Knockout of Calcyclin Binding Protein Impedes the Growth of Breast Cancer Cells by Regulating Cell Apoptosis and β-Catenin Signaling

Abstract

Breast invasive carcinoma (BRCA) is becoming the most common malignant disease worldwide, and there is intense interest in identifying diagnostic biomarkers that can be targeted for treatment of BRCA. Recent evidence has shown that calcyclin binding protein (CacyBP) can function as either a tumor promoter or suppressor during carcinogenesis. Data in The Cancer Genome Atlas (TCGA) database show that CacyBP is overexpressed in human BRCA tissues, and high levels of CacyBP are associated with shorter overall survival. Immunohistochemical staining has shown that CacyBP levels are high in cancer tissue samples and associated with a higher likelihood of disease progression. We, therefore, conducted a knockout assay to determine the role of CacyBP in the development of BRCA. Knockout of CacyBP significantly inhibited MCF7 cell proliferation and colony formation. Apoptosis was higher in CacyBP knockout cells compared with control cells. Microarray analysis showed that the CacyBP knockout caused dysregulation of numerous genes closely related to β-catenin signaling, whereas quantitative reverse-transcription PCR and immunoblotting showed that it to be inactivated. In summary, we conclude that when overexpressed, CacyBP acts as a potential oncogene for BRCA by regulating β-catenin signaling.

Introduction

According to global cancer statistics reported in 2020, breast invasive carcinoma (BRCA) has become the most frequent malignancy and the fifth leading cause of cancer-associated deaths worldwide (Sung et al., 2021). Based on expression of cell membrane receptors, BRCA patients are divided into three subtypes, with the most common being estrogen receptor (ER)-positive BRCA, the second most common being human epidermal growth factor receptor 2 (HER2)-positive BRCA, and the least common being triple negative BRCA (TNBC) (Harbeck et al., 2019). Based on invasive basic and clinical research, hormone therapies such as tamoxifen and HER2-specific inhibitor have been developed to treat ER- and HER2-positive BRCA patients (Davies et al., 2011; von Minckwitz et al., 2017, 2019). However, these drugs are less effective when treating advanced patients and still, there remains no effective treatment for TNBC patients.

Basic research has identified essential drivers of BRCA progression. The loss-of-function mutation BRCA1 has been proposed as the most important cause of BRCA through regulation of DNA damage repair (Wang et al., 2019). As a result, PARP1 (poly [ADP-ribose] polymerase 1) inhibitor has successfully been used for treatment of BRCA1-mutated BRCA patients (Pantelidou et al., 2019). Extensive genetic studies have shown that PIK3CA (phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha) and TP53 (tumor protein P53) mutations account for more than half of BRCA patients. Inhibitors of PIK3CA have been used for treatment of HER2-positive BRCA patients with mutated PIK3CA (André et al., 2019). Moreover, other oncogenes or tumor suppressors, such as CDH1, PTEN, and MED12, also play important roles during BRCA progression (Csolle et al., 2020; Klatt et al., 2020; Zhang et al., 2021). Nevertheless, specific biomarkers and drivers of BRCA are under investigation for development of precise and effective therapies.

Calcyclin binding protein (CacyBP) was initially demonstrated to be expressed in mouse brain and Ehrlich ascites tumor cells (Filipek and Kuźnicki, 1998). It is a 30-kDa protein that interacts with S100 proteins (Filipek et al., 2002). It has been shown that CacyBP plays an essential role during cancer development. CacyBP is overexpressed in and associated with progression of pancreatic cancer (Chen et al., 2008). Upregulation of CacyBP is also found in gastric cancer patients (Zhai et al., 2015). However, overexpression of CacyBP inhibits in vitro cell growth and in vivo tumorigenesis of gastric cancer cells (Ning et al., 2012). Even though CacyBP is upregulated during breast cancer development in rats (Kilańczyk et al., 2014), downregulation of CacyBP is associated with poor prognosis of human breast cancer patients (Nie et al., 2010). These results indicate that further studies should be conducted to explore the clinical significance and biological function of CacyBP in human cancers.

