Transcription Factor TBX18 Reprograms Vascular Smooth Muscle Cells of Ascending Aorta to Pacemaker-Like Cells

Abstract

Vascular smooth muscle cells (VSMCs) of ascending aorta and TBX18 ⁺ sinus node both originated from the second heart field. The study explored whether ascending aortic smooth muscle cells in vitro could be reprogrammed into pacemaker-like cells with human TBX18. In the study, VSMCs were infected with TBX18, and then cocultured with neonatal rat ventricular cardiomyocytes (NRVMs) in vitro. By overexpressing TBX18, the transfected VSMCs expressed high levels of hyperpolarization-activated cyclic nucleotide-gated channel 4 (HCN4), insulin gene enhancer binding protein 1, and human dwarf homeobox gene SHOX2, cardiac troponin I, and low level of connexin 43. In addition, funny current (I_f) was recorded by patch clamp appeared the time and voltage dependence in TBX18 group, which the amplitude of I_f density was from −5.164 ± 0.662 pA/pF to −0.765 ± 0.358 pA/pF (n = 14). Furthermore, TBX18-transfected VSMCs coupled with NRVMs showed typical action potential of pacemaker-like cells and the beating rate was faster (178.00 ± 7.55 bpm, p < 0.05) compared with other groups. In conclusion, our study indicated that transcription factor TBX18 could reprogram VSMCs into pacemaker-like cells in vitro.

Introduction

Bradycardiac arrhythmias in cardiovascular diseases, including sick sinus syndrome, sinus arrest, and atrioventricular block, could cause syncope and circulatory collapse. Current therapies for bradyarrhythmia rely on electronic pacemaker implantation. However, there are a lot of drawbacks about electronic devices, such as limited battery lifetime, lack of autonomic responsiveness, susceptible infection, and so on (Munshi and Olson, 2014; Boink et al., 2015). To replace electronic pacemakers, a biological pacemaker could be considered a better treatment theoretically. A biological pacemaker could provide a new physiological pacemaker by gene therapy and cell therapy, respond to human physiological changes, and be suitable for human growth environment. These points provide strong rationale for creating a biological pacemaker.

Sinoatrial node (SAN) comprised <1000 pacemaker cells and other mesenchymal cells, which can produce native impulses that cause cardiac contraction. Embryonic development of SAN is regulated by a variety of transcription factors and signaling systems. Transcription factor TBX18 is a member of the TBX subfamily of the T-box family, which is involved in the formation and development of sinus node head. Furthermore, TBX18 plays a key role in regulating the sinus node-specific markers, such as hyperpolarization-activated cyclic nucleotide-gated channel 4 (HCN4), insulin gene enhancer binding protein 1 (ISL1), human dwarf homeobox Gene SHOX2, connexin 43 (Cx43), and so on (Blaschke et al., 2007; Wiese et al., 2009). Recently, reprogramming neonatal rat ventricular cardiomyocytes (NRVMs) with TBX18 has been carried out in vitro and in vivo, and the results demonstrated the effectiveness and feasibility for creating a biological pacemaker (Kapoor et al., 2013). Studies (Sun et al., 2007; Sawada et al., 2017) have showed that VSMCs of ascending aorta and sinus node originate from a common cardiac progenitor. In this study, we explored whether VSMCs of the ascending aorta could be reprogrammed into pacemaker-like cells by human transcription factor TBX18 in vitro.

Materials and Methods

Culture of ascending aortic smooth muscle cells and NRVMs

All experimental procedures and animals conformed to the Institutional Guidelines for the Care and Use of Laboratory Animals at Wuhan University. This study was approved by the Experimental Animal Committee of Wuhan University (Hubei, China; no. WDRM20180802). After intraperitoneal injection of anesthetized rats (2% pentobarbital sodium), the male SD rat (Wuhan University Animal Testing Center), about 150–200 g, was exposed to the chest and abdomen. After the heart and aorta were fully exposed, the ascending tissue was cut along both ends and placed in fresh DMEM-F12 medium. After cleaning the intima and adventitia of aorta, the blood vessel was cut into pieces of 1 × 1 mm sizes and attached to a clean 25 cm² culture dish. After 40 min, 20% serum medium was slowly added to the culture dish and incubated in a 37°C incubator. After 5 days, spindle cells were observed around the tissue pieces under an inverted microscope, which are the original vascular smooth muscle cells (VSMCs). Once the cells reached 80–90% fusion, adherent cells were passaged. VSMCs were identified by immunofluorescence using mouse anti-SMα-actin (α-SMA) (cat. no. BM002; Boster, Wuhan, China) and anti-smooth muscle myosin heavy chain 11 (MHC) antibodies (Cat. no. ab683; Abcam, Cambridge, MA). The passaged VSMCs were cultured into a six-well plate in a 5% CO₂ incubator at 37°C for 48 h. After being fixed for 30 min with 4% polyaddition, PBS solution containing 0.1% Triton X-100 was added and placed in a room at 4°C for 10 min. And the plate was incubated with PBS containing 4% BSA for 30 min at 37°C. Finally, primary antibody was added in the plate overnight, CY-3 labeled secondary antibody was added for 30 min the next day, and stained with 4′,6-diamidino-2-phenylindole (DAPI) 1 μg/mL for 5 min. Also, under the fluorescence microscope, the ratio of positive stained cells was calculated.

