of DNA methylation in the development of these two diseases is still unknown.

DNA methylation, which occurs at the cytosine-phosphate-guanine sequences (CpGs), is a unique chemical modification in the human genome (Chen et al., 2016). DNA methylation of a promoter is correlated with transcriptional silencing of protein-coding genes, thus regulating its protein functions in the human body (Caranci et al., 2013). Aberrant DNA methylations have been extensively studied in the pathogenesis of multiple diseases (Mendizabal and Yi, 2016). For example, DNA hypermethylation of promoter-associated CpG islands (CGIs) in tumor suppressor genes was found to cause carcinogenesis (Moarii et al., 2015). DNA methylation of the PLA2G7 gene promoter may play a role in the molecular mechanisms underlying the pathophysiology of cardiovascular diseases (Jiang et al., 2013).

The platelet-derived growth factor-D (PDGFD) is the fourth member of the PDGF family and was first identified by Eriksson's group in 2001 (Bergsten et al., 2001). Emerging evidence had implicated that the PDGFD gene was mainly expressed in endothelial cells and adventitial connective layers of vessels (Chen et al., 2005). The PDGFD protein was predominantly expressed in artery, often localized to vascular bifurcations (Gladh et al., 2016). PDGFD was considered as the specific agonistic ligand for PDGF beta-receptor, and its activation could induce downstream signaling through PDGF-β-receptor (Bergsten et al., 2001). Through binding to PDGF-β-receptor, PDGFD played an important function in the vasculature (Uutela et al., 2001). It emerged as a vascular modulator during pathological conditions. PDGFD could induce vascular smooth muscle cell migration and proliferation by stabilizing newly formed vessels and neointimal hyperplasia after vessel injury (Chen et al., 2005). In the experimental mice model, Yang et al.'s (2016) study certified that PDGFD/PDGFR-β played an important role in the proinflammatory response of secondary brain injury after intracerebral hemorrhage. Gladh et al.'s (2016) study suggested that PDGFD might have a role in regulation of arterial blood pressure and described a possible role for PDGFD in mural cell physiology and regulation of vascular homeostasis. PDGFD polymorphisms were also shown to increase cardiovascular mortality risk in elders (Alehagen et al., 2016). Studies demonstrated that PDGFD variation was associated with higher risk for ischemic stroke in a Chinese population (Han et al., 2008). Furthermore, the PDGFD polymorphism rs974819 displayed a suggestive correlation with coronary stenosis index in women with coronary artery disease (Dechamethakun et al., 2014). Based on these results, we predict that the PDGFD gene is associated with cerebral artery disease. The only epigenetic study on this topic indicated that DNA methylation levels of the PDGFD gene promoter are significantly associated with cumulative arsenic exposure in urothelial carcinoma patients (Yang et al., 2014). The objective of our research is to determine the role of DNA methylation of the PDGFD gene promoter in the development of IAs and BAVMs.

Materials and Methods

Samples and clinical data

A total of 70 cerebrovascular patients (48 patients with IAs and 22 patients with BAVMs) and 26 patients with cerebral trauma (used as controls) were included in this study. All of the individuals were enrolled between September 2013 and December 2014 at the Department of Neurosurgery, Ningbo First Hospital. All patients were diagnosed using magnetic resonance imaging and angiography according to the standardized definition (Arngrim et al., 2016). Subjects who had any history of cardiovascular, severe liver, or kidney diseases were excluded. Plasma levels of several biochemical factors and the clinical characteristics of the patients are presented in Table 1. The detection methods for the biochemical factors used were the same as those described in our previous study (Huang et al., 2015). The Ethics Committee of Ningbo First Hospital approved this study, and written informed consent was obtained from all the participants.

Table 1.