In this study, we explored the diagnostic potential, biological function, and mechanisms of action of CacyBP in BRCA using The Cancer Genome Atlas (TCGA) database, a knockout strategy, cell biology experiments, and a microarray assay. We demonstrate that CacyBP is a promising oncogene for BRCA that regulates apoptosis and β-catenin (catenin beta 1, CTNNB1) signaling.

Materials and Methods

Analysis of CacyBP using TCGA

To assess the clinical relevance of CacyBP in BRCA patients, we obtained the transcription levels of CacyBP in cancer tissues and adjacent normal tissues from TCGA. BRCA patients were divided into two groups distinguished by high and low expression of CacyBP. Expression of CacyBP in cancer and normal tissues, and the correlation between CacyBP and BRCA overall survival were analyzed using the website http://gepia.cancer-pku.cn/. Our hospital institutional review board approved this study.

Immunohistochemical (IHC) staining of CacyBP

A total of 70 clinical tumor samples and 20 adjacent samples were enrolled in this study at the General Hospital of Ningxia Medical University between 2017 and 2020. This investigation was performed according to the World Medical Association Declaration of Helsinki and approved by the Ethics Committee of the General Hospital of Ningxia Medical University (No.: KYLL-2014-018). Human breast cancer and normal tissues were fixed in 4% paraformaldehyde. 4–5 μm of paraffin-embedded tissues were subjected to IHC staining of CacyBP, following a series of experimental procedures, including, deparaffinization, hydration, antigen repair, goat serum blockage and antibody incubation. CacyBP primary antibody was purchased from Santa Cruz.

Cell culture

The BRCA cell line MCF7 was purchased from ATCC. MCF7 cells were grown in complete culture medium of Dulbecco's modified Eagle's medium (DMEM, Hyclone), comprising 89% DMEM, 10% fetal bovine serum, and 1% antibiotics. Cell culture was maintained in an incubator at 37°C, and CO₂ was kept with 5%.

CacyBP knockout by CRISPR-Cas9

Cells were transfected with a single-guide RNA single vector plasmid and then incubated with puromycin for 16 h. When the cells reached 40–90% confluence, they were trypsinized and the cell suspension was added to a 96-well plate (1000 cells/100 μL/well) and shaken continuously. Eight days later, clones were formed and their DNA sequence was analyzed according to standard protocols. Knockout of CacyBP was checked by a Western blot assay.

Western blot

Total protein was isolated from negative control (Con) and CacyBP knockout (KO) MCF7 cells using lysis buffer (Beyotime) after washing the cells with phosphate-buffered saline (PBS) three times. Protein concentration was detected using a bicinchoninic acid assay kit. Before immunoblotting, the proteins were boiled for 10 min and stained with loading buffer. Then 50 μg of the total protein was loaded onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels followed by immunoblotting onto polyvinylidene difluoride (PVDF) membranes after activation with methanol. The membranes were blocked by 5% nonfat milk for 1 h, then incubated with primary antibodies and secondary antibodies and washed with PBS/tween three times. Finally, protein was detected by chemiluminescence (Thermo Fisher Scientific). The primary antibodies were CacyBP (ab176730; Abcam), CTNNB1 (#8480; CST), CCNA2 (#4656; CST), PCNA (#2586; CST), TR1 (ab73400; abcam), BIRC5 (ab469; Abcam), and GAPDH (SC-32233; Santa Cruz). The secondary antibodies were anti-mouse (sc-2005; Santa Cruz) and anti-rabbit (sc-2004; Santa Cruz) IgG.

RNA isolation and quantitative reverse-transcription PCR

Total RNA was isolated from the Con and KO MCF7 cells using Trizol (Invitrogen), chloroform, and ethanol, according to standard protocols. Then 0.5–1 μg of RNA was subjected to a reverse transcription using M-MLV reverse transcriptase (Promega), according to the manufacturer's instructions. Quantification of cDNA was carried out using a quantitative reverse-transcription PCR (RT-qPCR) mix on a Bio-Rad (IQ5) system. The RT-qPCR primer sequences are listed in Table 1.

Table 1.