NRVMs were cultured according to a previous study (Choi et al., 2010). Briefly, NRVMs were isolated from 1- to 3-day SD rats (Wuhan University Animal Testing Center) and were digested with 0.125% trypsin (Beyotime Institute of Biotechnology, Shanghai, China) at 37°C for 10 min. The tissue was repeatedly digested with a mixture that included 0.125% trypsin and 0.08% collagenase II (Sigma). When this digestive process ended, the single NRVMs were harvested by anchorage dependence and cultured in six-well plates with fresh DMEM/F-12 containing 15% FBS and 1% penicillin/streptomycin.

Construction of human TBX18 adenoviral vector

The adenoviral backbone vector pHBAd-MCMV-GFP (Shanghai Hanheng Biotechnology Co., Ltd., Shanghai, China) was digested with BamH I and Not I, and the ORF sequence of TBX18 was amplified by PCR. The recombinant fragment was ligated to the vector to obtain recombinant adenovirus plasmid pHBAd-MCMV-GFP-TBX18. The pHBAd-MCMV-GFP-TBX18 was transformed into a DH5a competent strain, and the transformed TBX18 plate was picked. The plasmid was extracted and identified by restriction enzyme digestion, and amplified with 293 cells until a large amount of purified TBX18 adenovirus vector was obtained.

Infection with hTBX18 for VSMCs and NRVMs

When the passaged VSMCs in 24-well plates were fused to 50–70%, the adenovirus carrying the TBX18 gene was added at different multiplicity of infection (MOI) values (MOI = 0, 20, 30, 40, 60, and 80) in DMEM/F-12. Then, the plate was cultured in a CO₂ incubator at 37°C for 4–6 h and clean 10% serum medium was added after washing thrice with 4°C PBS. The VSMCs were observed by fluorescence microscopy (Olympus, Japan) at 24, 48, and 72 h after infection, and the transfection rate of VSMCs was detected by flow cytometric analysis. Finally, the optimal MOI was selected. And the same way that ascertained the optimal MOI of NRVMs was conducted.

VSMCs were randomly divided into TBX18 group, GFP group, and Null group, NRVMs into TBX18 group and GFP group. According to the optimal MOI, VSMCs and NRVMs were transfected with TBX18 adenovirus and GFP adenovirus, respectively. When the cells were incubated in 37°C, 5% CO₂ incubator for 4–6 h, the suspension was replaced with the fresh medium containing 10% fetal serum. Then, the cells were continued to culture in 37°C, 5% CO₂ incubator for 4–5 days. Finally, VSMCs and NRVMs transfected with Ad-GFP and Ad-TBX18 were analyzed using the Flow cytometer. The detection was conducted at least thrice.

Real-time quantitative PCR

Quantitative PCR was performed to detect the mRNA expression of the cardiac-specific genes. When the cells were transfected for 4–5 days, total RNA was extracted from Null group, GFP group, and TBX18 group. The first-strand cDNA was Synthesized by PrimeScript™RT reagent Kit with gDNA Eraser (TaKaRa company) and the primers by Invitrogen Biotechnology (Shanghai, China). RT-qPCR was finished using the StepOne™ Real-Time PCR system (Life Technologies, Carlsbad, CA). Also, the results of RT-qPCR were compared with the way of the 2^−ΔΔCT and analyzed with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) used as a reference gene. All primers and reaction conditions are shown in Table 1. In addition, at the 3th, 4th, 5th, 7th, 10th, and 14th day, the sinus node-specific genes (TBX18, HCN4, and SHOX2) were detected by PCR in GFP group and TBX18 group, respectively, which tested the time of continuous expression for relative genes by adenovirus transfection. Finally, the results were repeated at least three times.

Table 1.