Characteristics of All Subjects

Characteristics	IA (n = 48)	BAVM (n = 22)	Control (n = 26)	p _{IA VS Control}	p _{BAVM VS Control}	p _{three groups}
Age	52.38 ± 1.35	47.77 ± 2.70	49.12 ± 2.46	0.229	0.676	0.216
Gender (M/F)	24/24	11/11	13/13
TG (mM)	1.91 ± 0.19	1.64 ± 0.33	1.54 ± 0.26	0.267	0.801	0.493
TC (mM)	5.27 ± 0.15	5.22 ± 0.26	5.04 ± 0.16	0.361	0.551	0.653
HDL (mM)	1.21 ± 0.04	1.10 ± 0.04	1.14 ± 0.05	0.331	0.605	0.287
LDL (mM)	2.99 ± 0.10	3.25 ± 0.18	3.03 ± 0.15	0.812	0.313	0.380
APOA-I (g/L)	1.13 ± 0.04	1.10 ± 0.06	1.07 ± 0.04	0.305	0.662	0.582
APOB (g/L)	0.84 ± 0.03	0.96 ± 0.07	0.87 ± 0.05	0.620	0.204	0.160
APOE (g/L)	42.91 ± 2.76^a	37.9 ± 1.55	38.53 ± 1.32	0.379	0.792	0.451
CK-MB (IU/L)	14.06 ± 1.43	9.95 ± 1.03	21.24 ± 3.40	0.014	0.001	0.004
hs-CRP (ng/L)	5.70 ± 1.50^a	10.53 ± 3.19	10.50 ± 2.30	0.043	0.396	0.122
PDGFD (ng/L)^b	13.47 ± 0.64	13.92 ± 0.66	18.83 ± 1.36	0.0008	0.002	0.002

Data presented are mean ± SE, p-value less than or equal to 0.017 is in bold.

p-value after log₁₀ transformation.

A total of 28 IA patients, 28 BAVM patients, and 28 controls were recruited for the PDGFD expression analysis.

IA, intracranial aneurysm; BAVM, brain arteriovenous malformation; TG, triglyceride; TC, total cholesterol; HDL, high-density lipoprotein; LDL, low-density lipoprotein; APOA, apolipoprotein A; APOB, apolipoprotein B; APOE, apolipoprotein E; CK-MB, creatine kinase isoenzyme; hs-CRP, hypersensitive c-reactive protein; PDGFD, platelet-derived growth factor-D.

Phenotypes collection

Blood samples were collected from the participants in a fasting state. Plasma levels of triglyceride, total cholesterol, high-density lipoprotein cholesterol (HDL), low-density lipoprotein cholesterol, apolipoprotein A-I, apolipoprotein B, apolipoprotein E (APOE), creatine kinase (CK), creatine kinase isoenzyme (CK-MB), and hypersensitive c-reactive protein were measured using the automatic biochemical analyzers [14]. A total of 84 gender–age matched individuals including 28 patients with IAs, 28 patients with BAVMs, and 28 controls were collected for the protein expression analysis. The PDGFD level in the plasma was determined using human PDGFD enzyme-linked immunosorbent assay kit (QiaoDu Biotechnology) according to the manufacturer's instructions.

Pyrosequencing assay

The magnetic bead isolation method was used to extract DNA from peripheral blood samples. The concentrations of the extracted DNA were measured by the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). The Epi Tech Bisulfite kit (Qiagen; CAT. 59104) was used to measure methylation levels through the conversion of unmethylated cytosine to uracil. DNA methylation was measured using the sodium bisulphite DNA conversion coupled with pyrosequencing (Wang et al., 2016). Pyrosequencing was performed on the PyroMark Q96 ID System. The primers were designed by the PyroMark Assay Design software. The forward primer sequence for the CGI region on the PDGFD gene promoter was 5′- TGGGTATGTTTAGTGGTAGAGT -3′, the reverse primer sequence was 5′- biotin- AAACAACAACCTTCTCCAACCC -3′, and the sequence of the sequencing primer was 5′- TGGGAAATTGGGGAG - 3′.

Statistical analyses

SPSS statistical software (version 16.0) was used to determine the correlation between the DNA methylation of the PDGFD gene promoter and IA, BAVM, and various biochemical factors. Biochemical indicator values that deviated from normality were corrected through a logarithmic transformation. A more conservative nonparametric approach was used to statistically test the data that could not be normalized. The correlation of DNA methylation with biochemical indicators was performed using both SPSS and R statistical software. A two-tailed p < 0.05 value was considered to be significant. Bonferroni's adjustment was applied to the significance thresholds for the multiple testing corrections. Given the three groups tested, the p value 0.05/3 = 0.017 was considered a corrected significance threshold.