Primers for the Target Genes

Gene	Forward (5′-3′)	Reverse (5′-3′)
MCM2	ATGATCGAGAGCATCGAGAACC	GCCAAGTCCTCATAGTTCACCA
EZH2	GTACACGGGGATAGAGAATGTGG	GGTGGGCGGCTTTCTTTATCA
LMNB1	AATGGGAGGCTGGGAGATGAT	TGGTTCTTCCAGATGAGGTCAGTT
CHKA	TTGCTTGAATCTACTCCATCTC	ATCATACATCCACTCACAGAAG
CTNNB1	GGTCTCCTTGGGACTCTTGT	CAGGCTCAGTGATGTCTTCC
FEN1	CACCTGATGGGCATGTTCTAC	CTCGCCTGACTTGAGCTGT
SMAD6	TGAAACGGAGGCTACCAACT	GTCGTACACCGCATAGAGGC
PCNA	TGTCGATAAAGAGGAGGAAGC	ACTGAGTGTCACCGTTGAAGA
SKP2	AGCACATGGACCTATCGAACTC	CACCCAGAAAGGTTAAGTCGC
SRSF1	CTTACCTCCAGACATCCGAACC	AGGAAACTCCACCCGCAGAC
TNFRSF11B	CCTTGCCCTGACCACTAC	TTGCACCACTCCAAATCC
SIRT1	GACTTCAGGTCAAGGGAT	CGTGTCTATGTTCTGGGTA
BIRC5	CAAGGACCACCGCATCTC	CCAAGGGTTAATTCTTCAAACT
RRM2	AAGAAACGAGGACTGATGC	CTGTCTGCCACAAACTCAA
CCNA2	CCCAGAAGTAGCAGAGTTTGTG	TTGTCCCGTGACTGTGTAGAG
GMNN	GGCAGAAGTAGCAGAACAT	GCATCCGTAGAGGAAGATA
ANXA1	GAGGAGGTTGTTTTAGCTCTGC	AGCAAAGCGTTCCGAAAATCT
ATF3	GCTAAGCAGTCGTGGTATG	CTGGAGTTGAGGCAAAGAT
DDIT3	GAACCAGGAAACGGAAACAG	ATTCACCATTCGGTCAATCA
TIMP3	TGGGTTGTAACTGCAAGATCA	GGTAGCCAGGGTAACCGAAA
RUNX1	ATGGCTGGCAATGATGAAA	CACTTCGACCGACAAACCT
CYLD	AGAAGGTCGTGGTCAAGGT	CTGGCAAAACATCACAGAAT
GADD45B	CGGCCAAGTTGATGAATGT	CCCGCACGATGTTGATGT
GADD45A	GAGAGCAGAAGACCGAAAGG	CAGCAGGCACAACACCAC
NUPR1	GCGGGCACGAGAGGAAAC	CTCAGTCAGCGGGAATAAGTC
GAPDH	TGACTTCAACAGCGACACCCA	CACCCTGTTGCTGTAGCCAAA

Cell proliferation assay

When establishing the CacyBP knockout MCF7 cell lines, the negative control and CacyBP knockout cells were seeded in 96-well plates at a density of 3000 cells for each well. Cell proliferation was assessed using an MTT [3-(4,5-dimethyl-2-yl)-2,5-diphenyltetrazolium bromide] assay. MTT solution (5 mg/mL) was added to each well and the plates were maintained in the incubator for 3 h. Then the MTT medium was removed and 100 μL dimethylsulfoxide (DMSO) was added to each well. Cell viability was measured by measuring OD490 with a microplate reader.

Colony formation assay

Con and KO MCF7 cells were seeded in 6-well plates at a density of 1000 cells in each well, and supplied with 3 mL complete culture medium. Two weeks later, culture medium was removed and each well was washed by PBS three times. Then cell colonies were fixed with methanol for half an hour and stained with Giemsa buffer for 20 min. Cell colonies were viewed and images acquired through a microscope.