Polymerase Chain Reaction Primers Used in This Study

Gene	Primers (5′-3′)		Tm	CG%	Product size(bp)
R-GAPDH	Forward	CGCTAACATCAAATGGGGTG	58.8	50	201
R-GAPDH	Reverse	TTGCTGACAATCTTGAGGGAG	57.7	47.6	201
R-HCN4	Forward	CACTAAGGGCAACAAGGAGACC	60.5	54.5	281
R-HCN4	Reverse	GGTAGTTGAAGACGCCTGAGTTG	60.8	52.2	281
R-cTNI	Forward	TTGGATGGGCTGGGCTT	59	58.8	286
R-cTNI	Reverse	CCTCCTTCTTCACCTGCTTGA	59.4	52.4	286
R-ISL-1	Forward	TGCGGAGTGTAATCAGTATTTGG	59.8	43.5	136
R-ISL-1	Reverse	TGCGGAGTGTAATCAGTATTTGG	59.5	50	136
R-SHOX2	Forward	AGGTGTCCCCTGAACTGAAGG	60.3	57.1	121
R-SHOX2	Reverse	AGCTCGTTGAGTTGTTCCAGG	59.4	52.4	121
H-TBX18	Forward	ACGTCATCCGTAAAGACTGTGG	59.2	50	251
H-TBX18	Reverse	AGTCCGTAGTGATGGTCGCC	59.6	60	251
R-Cx43	Forward	GCTGGTGGTGTCCTTGGTGT	60.1	60	213
R-Cx43	Reverse	GGAGGAGACATAGGCGAGAGTG	60.5	59.1	213

Western blot

After 4–5 days of TBX18 transfection, the total protein was extracted with RIPA lysis buffer (Cat. no. AS1004; Aspen Biological, Wuhan, China). The protein concentration was detected using a BCA Protein Concentration Assay Kit (cat. no. AS1086, Aspen Biological). The protein loading of each sample was 40 μg onto a gel for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; Cat. no. AS1012, Aspen Biological). When separated, the proteins were transferred to a nitrocellulose membrane, and then incubated with the primary antibody against TBX18 (Cat. no. ab115262; Abcam), HCN4 (Cat. no. ab32675; Abcam), SHOX2 (Cat. no. ab55740; Abcam), Cx43 (Cat. no. ab11370; Abcam), cardiac troponin I (cTNI, Cat. no. ab47003; Abcam), and ISL1 (Cat. no. abs132916; Absin Bioscience, Inc., Shanghai, China) overnight at 4°C. Also, HRP secondary antibody (Cat. no. AS1107 and AS1093; Aspen Biological) was added at room temperature for 30 min. Finally, chemiluminescence detection (ECL; Beyotime Institute of Biotechnology) was performed and repeated thrice, and then the data with GAPDH as an internal reference were analyzed.

Immunofluorescence

The cells transfected with TBX18 and GFP adenovirus, respectively, for 4–5 days were washed with 4°C PBS and fixed with 4% paraformaldehyde (Cat. no. AS1018; Aspen Biological) for 20 min at room temperature. Then, the cells were incubated with the primary antibody anti-HCN4 (Cat. no. ab32675; Abcam) overnight at 4°C and with CY3, the labeled goat anti-rat secondary antibody (Cat. no. BA1034; Boster, Wuhan, China), for 60 min at room temperature. Nuclei were stained with DAPI for 5 min. The fluorescent images were observed with a fluorescence microscope (Leica Microsystems GmbH, Solms, Germany). Images were selected randomly of three visual fields in three samples to observe the positive rates of HCN4 expression.

Co-culture of NRVMs and transfected VSMCs

When transfected with TBX18 and GFP for 4 days, VSMCs above three groups were added into the six-well plates with NRVMs at a ratio of 1:8, respectively, for co-culture conditions. Finally, there were four groups, TBX18-transfected VSMCs and NRVMs (TBX18 group), GFP-transfected VSMCs and NRVMs (GFP group), none-transfected VSMCs and NRVMs (Null group), and only NRVMs group. And gap junction protein was detected by immunofluorescence when cell clusters were formed between transfected VSMCs and NRVMs. The beating rate was observed after 1, 3, and 5 days, respectively. Finally, the co-culture experiment was performed thrice to validate the results.

Electrophysiological recordings

After being co-cultured with NRVMs for 4 days, the electrophysiological characterization of transfected VSMCs with green fluorescence was detected by patch-clamp technique with an Axon patch-clamp amplifier 700B (Molecular Devices LLC, Sunnyvale, CA). A digital 700AD/DA converter and 6.0.4 patch clamp (both Axon Instruments, Union City, CA) were used for recording and analyzing the data. The funny current (I_f) and action potential (AP) were recorded with following extracellular fluid (mM): NaCl 135, KCl 5.4, CaCl₂ 1.8, MgCl₂ 1.0, glucose 10, Bacl₂ 2.0, and HEPES 5.5 (pH 7.35) with NaOH, and pipette solution contained (mM) the following: K⁺-ATP 110, KCl 20, CaCl₂ 5.0, MgCl₂ 5.0, HEPES 10, and EGTA 10 (pH 7.3) with KOH. The impedance of fluid-filled electrode was 7–10 MΩ. Using the whole-cell clamp-recorded I_f current, the Clampex program was applied to the sample. The sampling frequency was 10 kHz, and the filtering rate was 5 kHz. The voltage of recording mode of I_f current started from −30 mV and decreased to −130 mV with each sweep 10 mV, and holding potential was set at −40 mV. Then, I_f current and the change of I_f current were observed when CsCl (4 mM) was added. Also, APs were recorded by current clamp.