Results

The clinical characteristics of the tested subjects are presented in Table 1. CK-MB levels were statistically different between IAs and controls (p = 0.014), BAVMs and controls (p = 0.001), and among the three groups (p = 0.004). The plasma PDGFD concentration was significantly different among three groups (Table 1, IAs vs. BAVMs vs. controls = 13.47 ± 0.64 vs. 13.92 ± 0.66 vs. 18.83 ± 1.36, p = 0.002). The plasma PDGFD levels in IAs and BAVMs were significantly lower than those in the control group (Fig. 1, p = 0.0008 and 0.002, respectively).

FIG. 1.

Comparison of PDGFD, CK-MB, and hs-CRP levels among the three groups. *p ≤ 0.017, **p ≤ 0.001. CK-MB, creatine kinase isoenzyme; hs-CRP, hypersensitive c-reactive protein; PDGFD, platelet-derived growth factor-D.

The CGI (GRCh/hg38, chr11: 104163809-104164330) region of the PDGFD is located in the gene promoter (Fig. 2). The percentages of DNA methylation found on the seven CpG sites on a 134-base pair (bp) polymerase chain reaction product were obtained using the bisulfite pyrosequencing assay. There was no significant correlation in DNA methylation levels among the seven CpGs (Fig. 2, r = 0.076–0.828). Therefore, we used the DNA methylation percentage of each CpG and the mean DNA methylation level to compare the differences between cases and controls, between male and female patients, and the relationship between PDGFD methylation and biochemical indicators.

FIG. 2.

Correlation among the seven CpGs in PDGFD gene promoter.

As shown in Figure 3, significant differences were observed between cerebrovascular and control groups in CpG1 methylation levels only. IA patients had significantly higher methylation levels (4.63 ± 0.35) than control subjects (3.36 ± 0.35, p = 0.017). BAVM patients (6.00 ± 0.86) had even higher levels than controls (3.36 ± 0.35, p = 0.003). There were no differences in DNA methylation levels between male and female patients in the case of IA, BAVM, and control subjects (Table 2, p = 0.926, 0.763, and 0.539, respectively). Both male and female patients with BAVM had higher CpG1 methylation levels than control subjects (Table 2, male patient: p = 2.81E-04, female patient: p = 0.017).

FIG. 3.

DNA methylation differences of seven CpG dinucleotides analyzed within the PDGFD. *p _{IA VS Control} = 0.017, **p _{BAVM VS Control} = 0.003.

Table 2.

Methylation Level Comparison of CpG1

DNA methylation	Male	Female	p _{Male VS Female}
IA	4.43 ± 0.27	4.83 ± 0.66	0.926
BAVM	6.30 ± 0.93	5.76 ± 1.40	0.763
Control	3.14 ± 0.53	3.58 ± 0.47	0.539
p _{IA VS Control}	0.048	0.262
p _{BAVM VS Control}	2.81E-04	0.017

Data presented are mean ± SE, p-value less than or equal to 0.017 is in bold.

Next, we explored the correlation between biochemical indicators and DNA methylation levels. Significant correlations were observed between APOE and CpG1 methylation levels in IA patients (Fig. 4a, p = 0.013). CK-MB was negatively correlated with CpG1 methylation levels in all individuals (Fig. 4b, p = 0.031), but no correlations were found between each group. Furthermore, HDL was negatively correlated with CpG1 methylation in IAs (Fig. 4c, p = 0.044).

FIG. 4.

Pearson correlation between PDGFD gene DNA methylation and APOE, CK-MB, and HDL. (a) APOE with CpG1 methylation in total subjects and IAs. (b) Correlation between PDGFD gene CpG1 methylation and CK-MB in all individuals. (c) Correlation between PDGFD gene CpG1 methylation and HDL in IAs. APOE, apolipoprotein E; HDL, high-density lipoprotein.