Bromodeoxyuridine proliferation assay

MCF-7 cells were plated in 96-well plates at a density of 2000 cells/well. Twelve hours later, 10 μL bromodeoxyuridine (BrdU) solution was added to each well. After 24 h, culture medium was removed and each well was incubated with 200 μL FixDenat in the dark for 30 min. The cells were then incubated with 100 μL BSA and with 100 μL anti-BrdU for 30 and 90 min, respectively, in the dark at room temperature. Finally, OD450 was measured to check BrdU uptake according to the manufacturer's instructions.

Cell apoptosis assay

An annexin V-FITC assay kit was applied to analyze cell apoptosis. 6 × 10⁵ Con and KO MCF7 cells were seeded in 6-well plates in triplicate. Forty-eight hours later, cells were collected by treatment with ethylenediaminetetraacetic acid (EDTA)-free trypsin and incubated in 1 × binding buffer. After staining the cells with annexin V, apoptotic cells were analyzed by flow cytometry.

Microarray analysis of transcripts after CacyBP knockout

To detect downstream genes regulated by CacyBP, we subjected total RNA isolated from the Con and KO MCF7 cells to microarray analysis, which was carried out at GeneChem. Genes were considered to be dysregulated if they had a fold change >1.5 and a p-value <0.05.

Statistical analysis

We analyzed statistical significance using SPSS software. The data were presented as mean ± standard error of mean. Student's t-tests or one-way analysis of variance (ANOVA) followed by Tukey's post hoc test were applied to analyze the differences among two or more groups. A p-value <0.05 was considered statistically significant.

Results

Overexpression of CacyBP is associated with progression of human BRCA

Previous studies have shown that CacyBP is overexpressed in osteosarcoma and colon cancer (Feng et al., 2018; Zhao et al., 2020). TCGA is a well-known public database that contains extensive information on gene expression in normal and cancer samples, including BRCA. Based on the information from TCGA, we found that CacyBP is significantly overexpressed in BRCA samples as compared with normal breast tissues (Fig. 1A, p < 0.05). BRCA patients were divided into high and low CacyBP expression groups and patient survival was analyzed. The results showed that higher CacyBP expression predicted poorer overall survival in BRCA patients (Fig. 1B, p < 0.05). We also performed immunohistochemical staining to measure CacyBP protein expression in BRCA patients. We found that CacyBP was more highly expressed in the cancer tissues than in normal tissues (Fig. 1C). CacyBP was highly expressed in 55 of 70 cancer tissues, whereas only 5 of 20 normal tissues had high levels of CacyBP protein (Table 2, p < 0.001). We also analyzed correlations between CacyBP expression and patients' characteristics. The results showed that CacyBP expression was not associated with age. Interestingly, CacyBP expression was higher in patients with stage III/IV than those with stage I/II cancer (Table 3). Furthermore, CacyBP was more highly expressed in patients classified as T2–T3 or with lymph node invasion had higher CacyBP expression than in T0–T1 patients or those without lymph node invasion (Table 3). In summary, CacyBP is highly expressed in BRCA patients and confers poor prognosis.

FIG. 1.

CacyBP expression was analyzed based on TCGA public database and immunohistochemical staining. (A) Transcript levels of CacyBP in BRCA tissues (n = 1085) and noncancer tissues (n = 291) were evaluated from TCGA public database. *p < 0.05. (B) Overall survival was analyzed in a total of 536 BRCA patients who were divided into CacyBP high and low expression group (n = 268 per group). p = 0.03. (C) Immunohistochemical staining of CacyBP in BRCA and noncancer tissues. BRCA, breast invasive carcinoma; CacyBP, calcyclin binding protein; TCGA, The Cancer Genome Atlas. Color images are available online.

Table 2.

The Expression of Calcyclin Binding Protein in Normal Tissue and Breast Cancer by Immunohistochemical

	Tumor tissue	Adjacent tissue	χ²	p
CacyBP high expression	55	5	20.09	<0.001
CacyBP low expression	15	15	20.09	<0.001
Total	70	20

CacyBP, calcyclin binding protein.

Table 3.