Statistical analysis

Data are expressed as mean ± standard error of the mean (SEM). Statistical comparisons among multiple groups were estimated by one-way analysis of variance with SPSS 21.0 software (IBM Corp., Armonk, NY). p < 0.05 was considered statistically significant.

Results

Culture of VSMCs and NRVMs

Primary VSMCs were observed around the tissue block on about the 5th day. These cells that had a triangular or long spindle shape were mountain-like growth under a microscope when they were cultured for 8 days (Fig. 1A). When they reached 80%-90%, the cells could be passaged. The cells adhered for 24 h and grew rapidly. And the 3–5th generation cells were used for experiments. According to the results of α-SMA and MHC immunofluorescence, VSMCs showed red fluorescence and nuclear staining blue fluorescence, respectively (Fig. 1B, C). After the third generation, VSMCs accounted for above 90% of the total number of cells. After being cultured for 48 h, NRVMs began to beat and were triangular under a light microscope (Fig. 1D).

FIG. 1.

Morphology of VSMCs and NRVMs, and transfection efficiency by different MOI values. (A) Primary VSMCs observed under a light microscope. (magnification, × 200) (B) VSMCs labeled with anti-α-SMA antibody. (magnification, × 200) (C) VSMCs labeled with anti-MHC antibody. (magnification, × 200) (D) Morphology of NRVMs in 48 h. (magnification, × 200) (E) Transfection rate of VSMCs at different MOI values. (F) Transfected after 48 h, VSMCs were observed under a fluorescence microscope at different MOI values. (magnification, × 100) (G) Transfection efficiency of VSMCs was detected by flow cytometric analysis. (H) Transfection rate of NRVMs at different MOI values. MOI, multiplicity of infection; VSMC, vascular smooth muscle cells; NRVM, neonatal rat ventricular cardiomyocytes.

The optimal MOI and transfection efficiency

VSMCs transfected for 24 h were observed under a fluorescence microscope and detected by flow cytometry. Detected by the flow cytometric analysis, the transfection efficiency was 73.33 ± 6.543 at MOI = 20 and was >80% at MOI ≥30 (Fig. 1E). According to the fluorescence intensity and the death and floating of transfected cells, MOI = 30 was selected as the optimal MOI for VSMCs (Fig. 1F, G). An MOI = 10 was determined for NRVMs according to the above method (Fig. 1H).

Flow cytometric analysis of positive cells of HCN4

The percentage of HCN4-positive cells was detected by flow cytometry, in which VSMCs and NRVMs were transfected with Ad-TBX18 and Ad-GFP, respectively (Fig. 2A). The positive cells for HCN4 of Ad-TBX18-VSMCs were 23.233% ± 1.739% higher compared with Ad-GFP -VSMCs (4.300 ± 1.058; p < 0.05; Fig. 2B). The positive cells for HCN4 of Ad-GFP-NRVMs were 5.267% ± 0.702%, which were lower compared with Ad-TBX18-NRVMs (25.800% ± 3.466%; p < 0.05; Fig. 2B). In addition, there was no significant difference between Ad-TBX18-VSMCs and Ad-TBX18-NRVMs (p > 0.05; Fig. 2B).

FIG. 2.

Comparison of positive cells of HCN4 by flow cytometry for VSMCs and NRVMs transfected with Ad-TBX18 and Ad-GFP, respectively. (A) The detection of positive cells of HCN4 by flow cytometry for Ad-GFP-VSMCs, Ad-GFP-NRVMs, Ad-TBX18-VSMCs, Ad-TBX18-NRVMs, and blank group. (B) The percentage of HCN4-positive cells above five groups (n = 3). *p < 0.05, Ad-GFP-VSMCs versus Ad-TBX18-VSMCs; ^#p < 0.05, Ad-GFP-NRVMs versus Ad-TBX18-NRVMs; ns, not significant difference; HCN4, hyperpolarization-activated cyclic nucleotide-gated channel 4; GFP, green fluorescent protein; Ad, adenovirus.