Discussion

In recent years, genetic research on cerebrovascular disease has focused on genes involved in vascular smooth muscle cell proliferation and differentiation, blood pressure regulation, and vascular inflammation (Bendjilali et al., 2014). Recent studies reported that genetic variations in angiogenesis and inflammation processes could play an important role in vascular development and differentiation and in arteriovenous specifications (Sturiale et al., 2013, 2014). Susceptible chromosomal loci for IAs are as follows: 1p34.3-p36.13, 7q11, 8q11.23-q12.1, 9p21, 19q13, and Xp22 (Ruigrok and Rinkel, 2008; Mohan et al., 2015); the associated genetic variants are located in genes such as CDKN2B-AS1, ELN, COL1A2, SOX17, and ADAMTS15 (Ruigrok and Rinkel, 2008; Alg et al., 2013; Yan et al., 2015). Two aneurysm-associated loci, SOX-17 and RBBP8, are also possibly associated with BAVMs (Alg et al., 2013; Kremer et al., 2015). Moreover, associated genes including IL6, MMP, and APOE were identified in both IAs and BAVMs (Fontanella et al., 2012; Huai et al., 2013; Sturiale et al., 2013). In the previous study, we had found that gender modulated the interaction between nitric oxide synthase 1 adaptor (NOS1AP) promoter DNA methylation in IA and BAVM patients. And the results also confirmed that regular tobacco smoking could increase NOS1AP methylation in humans (Wang et al., 2016). To our knowledge, this study is the first to report the correlation between DNA methylation of the PDGFD promoter and the risk of developing either BAVM or IA.

The disulfide-linked homodimer, PDGFD, is activated by proteolysis and becomes a specific agonist for PDGF-beta-receptor (Bergsten et al., 2001). This binding specificity suggested that the PDGFD could be important for the development and pathophysiology of several organs. The PDGFD gene is predominantly expressed in fibroblastic adventitial cells and is active in cultured endothelial cells (Uutela et al., 2001). PDGFD secreted by glioma cells is capable of promoting the migration of stem cells toward glioma cells (Gondi et al., 2010). A PDGFD variation was found to be significantly correlated with a higher risk of developing cardiovascular and cerebrovascular disease (Han et al., 2008; Zhou et al., 2012). Homocysteine is an independent risk factor for vascular diseases. Han et al.'s (2014) study suggested that aberrant DNA methylation of the PDGF gene in homocysteine could mediate vascular smooth muscle cell proliferation in atherosclerosis. The only available research on DNA methylation of the PDGFD gene promoter suggested a correlation with cumulative arsenic exposure in patients with urothelial carcinomas, results that were derived from genome-wide DNA methylation profiles (Yang et al., 2014). In this study, we found that the plasma PDGFD levels in IA and BAVM were significantly lower than those in the control group. Both IA and BAVM patients had significantly higher DNA methylation levels of the PDGFD gene promoter than the control group. CpG1 methylation of the PDGFD gene promoter was significantly correlated with the risk of developing BAVM, in both male and female patients. However, a similar correlation was only found in male IA patients. Therefore, there may be interplay between DNA methylation of the PDGFD gene promoter and gender in IA. This significant correlation could provide new information regarding epigenetic regulation of the PDGFD gene promoter in both BAVM and IA.

On analysis of clinical data, CK-MB, a biomarker for detecting myocardial injury (Ozdemir et al., 2011), caught our attention. Increased CK-MB levels often indicate acute myocardial infarction (Jaruvongvanich et al., 2015) and cerebrovascular disease (Manea et al., 2015). The cerebral trauma control group had higher CK-MB levels than IA and BAVM patients, which may have been caused by an acute craniocerebral trauma in the recent past. Analysis of clinical data and DNA methylation of the PDGFD gene promoter showed a negative correlation between CK-MB and CpG1 methylation levels in all participants. APOE is a major cholesterol carrier that plays an important role in maintaining lipid homeostasis in both the periphery and the brain (Zhong et al., 2016). HDL is a biomarker in various arterial diseases, including cardiovascular (Cho et al., 2016) and cerebrovascular events (Dong et al., 2015). APOE and HDL were recognized for their importance in lipoprotein metabolism and cerebrovascular disease. Recent studies demonstrated that the HDL particle profile is associated with DNA methylation of the ABCA1 gene promoter in coronary heart disease (Guay et al., 2012). The plasma APOE level was positively correlated with the gene promoter DNA methylation (Marioni et al., 2015). Summarizing, our results showed that CpG1 methylation of the PDGFD gene promoter has a significant correlation with APOE in IA patients. This observation can possibly be explained by the interaction between epigenetic and clinical data.