Correlation of Calcyclin Binding Protein Expression with Clinicopathological Characteristics in 70 Patients of Breast Cancer

	Characteristic	CacyBP expression		p
	Characteristic	High	Low	p
Age	<50	25	5	0.11
Age	≥50	30	10	0.11
Stage I/II/III/IV	I/II	15	9	0.018
Stage I/II/III/IV	III/IV	40	6	0.018
T classification	T0–T1	17	10	0.012
T classification	T2–T3	38	5	0.012
Lymph node invasion	Yes	42	4	0.0003
Lymph node invasion	No	13	11	0.0003

Knockout of CacyBP reduces MCF7 cell proliferation

To further explore the role of CacyBP in BRCA, we used a CRISPR-Cas9 assay to deplete CacyBP expression in MCF7 cells. When the Con and CacyBP KO cell lines were established (Fig. 2A, B), an MTT assay was conducted to determine cell proliferation. We observed that CacyBP knockout significantly reduced proliferation ability of MCF7 cells (Fig. 3A, p < 0.001). BrdU is a thymine nucleoside analogue and its uptake indicates the rate of cell proliferation rate of cells. We then measured BrdU incorporation and found that CacyBP knockout reduced BrdU uptake in MCF7 cells (Fig. 3B, p < 0.001 at day 4). To confirm the oncogenic role of CacyBP, we showed that knocking it out suppressed MCF7 colony formation (Fig. 3C, p < 0.001). Furthermore, PI/annexin V staining indicated that CacyBP induced apoptosis in MCF7 cells (Fig. 4). These results demonstrated that CacyBP plays an oncogenic role in BRCA cells.

FIG. 2.

Establishment of CacyBP knockout MCF7 cells. (A) Genotyping assay was performed to identify CacyBP knockout cells line. (B) Western blot analysis of CacyBP in sgCtrl and sgRNA2 MCF7 cells. The expression of CacyBP was adjusted to β-actin.

FIG. 3.

CacyBP knockout repressed MCF7 cell proliferation and colony development. (A) Cell proliferation was determined by MTT assay in negative control (Con) CacyBP knockout (KO) MCF7 cells. ***p < 0.001. (B) BrdU intake was examined in Con and CacyBP KO MCF7 cells at days 1 and 4. ***p < 0.001. (C) Colony was developed by day 14 after seeding equal number of Con and CacyBP KO MCF7 cells in 6-well plates. Left, colony formation results. Right, quantification results of colony formation. ***p < 0.001. BrdU, bromodeoxyuridine; MTT, 3-(4,5-dimethyl-2-yl)-2,5-diphenyltetrazolium bromide. Color images are available online.

FIG. 4.

CacyBP knockout induced cell apoptosis. Apoptotic cells were checked by annexin V staining and flow cytometry analysis. Left, apoptosis images. Right, quantification results of cell apoptosis. **p < 0.01. Color images are available online.

Microarray profiling of gene expression in CacyBP knockout MCF7 cells

To explore the downstream effectors of CacyBP, a microarray assay was carried out to detect dysregulated genes in CacyBP knockout cells as compared with Con cells. We found numerous genes that were dysregulated after knocking out CacyBP (Fig. 5A). Ingenuity pathways analysis (IPA) demonstrated that CacyBP knockout resulted in inactivation of CTNNB1 and dysregulation of various CTNNB1-related genes (Fig. 5B).

FIG. 5.

Microarray profiling of gene expression after CacyBP knockout. (A) Heatmap of dysregulated genes (including downregulation of 571 genes and upregulation of 1072 genes) in MCF7 cells of Con and CacyBP KO group. Dysregulation of the genes were set when fold change was >1.5 and p-value was <0.5. (B) IPA analysis showed that CTNNB1 and associated genes were regulated by CacyBP knockout. (C) RT-PCR was conducted to check mRNA expression levels of MCM2, EZH2, LMNB1, CHKA, CTNNB1, FEN1, SMAD6, PCNA, SKP2, SRSF1, TNFRSF11B, SIRT1, BIRC5, RRM2, CCNA2, GMNN, ANXA1, ATF3, DDIT3, TIMP3, RUNX1, CYLD, GADD45B, GADD45A, and NUPR1 in Con and CacyBP KO MCF7 cells. (D) Western blot was conducted to check protein expression levels of CTNNB1, CCNA2, PCNA, TR1, and BIRC5 in Con and CacyBP KO MCF7 cells. The expression of indicated genes was adjusted to GAPDH expression. *p < 0.05. **p < 0.01. ***p < 0.001. IPA, ingenuity pathways analysis; RT-PCR, real time PCR. Color images are available online.