Expression of correlative mRNA

The TBX18 mRNA was verified by RT-qPCR (Fig. 3A), and the results of RT-qPCR indicated that the mRNA expression levels of HCN4, ISL1, SHOX2, and cTNI were significantly higher in the TBX18 group than in GFP group and Null group (p < 0.05, Fig. 3B). In turn, the expression level of Cx43 mRNA was distinctly lower in the TBX18 group compared with the GFP group (p < 0.05; Fig. 3B). And the statistical analysis revealed that no significant differences were found between the GFP and Null groups. Furthermore, after being transfected for 3, 4, 5, 7, 10, and 14 days, the mRNA expression levels, such as TBX18, HCN4, and SHOX2, showed a peak on the 3th–5th day, which decreased sharply down from the 7th day (Fig. 3C, D).

FIG. 3.

The mRNA and protein expression levels of associated transcription factors by RT-qPCR and WB. (n = 3) (A) Transfected VSMCs were verified by the expression of TBX18 mRNA in the TBX18 group. (B) The expression levels of mRNA related with biological pacemaker were detected by RT-qPCR. (C) The mRNA expression changes of TBX18 after transfection for 3, 4, 5, 7, 10, and 14 days. (D) The mRNA expression changes of HCN4 and SHOX2 after transfection for 3, 4, 5, 7, 10, and 14 days. (E) Expression of relative proteins was examined by Western blot. GAPDH as the protein control. (F) Quantitative measurements of HCN4, ISL1, SHOX2, cTNI, TBX18, and Cx43 protein levels. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.001; TBX18 group versus GFP group, TBX18 group versus Null group. ISL1, insulin gene enhancer binding protein 1; SHOX2, human dwarf homeobox Gene SHOX2; cTNI, cardiac troponin I; Cx43, connexin 43; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; d, day.

Expression of relevant proteins

According to the results of Western Blot, the protein expression levels of HCN4, ISL1, SHOX2, and cTNI were upregulated clearly in the TBX18 group compared with the GFP group (p < 0.05, Fig. 3E, F; Supplementary Figure S1); in contrast with the GFP group, the expression of Cx43 protein was reduced in the TBX18 group (p < 0.05, Fig. 3E, F; Supplementary Figure S1). And there were no significant differences statistically between the GFP and Null groups.

Immunocytochemical analysis of HCN4 protein

When transduced for 4–5 days, VSMCs have possessed the characteristic of pacemaker-like cells. As is shown in Figure 4, the expression of HCN4 (red) was obvious in the TBX18 group cells, whereas it was hardly seen in the GFP group cells.

FIG. 4.

HCN4 protein immunofluorescence of transduced VSMCs. (magnification, × 200) (A) HCN4 and GFP expression were detected in the TBX18 group. Nuclei were stained with DAPI. (B) VSMCs transfected with pHBAd-MCMV-GFP only expressed GFP. DAPI, 4',6-diamidino-2-phenylindole.

Morphology and beating rate of co-cultured cells

For 2 days in co-culture conditions, the Ad-TBX18-transfected VSMCs proliferated decreasingly and the majority of VSMCs connected with NRVMs that formed cell clusters (black arrows, Fig. 5A). Every cluster produced synchronous beating after 3 days and the morphology of VSMCs coupled with NRVMs was spindly and quadrangular by fluorescence microscopy (red arrows, Fig. 5B). Immunofluorescence showed that Cx43 protein (red) was clearly detected at membranes of Ad-TBX18-transfected VSMCs (green) and NRVMs, which formed gap junctions between them (white arrows, Fig. 5C). TBX18-transfected VSMCs in co-culture systems had a higher beating rate compared with the GFP group, Null group, and NRVMs. The beating rate of the cells reached 178.00 ± 7.55 bpm (n = 3) in the TBX18 group, 154.00 ± 2.00 bpm (n = 3) in the GFP group, 154.33 ± 1.53 bpm (n = 3) in the Null group, and 147.67 ± 2.52 bpm (n = 3) in the alone NRVMs group after 3 days. And there were statistical differences between the TBX18 group and the other three groups (Fig. 5D).

FIG. 5.

The cell clusters and beating rate of cells in co-culture conditions. (A) The cell clusters (black arrows) contained TBX18-transfected VSMCs and NRVMs in co-culture conditions by a light microscope. (magnification, × 200) (B) Morphology of TBX18-transfected VSMCs (arrows) connected with NRVMs by a fluorescence microscope. (magnification, × 200) (C) By immunofluorescence indicates cell-cell contacts between VSMCs-TBX18 ⁺ and adjacent NRVMs. Note Cx43 signals of NRVMs, but also detectable at membranes of adjacent Ad-TBX18-reprogrammed VSMCs suggesting connexin-mediated coupling of cells (white arrows). Nuclei were stained with DAPI. (magnification, × 400) (D) Beating rate of co-cultured cells in 1, 3, and 5 days (n = 3, *p < 0.05). Cx43, connexin 43.