There are some limitations of our results that have to be examined with caution. First, we explored only a portion of the CGI; seven CpGs were selected for analysis and no correlation was found between them. Therefore, our findings involving CpG1 may not represent all the CGIs of the PDGFD promoter gene. Second, the small sample size is also a limitation. Our findings need to be validated in a larger number of samples and in other ethnic populations. Finally, we cannot exclude the possibility that variations in administered drugs and diets could affect our findings regarding the DNA methylation levels of the PDGFD gene promoter. Our results have not been adjusted by multiple factors, including hypertension, smoking habits, and diabetes, all of which can influence DNA methylation in subjects.

In conclusion, our study has proved that there are significant correlations between DNA methylation levels of the PDGFD gene promoter and the risk for developing IAs and BAVMs. In addition, CpG1 methylation of the PDGFD gene promoter shows a significant correlation with APOE in IAs. Further functional studies about these relationships and correlations are warranted.

Footnotes

Acknowledgments

This study was supported by grants from the Ningbo People of Science and Technology Projects (2015C50005), Ningbo Natural Science Foundation (2015A610232 and 2016A610154), Zhejiang Traditional Chinese Medicine Science and Technology Projects (2015ZB100), Ningbo Youth and Doctor Foundation, Ningbo High Level Innovative Talents Program, the National Key Research and Development Plan (2016YFC0106106), and Zhejiang Provincial Natural Science Foundation of China (LQ17H090002).

Disclosure Statement

The authors declare no conflict of interest.

References

Alehagen

, Olsen

R.S.

, Lanne

, Matussek

, and Wagsater

(2016). PDGF-D gene polymorphism is associated with increased cardiovascular mortality in elderly men. BMC Med Genet, 17, 62.

Alg

V.S.

, Sofat

, Houlden

, and Werring

D.J.

(2013). Genetic risk factors for intracranial aneurysms: a meta-analysis in more than 116,000 individuals. Neurology, 80, 2154–2165.

Arngrim

, Schytz

H.W.

, Britze

, Amin

F.M.

, Vestergaard

M.B.

, Hougaard

, et al. (2016). Migraine induced by hypoxia: an MRI spectroscopy and angiography study. Brain, 139, 723–737.

Bendjilali

, Nelson

, Weinsheimer

, Sidney

, Zaroff

J.G.

, Hetts

S.W.

, et al. (2014). Common variants on 9p21.3 are associated with brain arteriovenous malformations with accompanying arterial aneurysms. J Neurol Neurosurg Psychiatry, 85, 1280–1283.

Bergsten

, Uutela

, Li

, Pietras

, Ostman

, Heldin

C.H.

, et al. (2001). PDGF-D is a specific, protease-activated ligand for the PDGF beta-receptor. Nat Cell Biol, 3, 512–516.

Braksick

S.A.

, and Fugate

J.E.

(2015). Management of brain arteriovenous malformations. Curr Treat Options Neurol, 17, 358.

Caranci

, Briganti

, Cirillo

, Leonardi

, and Muto

(2013). Epidemiology and genetics of intracranial aneurysms. Eur J Radiol, 82, 1598–1605.

Chen

, Peng

, Huang

, Zhao

, Li

, Yin

, et al. (2016). Genome-wide profiling of DNA methylation and gene expression in esophageal squamous cell carcinoma. Oncotarget, 7, 4507–4521.

Chen

, Han

, Lin

, Zhen

, Song

, Teng

, et al. (2005). PDGF-D contributes to neointimal hyperplasia in rat model of vessel injury. Biochem Biophys Res Commun, 329, 976–983.

10.

Cho

S.W.

, Kim

B.G.

, Kim

B.O.

, Byun

Y.S.

, Goh

C.W.

, Rhee

K.J.

, et al. (2016). Hemorheological and Glycemic Parameters and HDL Cholesterol for the Prediction of Cardiovascular Events. Arq Bras Cardiol, 106, 56–61.

11.

Dechamethakun

, Ikeda

, Arai

, Sato

, Sawabe

, and Muramatsu

(2014). Associations between the CDKN2A/B, ADTRP and PDGFD polymorphisms and the development of coronary atherosclerosis in Japanese patients. J Atheroscler Thromb, 21, 680–690.