To validate the microarray results, we performed RT-qPCR and Western blot assays to detect the dysregulated genes. RT-qPCR demonstrated that MCM2, EZH2, LMNB1, CHKA, CTNNB1, FEN1, SMAD6, PCNA, SKP2, SRSF1, TNFRSF11B, SIRT1, BIRC5, RRM2, CCNA2, and GMNN were downregulated, whereas ANXA1, ATF3, DDIT3, TIMP3, RUNX1, CYLD, GADD45B, GADD45A, and NUPR1 were upregulated in the CacyBP knockout MCF7 cells (Fig. 5C). Western blotting results demonstrated that CTNNB1, CCNA2, PCNA, TR1, and BIRC5 were downregulated in the CacyBP knockout MCF7 cells (Fig. 5D).

Discussion

BRCA patients are becoming the largest population of human cancers worldwide. An increased understanding of the molecular drivers of BRCA will help to develop effective drugs to cure this malignant disease. In this study, we showed that CacyBP is a promising diagnostic and therapeutic target for BRCA. CacyBP overexpression was not only observed in BRCA samples but also in patients who exhibited poor survival. In vitro experiments showed that CacyBP expression was pivotal for BRCA cell proliferation and colony growth. Thus, we proposed CacyBP as an important oncogene for BRCA.

CacyBP is a 30-kDa protein comprising three domains: a central CHORD and Sgt1 domain, a helical hairpin, and a flexible C-terminal SGT1-specific domain (Lian et al., 2019). Because of its function in regulating the cell cycle, autophagy, and oxidative stress (Rosińska and Filipek, 2018; Jiang et al., 2019; Zhao et al., 2020), CacyBP is considered an important protein for tumorigenesis. Number of literature data have shown that CacyBP is abnormally expressed in human cancer patients and correlates with the growth and migration of cancers. For example, CacyBP expression levels were enhanced in colon cancer (Zhai et al., 2017), gastric cancer (Zhai et al., 2015), glioma (Yan et al., 2018), and hepatocellular carcinoma (HCC) (Lian et al., 2019), but were reduced in breast cancer (Nie et al., 2010). Biological function experiments have suggested that CacyBP may play different roles in regulating cancer cell proliferation and migration. Overexpression of CacyBP increases proliferation of osteosarcoma, HCC, and colon cancer cells (Zhai et al., 2017; Lian et al., 2019; Zhao et al., 2020), whereas proliferation is suppressed in gastric cancer and glioma cells (Ning et al., 2012; Yan et al., 2018). In contrast, one report showed that CacyBP induced by gastrin can enhance the malignant growth of gastric cancer (Zhai et al., 2014). These results indicate that CacyBP exerts distinct functions on cancer cell growth that depend on the type of cancer. Therefore, further studies should be conducted to illustrate whether CacyBP acts as an oncogene or tumor suppressor. In this study, we observed upregulation of CacyBP in BRCA patients. High CacyBP expression was also associated with disease progression of BRCA. In vitro, knockout of CacyBP inhibited BrdU uptake and proliferation capacity of MCF7 cells, and also promoted cell apoptosis.

BRCA is driven by gain-of-function oncogenes or loss-of-function tumor suppressor genes. CTNNB1, EZH2, MCM2, and BIRC5 genes act as tumor promoters in BRCA (Biswas et al., 2020; Khan et al., 2020; Samad et al., 2020; Schwarz-Cruz Y Celis et al., 2020), whereas CYLD represents a tumor suppressor gene in BRCA (Pseftogas et al., 2020). Since CTNNB1, EZH2, MCM2, and BIRC5 were downregulated in the CacyBP knockout MCF7 cells, whereas CYLD was upregulated, we predicted that CacyBP contributed to growth of BRCA cells by regulating expression of these genes. Furthermore, IPA analysis showed that CTNNB1-related genes were dysregulated after knocking out CacyBP. Thus, CacyBP knockout might suppress BRCA cell growth through inactivation of CTNNB1.