Electrophysiological characterization

I_f current was examined in a voltage-clamp mode. Spindle cells with whole cell and green fluorescence were used for electrophysiological analysis (Fig. 6A, B). The results of whole-cell patch clamp showed that I_f current was not recorded in the null group and the GFP group. However, I_f current recorded in TBX18 group was activated and appeared the time and voltage dependence (Fig. 6C, D). After adding 4 mM CsCl to the extracellular fluid, I_f current was blocked significantly (Fig. 6C). However, when the CsCl was cleaned with normal fluid, I_f current recovered rapidly. And the amplitude of current density ranged from −5.164 ± 0.662 pA/pF to −0.765 ± 0.358 pA/pF (n = 14) (Fig. 6D). When VSMCs were cocultured with NRVMs for 5 days, the APs of transfected VSMCs and NRVMs were recorded by c-clamp. It is evident that slow 4 phase depolarization rates and short AP durations were like pacemaker cells APs in VSMCs infected with TBX18 (Fig. 6E). However, the APs of GFP-VSMCs and NRVMs showed typical ventricular-like APs (Fig. 6E).

FIG. 6.

Electrophysiological recordings by patch clamp in co-culture systems for 5 days. (A) The pacemaker-like cell was selected for current recording. (magnification, × 400) (B) The selected cells with TBX18 and fluorescence. (magnification, × 400) (C) I_f current was recorded and was sensitive to Cs⁺ (4 mM) in the TBX18 group. (D) The average current density of I_f current and voltage correlation (n = 14). (E) Representative recordings of action potentials for VSMCs transfected with TBX18 and GFP and for alone NRVMs.

Discussion

This study showed that VSMCs of ascending aorta by overexpressing TBX18 could be reprogrammed into pacemaker-like cells in vitro. We present the following evidences: (1) The gene and protein expression levels of ISL1, SHOX2, HCN4, and cTNI were significantly upregulated and Cx43 expression was downregulated in TBX18-transfected VSMCs. (2) Electrophysiological studies showed that I_f current was presented and appeared the time and voltage dependence in TBX18-reprogrammed VSMCs in co-culture systems, which was sensitive to Cs⁺. The APs for VSMCs infected with TBX18 showed slow 4 phase depolarization, similar with that of SAN-like cells. And beating rate of the cells cocultured with NRVMs was much faster in the TBX18 group than other groups.

During cardiac embryonic development, the second heart field not only differentiates into the arterial pole (right ventricle and outflow tract) but also differentiates into the sinus node, endothelial cell lineages, and smooth muscle cells (Waldo et al., 2005; Kattman et al., 2006; Moretti et al., 2006; Bu et al., 2009; Andersen et al., 2018). Recently, Sawada et al. (Harmon and Nakano, 2013; Sawada et al., 2017) demonstrated that smooth muscle cells of the aortic root and ascending aorta were extended by the second heart field and cardiac neural crest. Furthermore, the second heart fields could differentiate into the pacemaker cells of SAN and atrioventricular node (Sun et al., 2007). Therefore, pacemaker cells and ascending aortic smooth muscle cells were both derived from the second heart field cells. Therefore, this study explored whether VSMCs of the ascending aorta could be reprogrammed into pacemaker-like cells by human transcription factor TBX18 in vitro.

Embryonic development of SAN is influenced by multiple transcription factors (Christoffels et al., 2010; Barbuti and Robinson, 2015). During specific differentiation of pacemaker cells, transcription factor TBX18 is the first gene to be expressed, and TBX18 was only expressed in the head region of sinus node in mature cardiomyocytes (Wiese et al., 2009). Cardiac troponins included troponin I (cTNI), troponin C (cTNC), and troponin T (cTNT) proteins, which were considered myocardial makers (Kociol et al., 2010). In this study, we found that cTNI was expressed in VSMCs of the ascending aorta after transfection with TBX18, indicating that the transfected cells have had the characteristics of cardiomyocytes. Transcription factor ISL1, SHOX2, and HCN4 were regarded as sinus node-specific markers, which were both regulated by TBX18. Previous studies (Blaschke et al., 2007; Barbuti and Robinson, 2015; Ye et al., 2015) demonstrated that SHOX2 could inhibit the expression of chamber gene NKX2.5 and activate transcription factor ISL1, which participate in the formation of SAN. And that ISL1 could also regulate sinus node development and interact with HCN4 (Liang et al., 2015; Vedantham et al., 2015). Previous studies (Liu et al., 2007; Brioschi et al., 2009; Wahl-Schott et al., 2014) demonstrated that HCN4 mainly distributed in SAN. In these results, we found that the mRNA and protein expression levels of ISL1, SHOX2, and HCN4 were significantly increased in the TBX18 group, indicating that the transfected cells had the phenotype of SAN-like cells. Furthermore, I_f current encoded by HCN4 channel was the basis of phase 4 automatic depolarization of pacemaker cells (Marionneau et al., 2005; Mommersteeg et al., 2007; DiFrancesco, 2010). And we indicated that the specific I_f current was detected in transfected cells by TBX18, further demonstrating that the transfected cells had the characteristics of SAN-like cells. Moreover, gap junction proteins mediated direct cardiomyocyte coupling (electrical and metabolic) that regulated heart homeostasis and function. And three main isoforms of connexin distributed in the heart: Cx40, Cx43, and Cx45. Cx43 is the most abundant connexin in working cardiomyocytes, which is fewer in SAN cells (Jansen et al., 2010). Our result showed that connexin 43 mRNA and protein were distinctly decreased in the TBX18 group, showing that the gap junction appeared to change between the reprogrammed VSMCs toward the SAN-like cells. In addition, the beating rate of TBX18-overexpressing VMSCs was faster compared with other groups in co-culture systems, and most importantly, the transfected cells by TBX18 exhibited sinoatrial-like APs, which do not appear in the remaining groups.