12.

Dong

, Hou

, Xu

, Yuan

, Li

, Zheng

, et al. (2015). Analyzing the Correlation between the Level of Serum Markers and Ischemic Cerebral Vascular Disease by Multiple Parameters. Comput Math Methods Med, 2015, 972851.

13.

Ecker

R.D.

(2016). Epistemology of Brain Arteriovenous Malformations. World Neurosurg, 89, 697–698.

14.

Fontanella

, Rubino

, Crobeddu

, Gallone

, Gentile

, Garbossa

, et al. (2012). Brain arteriovenous malformations are associated with interleukin-1 cluster gene polymorphisms. Neurosurgery, 70, 12–17.

15.

Foroud

, Koller

D.L.

, Lai

, Sauerbeck

, Anderson

, Ko

, et al. (2012). Genome-wide association study of intracranial aneurysms confirms role of Anril and SOX17 in disease risk. Stroke, 43, 2846–2852.

16.

Gladh

, Folestad

E.B.

, Muhl

, Ehnman

, Tannenberg

, Lawrence

A.L.

, et al. (2016). Mice Lacking Platelet-Derived Growth Factor D Display a Mild Vascular Phenotype. PLoS One, 11, e0152276.

17.

Gondi

C.S.

, Veeravalli

K.K.

, Gorantla

, Dinh

D.H.

, Fassett

, Klopfenstein

J.D.

, et al. (2010). Human umbilical cord blood stem cells show PDGF-D-dependent glioma cell tropism in vitro and in vivo. Neuro Oncol, 12, 453–465.

18.

Guay

S.P.

, Brisson

, Munger

, Lamarche

, Gaudet

, and Bouchard

(2012). ABCA1 gene promoter DNA methylation is associated with HDL particle profile and coronary artery disease in familial hypercholesterolemia. Epigenetics, 7, 464–472.

19.

Han

S.H.

, Liu

J.P.

, Tan

, Peng

, Zhang

R.L.

, Gao

S.T.

, et al. (2008). Association of platelet-derived growth factor-D gene polymorphism with ischemic stroke in a Chinese case-control study. Blood Coagul Fibrinolysis, 19, 415–419.

20.

Han

X.B.

, Zhang

H.P.

, Cao

C.J.

, Wang

Y.H.

, Tian

, Yang

X.L.

, et al. (2014). Aberrant DNA methylation of the PDGF gene in homocysteinemediated VSMC proliferation and its underlying mechanism. Mol Med Rep, 10, 947–954.

21.

Huai

, Song

, Ma

, Qin

, Li

, Chen

, et al. (2013). Allelic variation of the MMP3 promoter affects transcription activity through the transcription factor C-MYB in human brain arteriovenous malformations. PLoS One, 8, e57958.

22.

Huang

, Nie

, Zhou

, Li

, Sun

, Zhao

, et al. (2015). PPARD rs2016520 polymorphism and circulating lipid levels connect with brain diseases in Han Chinese and suggest sex-dependent effects. Biomed Pharmacother, 70, 7–11.

23.

Jaruvongvanich

, Rattanadech

, Damkerngsuntorn

, Jaruvongvanich

, and Vorasettakarnkij

(2015). CK-MB Activity, Any Additional Benefit to Negative Troponin in Evaluating Patients with Suspected Acute Myocardial Infarction in the Emergency Department. J Med Assoc Thai, 98, 935–941.

24.

Jiang

, Zheng

, Wang

, Huang

, Liu

, Xu

, et al. (2013). Elevated PLA2G7 gene promoter methylation as a gender-specific marker of aging increases the risk of coronary heart disease in females. PLoS One, 8, e59752.

25.

Kremer

P.H.

, Koeleman

B.P.

, Pawlikowska

, Weinsheimer

, Bendjilali

, Sidney

, et al. (2015). Evaluation of genetic risk loci for intracranial aneurysms in sporadic arteriovenous malformations of the brain. J Neurol Neurosurg Psychiatry, 86, 524–529.

26.

Manea

M.M.

, Comsa

, Minca

, Dragos

, and Popa

(2015). Brain-heart axis—Review Article. J Med Life, 8, 266–271.

27.

Marioni

R.E.

, Shah

, McRae

A.F.