Conclusion

In summary, we have demonstrated that CacyBP is overexpressed in BRCA tissues. Patients with high CacyBP expression had shorter survival. Importantly, knockout of CacyBP impeded proliferation and colony formation of MCF7 cells. A large number of oncogenes and tumor suppressor genes are regulated by CacyBP. Thus, targeting CacyBP may be a promising treatment for BRCA.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was financially supported by Natural Science Foundation of China (No. 81460400).

References

André

, Ciruelos

, Rubovszky

, Campone

, Loibl

, Rugo

, et al. (2019). PIK3CAAlpelisib for -mutated, hormone receptor-positive advanced breast cancer. N Engl J Med, 380, 1929–1940.

Biswas

, Mukherjee

, Kondaiah

, and Desai

(2020). Both EZH2 and JMJD6 regulate cell cycle genes in breast cancer. BMC Cancer 20, 1159.

Chen

, Han

, Zhai

, Zhang

, Wang

, Li

, et al. (2008). Expression and clinical significance of CacyBP/SIP in pancreatic cancer. Pancreatology, 8, 470–477.

Csolle

, Ooms

, Papa

, and Mitchell

(2020). PTEN and other PtdIns(3,4,5)P lipid phosphatases in breast cancer. Int J Mol Sci 21, 9189.

Davies

, Godwin

, Gray

, Clarke

, Cutter

, Darby

, et al. (2011). Relevance of breast cancer hormone receptors and other factors to the efficacy of adjuvant tamoxifen: patient-level meta-analysis of randomised trials. Lancet (London, England), 378, 771–784.

Feng

, Zhou

, Yang

, Li

, Liu

, Zhao

, et al. (2018). The effect of S100A6 on nuclear translocation of CacyBP/SIP in colon cancer cells. PLoS One 13, e0192208.

Filipek

, Jastrzebska

, Nowotny

, and Kuznicki

(2002). CacyBP/SIP, a calcyclin and Siah-1-interacting protein, binds EF-hand proteins of the S100 family. J Biol Chem, 277, 28848–28852.

Filipek

, and Kuźnicki

(1998). Molecular cloning and expression of a mouse brain cDNA encoding a novel protein target of calcyclin. J Neurochem, 70, 1793–1798.

Harbeck

, Penault-Llorca

, Cortes

, Gnant

, Houssami

, Poortmans

, et al. (2019). Breast cancer. Nat Rev Dis Primers 5, 66.

10.

Jiang

, Zou

, Zhu

, Liu

, Wang

, Du

, et al. (2019). SIP/CacyBP promotes autophagy by regulating levels of BRUCE/Apollon, which stimulates LC3-I degradation. Proc Natl Acad Sci U S A, 116, 13404–13413.

11.

Khan

, Shukla

, Farhan

, Sinha

, Lakra

, Penta

, et al. (2020). Centchroman prevents metastatic colonization of breast cancer cells and disrupts angiogenesis via inhibition of RAC1/PAK1/β-catenin signaling axis. Life Sci 256, 117976.

12.

Kilańczyk

, Gwoździński

, Wilczek

, and Filipek

(2014). Up-regulation of CacyBP/SIP during rat breast cancer development. Breast Cancer (Tokyo, Japan), 21, 350–357.

13.

Klatt

, Leitner

, Kim

, Ho-Xuan

, Schneider

, Langhammer

, et al. (2020). A precisely positioned MED12 activation helix stimulates CDK8 kinase activity. Proc Natl Acad Sci U S A, 117, 2894–2905.

14.

Lian

, Huang

, Zhang

, Chen

, Wang

, Wei

, et al. (2019). CACYBP Enhances cytoplasmic retention of P27 to promote hepatocellular carcinoma progression in the absence of RNF41 mediated degradation. Theranostics, 9, 8392–8408.

15.