In conclusion, this study suggested that VSMCs of ascending aorta with TBX18 could be reprogrammed into pacemaker-like cells in vitro. However, there are still some limits in this experiment: (1) adenovirus functions a relatively short time and has high innate immunogenicity (Thaci et al., 2011; Merentie et al., 2016), so we need to find a carrier that works longer and safer in future studies; (2) The duration of these transduced pacemaker-like cells is not verified and tested in vivo. Therefore, more studies should be conducted to further verify the long-term efficacy in vitro and in vivo experiments of these transfected cells.

Footnotes

Acknowledgment

The authors are appreciative to Wuhan University School of Basic Medical Science for their assistance in conducting the experiments.

Disclosure Statement

The authors declare no conflict of interests.

Funding Information

This research was funded by the Fundamental Research Funds for the Central Universities of China (grant no. 2042015kf0229) and the Technical Innovation Project of Hu Bei Province of China (grant no. 2016ACA153).

Supplementary Material

Supplementary Figure S1.

References

Andersen

, Tampakakis

, Jimenez

D.V.

, Kannan

, Miyamoto

, Shin

H.K.

, et al. (2018). Precardiac organoids form two heart fields via Bmp/Wnt signaling. Nat Commun 9, 3140.

Barbuti

, and Robinson

R.B.

(2015). Stem cell-derived nodal-like cardiomyocytes as a novel pharmacologic tool: insights from sinoatrial node development and function. Pharmacol Rev, 67, 368–388.

Blaschke

R.J.

, Hahurij

N.D.

, Kuijper

, Just

, Wisse

L.J.

, Deissler

, et al. (2007). Targeted mutation reveals essential functions of the homeodomain transcription factor Shox2 in sinoatrial and pacemaking development. Circulation, 115, 1830–1838.

Boink

G.J.

, Christoffels

V.M.

, Robinson

R.B.

, and Tan

H.L.

(2015). The past, present, and future of pacemaker therapies. Trends Cardiovasc Med, 25, 661–673.

Brioschi

, Micheloni

, Tellez

J.O.

, Pisoni

, Longhi

, Moroni

, et al. (2009). Distribution of the pacemaker HCN4 channel mRNA and protein in the rabbit sinoatrial node. J Mol Cell Cardiol, 47, 221–227.

, Jiang

, Martin-Puig

, Caron

, Zhu

, Shao

, et al. (2009). Human ISL1 heart progenitors generate diverse multipotent cardiovascular cell lineages. Nature, 460, 113–117.

Choi

Y.S.

, Dusting

G.J.

, Stubbs

, Arunothayaraj

, Han

X.L.

, Collas

, et al. (2010). Differentiation of human adipose-derived stem cells into beating cardiomyocytes. J Cell Mol Med, 14, 878–889.

Christoffels

V.M.

, Smits

G.J.

, Kispert

, and Moorman

A.F.

(2010). Development of the pacemaker tissues of the heart. Circ Res, 106, 240–254.

DiFrancesco

(2010). The role of the funny current in pacemaker activity. Circ Res, 106, 434–446.

10.

Harmon

A.W.

, and Nakano

(2013). Nkx2-5 lineage tracing visualizes the distribution of second heart field-derived aortic smooth muscle. Genesis, 51, 862–869.

11.

Jansen

J.A.

, van Veen

T.A.

, de Bakker

J.M.

, and van Rijen

H.V.

(2010). Cardiac connexins and impulse propagation. J Mol Cell Cardiol, 48, 76–82.

12.