, Chen

B.H.

, Colicino

, Harris

S.E.

, et al. (2015). DNA methylation age of blood predicts all-cause mortality in later life. Genome Biol, 16, 25.

28.

Mendizabal

, and Yi

S.V.

(2016). Whole-genome bisulfite sequencing maps from multiple human tissues reveal novel CpG islands associated with tissue-specific regulation. Hum Mol Genet, 25, 69–82.

29.

Moarii

, Boeva

, Vert

J.P.

, and Reyal

(2015). Changes in correlation between promoter methylation and gene expression in cancer. BMC Genomics, 16, 873.

30.

Mohan

, Munteanu

, Coman

, and Ciurea

A.V.

(2015). Genetic factors involves in intracranial aneurysms—actualities. J Med Life, 8, 336–341.

31.

Mouchtouris

, Jabbour

P.M.

, Starke

R.M.

, Hasan

D.M.

, Zanaty

, Theofanis

, et al. (2015). Biology of cerebral arteriovenous malformations with a focus on inflammation. J Cereb Blood Flow Metab, 35, 167–175.

32.

Ozdemir

, Elonu

O.H.

, and Gocmen

A.Y.

(2011). Heart type fatty acid binding protein is more sensitive than troponin I and creatine kinase myocardial band at early stage in determining myocardial injury caused by percutaneous coronary intervention. Int Heart J, 52, 143–145.

33.

Ruigrok

Y.M.

, and Rinkel

G.J.

(2008). Genetics of intracranial aneurysms. Stroke, 39, 1049–1055.

34.

Sturiale

C.L.

, Fontanella

M.M.

, Gatto

, Puca

, Giarretta

, D'Arrigo

, et al. (2014). Association between polymorphisms rs1333040 and rs7865618 of chromosome 9p21 and sporadic brain arteriovenous malformations. Cerebrovasc Dis, 37, 290–295.

35.

Sturiale

C.L.

, Puca

, Sebastiani

, Gatto

, Albanese

, Di Rocco

, et al. (2013). Single nucleotide polymorphisms associated with sporadic brain arteriovenous malformations: where do we stand?. Brain, 136, 665–681.

36.

Uutela

, Lauren

, Bergsten

, Li

, Horelli-Kuitunen

, Eriksson

, et al. (2001). Chromosomal location, exon structure, and vascular expression patterns of the human PDGFC and PDGFD genes. Circulation, 103, 2242–2247.

37.

Wang

, Zhao

, Sun

, Nie

, Li

, Gao

, et al. (2016). Sex-dichotomous effects of NOS1AP promoter DNA methylation on intracranial aneurysm and brain arteriovenous malformation. Neurosci Lett, 621, 47–53.

38.

Yan

, Hitomi

, Takenaka

, Kato

, Kobayashi

, Okuda

, et al. (2015). Genetic study of intracranial aneurysms. Stroke, 46, 620–626.

39.

Yang

, Manaenko

, Xu

, Miao

, Wang

, Hu

, et al. (2016). Role of PDGF-D and PDGFR-beta in neuroinflammation in experimental ICH mice model. Exp Neurol, 283, 157–164.

40.

Yang

T.Y.

, Hsu

L.I.

, Chiu

A.W.

, Pu

Y.S.

, Wang

S.H.

, Liao

Y.T.

, et al. (2014). Comparison of genome-wide DNA methylation in urothelial carcinomas of patients with and without arsenic exposure. Environ Res, 128, 57–63.

41.

Yasuno

, Bilguvar

, Bijlenga

, Low

S.K.

, Krischek

, Auburger

, et al. (2010). Genome-wide association study of intracranial aneurysm identifies three new risk loci. Nat Genet, 42, 420–425.

42.

Zhong

, Xie

Y.Z.

, Cao

T.T.

, Wang

, Li

, et al. (2016). A rapid and cost-effective method for genotyping apolipoprotein E gene polymorphism. Mol Neurodegener, 11, 2.

43.

Zhou

, Huang

R.S.

, Wang

, Xu

, Le

, et al. (2012). A case-control study provides evidence of association for a common SNP rs974819 in PDGFD to coronary heart disease and suggests a sex-dependent effect. Thromb Res, 130, 602–606.