Nie

, Yu

, Wang

, Tang

, Wang

, and Ma

(2010). Down-regulation of CacyBP is associated with poor prognosis and the effects on COX-2 expression in breast cancer. Int J Oncol, 37, 1261–1269.

16.

Ning

, Sun

, Zhang

, Liang

, Chuai

, Li

, et al. (2012). S100A6 protein negatively regulates CacyBP/SIP-mediated inhibition of gastric cancer cell proliferation and tumorigenesis. PLoS One 7, e30185.

17.

Pantelidou

, Sonzogni

, De Oliveria Taveira

, Mehta

, Kothari

, Wang

, et al. (2019). PARP inhibitor efficacy depends on CD8 T-cell recruitment via intratumoral STING pathway activation in BRCA-deficient models of triple-negative breast cancer. Cancer Discov, 9, 722–737.

18.

Pseftogas

, Xanthopoulos

, Poutahidis

, Ainali

, Dafou

, Panteris

, et al. (2020). The tumor suppressor CYLD inhibits mammary epithelial to mesenchymal transition by the coordinated inhibition of YAP/TAZ and TGF signaling. Cancers (Basel) 12, 2047.

19.

Rosińska

, and Filipek

(2018). Interaction of CacyBP/SIP with NPM1 and its influence on NPM1 localization and function in oxidative stress. J Cell Physiol, 233, 8826–8838.

20.

Samad

, Haque

, Nain

, Alam

, Al Noman

, Rahman Molla

, et al. (2020). Computational assessment of MCM2 transcriptional expression and identification of the prognostic biomarker for human breast cancer. Heliyon 6, e05087.

21.

Schwarz-Cruz Y Celis

, Ceballos-Cancino

, Vazquez-Santillan

, Espinosa

, Zampedri

, Bahena

, et al. (2020). Basal-type breast cancer stem cells over-express chromosomal passenger complex proteins. Cells 9, 709.

22.

Sung

, Ferlay

, Siegel

R.L.

, Laversanne

, Soerjomataram

, Jemal

, et al. (2021). Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin, 71, 209–249.

23.

von Minckwitz

, Huang

, Mano

, Loibl

, Mamounas

, Untch

, et al. (2019). Trastuzumab emtansine for residual invasive HER2-positive breast cancer. N Engl J Med, 380, 617–628.

24.

von Minckwitz

, Procter

, de Azambuja

, Zardavas

, Benyunes

, Viale

, et al. (2017). Adjuvant pertuzumab and trastuzumab in early HER2-positive breast cancer. N Engl J Med, 377, 122–131.

25.

Wang

, Xiang

, Liu

, He

, Randle

, Zhang

, et al. (2019). Inadequate DNA damage repair promotes mammary transdifferentiation, leading to BRCA1 breast cancer. Cell, 178, 135–151.

26.

Yan

, Li

, and Liu

(2018). CacyBP/SIP inhibits the migration and invasion behaviors of glioblastoma cells through activating Siah1 mediated ubiquitination and degradation of cytoplasmic p27. Cell Biol Int, 42, 216–226.

27.

Zhai

, Meng

, Jin

, Li

, and Wang

(2015). Role of the CacyBP/SIP protein in gastric cancer. Oncol Lett, 9, 2031–2035.

28.

Zhai

, Meng

, Wang

, Liu

, Li

, and Feng

(2014). CacyBP/SIP nuclear translocation induced by gastrin promotes gastric cancer cell proliferation. World J Gastroenterol, 20, 10062–10070.

29.

Zhai

, Shi

, Chen

, Wang

, Lu

, Zhang

, et al. (2017). CacyBP/SIP promotes the proliferation of colon cancer cells. PLoS One 12, e0169959.

30.

Zhang

, Zhang

, and Hao

(2021). Phenethyl isothiocyanate reduces breast cancer stem cell-like properties by epigenetic reactivation of CDH1. Oncol Rep, 45, 337–348.

31.

Zhao

, Zhang

, Qi

, Chen

, and Zhang

(2020). CacyBP/SIP promotes tumor progression by regulating apoptosis and arresting the cell cycle in osteosarcoma. Exp Ther Med, 20, 1397–1404.