Kapoor

, Liang

, Marban

, and Cho

H.C.

(2013). Direct conversion of quiescent cardiomyocytes to pacemaker cells by expression of Tbx18. Nat Biotechnol, 31, 54–62.

13.

Kattman

S.J.

, Huber

T.L.

, and Keller

G.M.

(2006). Multipotent flk-1+ cardiovascular progenitor cells give rise to the cardiomyocyte, endothelial, and vascular smooth muscle lineages. Dev Cell, 11, 723–732.

14.

Kociol

R.D.

, Pang

P.S.

, Gheorghiade

, Fonarow

G.C.

, O'Connor

C.M.

, and Felker

G.M.

(2010). Troponin elevation in heart failure prevalence, mechanisms, and clinical implications. J Am Coll Cardiol, 56, 1071–1078.

15.

Liang

, Zhang

, Cattaneo

, Zhuang

, Gong

, Spann

N.J.

, et al. (2015). Transcription factor ISL1 is essential for pacemaker development and function. J Clin Invest, 125, 3256–3268.

16.

Liu

, Dobrzynski

, Yanni

, Boyett

M.R.

, and Lei

(2007). Organisation of the mouse sinoatrial node: structure and expression of HCN channels. Cardiovasc Res, 73, 729–738.

17.

Marionneau

, Couette

, Liu

, Li

, Mangoni

M.E.

, Nargeot

, et al. (2005). Specific pattern of ionic channel gene expression associated with pacemaker activity in the mouse heart. J Physiol, 562, 223–234.

18.

Merentie

, Lottonen-Raikaslehto

, Parviainen

, Huusko

, Pikkarainen

, Mendel

, et al. (2016). Efficacy and safety of myocardial gene transfer of adenovirus, adeno-associated virus and lentivirus vectors in the mouse heart. Gene Ther, 23, 296–305.

19.

Mommersteeg

M.T.

, Hoogaars

W.M.

, Prall

O.W.

, de Gier-de Vries

, Wiese

, Clout

D.E.

, et al. (2007). Molecular pathway for the localized formation of the sinoatrial node. Circ Res, 100, 354–362.

20.

Moretti

, Caron

, Nakano

, Lam

J.T.

, Bernshausen

, Chen

, et al. (2006). Multipotent embryonic isl1+ progenitor cells lead to cardiac, smooth muscle, and endothelial cell diversification. Cell, 127, 1151–1165.

21.

Munshi

N.V.

, and Olson

E.N.

(2014). Translational medicine. Improving cardiac rhythm with a biological pacemaker. Science, 345, 268–269.

22.

Sawada

, Rateri

D.L.

, Moorleghen

J.J.

, Majesky

M.W.

, and Daugherty

(2017). Smooth muscle cells derived from second heart field and cardiac neural crest reside in spatially distinct domains in the media of the ascending aorta-brief report. Arterioscler Thromb Vasc Biol, 37, 1722–1726.

23.

Sun

, Liang

, Najafi

, Cass

, Lin

, Cai

C.L.

, et al. (2007). Islet 1 is expressed in distinct cardiovascular lineages, including pacemaker and coronary vascular cells. Dev Biol, 304, 286–296.

24.

Thaci

, Ulasov

I.V.

, Wainwright

D.A.

, and Lesniak

M.S.

(2011). The challenge for gene therapy: innate immune response to adenoviruses. Oncotarget, 2, 113–121.

25.

Vedantham

, Galang

, Evangelista

, Deo

R.C.

, and Srivastava

(2015). RNA sequencing of mouse sinoatrial node reveals an upstream regulatory role for Islet-1 in cardiac pacemaker cells. Circ Res, 116, 797–803.

26.

Wahl-Schott

, Fenske

, and Biel

(2014). HCN channels: new roles in sinoatrial node function. Curr Opin Pharmacol, 15, 83–90.

27.

Waldo

K.L.

, Hutson

M.R.

, Ward

C.C.

, Zdanowicz

, Stadt

H.A.

, Kumiski

, et al. (2005). Secondary heart field contributes myocardium and smooth muscle to the arterial pole of the developing heart. Dev Biol, 281, 78–90.

28.

Wiese

, Grieskamp

, Airik

, Mommersteeg

M.T.

, Gardiwal

, de Gier-de Vries

, et al. (2009). Formation of the sinus node head and differentiation of sinus node myocardium are independently regulated by Tbx18 and Tbx3. Circ Res, 104, 388–397.

29.

, Wang

, Song

, Yu

, Sun

, Liu

, et al. (2015). A common Shox2-Nkx2-5 antagonistic mechanism primes the pacemaker cell fate in the pulmonary vein myocardium and sinoatrial node. Development, 142, 2521–2532.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.05 MB